Skip to main content

Full text of "Year book - Carnegie Institution of Washington"

See other formats


Carnegie 
Institution 



OF WASHINGTON 



.- " v V' i.^!>-''::m:\:Hm;^i^^^ 



Carnegie 
Institution 



OF WASHINGTON 



Year Book 76 



1976-1977 



Library of Congress Catalog Card Numh)er 3-16716 

Port City Press, Inc., Baltimore, Maryland 

Issued December 1977 



Contents 



Officers and Staff v 

Report of the President 1 

Reports of Departments and Special Studies 1 

Department of Embryology 3 

Hale Observatories 115 

Department of Plant Biology 199 

Geophysical Laboratory 377 

Developmental Biology Research Group 693 

Department of Terrestrial Magnetism 713 

Bibliography 903 

Administrative Reports 905 

Report of the Executive Committee 907 

Abstract of Minutes of the Eightieth Meeting of the 

Board of Trustees 909 

Financial Statement 911 

Articles of Incorporation 929 

By-Laws of the Institution 933 

Index of Names . 939 



111 



President and Trustees 



PEESIDENT 
Philip H. Abelson 

BOAPvD OF TRUSTEES 

Frank Stanton 
Chaii-man 

William C. Greenough 
Vice-Chaiwian 

William T. Golden 
Secretary 

Kobert 0. Anderson 

J. Paul Austin 

Lewis M. Branscomb 

John T. Connor 

John Diebold 

Michael Ference, Jr. 

Carl J. Gilbert 

Hanna H. Gray 

Crawford H. Greenewalt 

Caryl P. Haskins 

William R. Hewlett 

William MrChesney Martin, Jr. 

Henry S. Morgan 

Waher H. Page 

Robert M. Pennoyer 

Richard S. Perkins 

William M. Roth 

Robert C. Seamans, Jr. 

Charles H. TowTies 

Juan T. Trippe 

James N. White 



Garrison Norton 
Charles P. Taft 

Trustees Emeriti 



Former Presidents and Trustees 



PRESIDENTS 

Daniel Coit Oilman 1902-1904 John Campbell Merriam 

Robert Simpson Woodward 1904-1920 Vannevar Bush 

Canl P. Haskins 195&-1971 



TRUSTEES 



Alexander Agassiz 
Lord Ashby of Brandon 
George J. Baldwin 
Thomas Barbour 
James F. Bell 
John S. Billings 
Robert Woods Bliss 
Amory H. Bradford 
Lindsay Bradford 
Omar N. Bradley 
Robert S. Brookings 
"N'aimevar Bush 
John L. Cadwalader 
William W. Campbell 
John J. Carty 
Whitefoord R. Cole 
Frederic A. Delano 
Cleveland H. Dodge 
William E. Dodge 
Charles P. Fenner 
Homer L. Ferguson 
Simon Flexner 
W. Cameron Forbes 
James Forrestal 
William X. Frew 
Lvman J. Gage 
Walter S. Gifford 
Cass Gilbert 
Frederick H. Gillett 
Daniel C. Oilman 
Patrick E. Haggerty 
John Hay 

Barklie McKee Henry 
Myron T. Herrick 
Abram S. Hewitt 
Henry L. Higginson 
Ethan A. Hitchcock 
Henry Hitchcock 
Herbert Hoover 
William Wirt Howe 
Charles L. Hutchinson 
Walter A. Jessup 
Frank B. Jewett 
Samuel P. Langley 
Ernest 0. Lawrence 
Charles A. Lindbergh 
William Lindsay 
Henry Cabot Lodge 
Alfred L. Loomis 



1904-05 

1967-74 

1925-27 

1934-46 

1935-61 

1902-13 

193G-62 

1959-72 

1940-58 

194g-69 

1910-29 

1958-71 

1903-14 

1929-38 

1916-32 

1925-34 

1927^9 

1903-23 

1902-03 

1914-24 

1927-52 

1910-14 

1920-55 

1948-49 

1902-15 

1902-12 

1931-66 

1924-34 

1924-35 

1902-08 

1974-75 

190^05 

1949-66 

1915-29 

1902-03 

1902-19 

1902-09 

1902 

1920-49 

1903-09 

1902-04 

1938-44 

1933-49 

1904-06 

1944-58 

1934-39 

1902-09 

1914-24 

1934-73 



Robert A. Lovett 
Seth Low 
Wavne MacVeagh 
Keith S. McHugh 
Andrew W. Mellon 
John Campbell Merriam 
Margaret Carnegie Miller 
Roswell Miller 
Darius 0. Mills 
S. Weir Mitchell 
Andrew J. Montague 
William W. Morrow 
Seeley G. Mudd 
William L Myers 
William Church Osborn 
James Parmelee 
Wm. Barclay Parsons 
Stewart Paton 
George W. Pepper 
John J. Pershing 
Henning W. Prentis, Jr. 
Henry S. Pritchett 
Gordon S. Rentschler 
David Rockefeller 
Elihu Root 
Elihu Root, Jr. 
Julius Rosenwald 
William W. Rubey 
Martin A. Ryerson 
Henry R. Shepley 
Theobald Smith 
John C. Spooner 
William Benson Storey 
Richard P. Strong 
William H. Taft 
William S. Thayer 
James W. Wadsworth 
Charles D. Walcott 
Frederic C. Walcott 
Henry P. Walcott 
Lewis H. Weed 
William H. Welch 
Andrew D. White 
Edward D. White 
Henry White 
George W. Wickersham 
Robert E. Wilson 
Robert S. Woodward 
Carroll D. Wright 



1921-1938 
1939-1955 



1948-71 
1902-16 
1902-07 
1950-74 
1924-37 
1921-38 
1955-67 
1933-55 
1902-09 
1902-14 
1907-35 
1902-29 
1940-68 
1948-76 
1927-34 
1917-31 
1907-32 
1916-42 
1914-19 
1930-43 
1942-59 
1906-36 
1946-48 
1952-56 
1902-37 
1937-67 
1929-31 
1962-74 
1908-28 
1937-62 
1914-34 
1902-07 
1924-39 
1934-48 
1906-15 
1929-32 
1932-52 
1902-27 
1931-48 
1910-24 
1935-52 
1906-34 
1902-16 
1902-03 
1913-27 
1909-36 
1953-64 
1905-24 
1902-08 



Under the original charter, from the date of organization until April 28, 1904, the following 
were ex officio members of the Board of Trustees: the President of the United States, the Presi- 
dent of the Senate, the Si:)eaker of the House of Rei)resentatives, the Secretary of the 
Smithsonian Institution, and the President of the National Academy of Sciences. 



VI 



OFFICE OF ADMINISTRATION 

1530 P Street, N.W., Washington, D.C. 20005 

Philip H. Abelson President 

James W. Boise Bursar; Secretary -Treasurer, Retirement Trust; 
Executive Secretary to the Finance Committee 

Marjorie H. Walburn Assistant to the President 

Sheila A. McGough Publications Officer; Editor 

Kenneth R. Henard Assistant Bursar; Assistant Treasurer, 

Retirement Trust 

Joseph M. S. Haraburda Assistant to the Bursar 

Richard E. Hewitt Administrative Officer for Services 



Marshall Hornblower Counsel 

STAFF MEMBERS IN SPECIAL SUBJECT AREAS 

Elhs T. Bolton 
Roj^ J. Britten 
Tatiana Proskouriakoff^ 

DISTINGUISHED SERVICE MEMBER IN SPECIAL SUBJECT AREA 

Barbara McClintock 

RESEARCH ASSOCIATE AT LARGE 

Harry E. D. Pollock 



1 Retired June 30, 1977. 



Vll 



Carnegie Institution of Washington adheres in all phases of its operations, 
including employment and educational programs, to a policy barring discrimina- 
tion on the basis of race, religion, color, national or ethnic origin, sex, or physical 
handicap. In its educational programs it admits qualified students as fellows 
without regard to race, religion, color, national or ethnic origin, sex, or physical 
handicap to all the rights, privileges, programs, and activities generally accorded 
or made available to fellows at the Institution. It does not discriminate on the 
basis of race, religion, color, national or ethnic origin, sex, or physical handicap 
in administration of its educational policies, admissions policies, fellowship 
programs, and other Institution-administered programs. 



Report OF 
THE President 



INTRODUCTION 

AT THE CARNEGIE INSTITUTION it is ouF custom to engage in frequent 
self -appraisal. Every year the professional staff and fellows prepare a 
comprehensive report presenting the results of their research and defending 
its significance. Over the years a rich record of changing aspirations and 
accomplishments has been compiled in these Annual Reports. 

Another tradition of the Institution is that from time to time its presi- 
dents make an assessment of its performance. On the Institution's fiftieth 
anniversary Vannevar Bush prepared such an analysis, together with a 
statement of operating principles that continue to give guidance to our 
efforts. On the sixtieth anniversary Caryl Haskins wrote a superb essay 
detailing past accomplishments and putting the current activities of the 
Institution in the context of the times. This seventy-fifth anniversary is 
the occasion for another long-term view. 

The Institution has modest financial resources and a total professional 
staff that is tiny in comparison to that of many universities. Its accomplish- 
ments, however, have been substantial. Hundreds of postdoctoral fellows 
have received training at our departments, and many of them have gone 
on to make outstanding contributions in their fields. Carnegie staff have 
produced thousands of scholarly works including more than 800 books 
published by the Institution and countless articles in professional journals. 

Judging the significance of scholarly endeavors is difficult, and only a 
few experts can do so with assurance. Some of our activities, however, have 
led to important practical applications whose value is more easily assessed. 

In addition, there are the very important contributions that the Institu- 
tion made to the national defense in two world wars by furnishing leader- 
ship in the mobilization of scientists well ahead of the declaration of w^ar. 
Staff members also made substantial contributions in the application of 
science to the war efforts. 

The well-documented history of the Carnegie Institution reveals an 
enormous number of activities and contributions. Only part of these could 
be cited. The criterion for selection was that an activity or accomplishment 
made a difference. That is, had the Institution not conducted its programs, 
the history of science, technology, or the country would have been different. 

As might be expected most of the examples of Carnegie achievements 
are drawn from the past. Often decades must pass before the significance 
of a program is fully evident. However, staff of our departments are 
pioneering scientifically and practically in new directions. Moreover, the 
policies of the Institution are especially effective in fostering creativity. 
Discussion of these matters follows treatment of outstanding accomplish- 
ments. 

3 



4 CARNEGIE INSTITUTION 

LEADERSHIP IN WORLD WAR II 

The many books about applications of science during World War II 
make clear tlie importance of Vannevar Bush, then President of the 
Carnegie Institution. He was instrumental in the creation of the National 
Defense Research Connnittee. and served as its Chairman. Later he directed 
the Office of Scientific Research and Development. His office, and the 
nerve center of research and development for national defense, was the 
Carnegie administration building at 1530 P Street in Washington. 

By training and profession Bush was an electrical engineer. For most 
of his career he had been associated with the Massachusetts Institute of 
Technology, where he served as Vice President and Dean of Engineering 
from 1932 to 1938. In 1938 he was elected President of the Carnegie 
Institution of Washington. There is no record of the considerations that 
went into the selection of Bush, nor of the factors that caused him to 
accept the office. But we can assume that Bush and the Trustees were 
following the events unfolding in Europe. Hitler was on the march: He 
had already moved into the Rhineland, swallowed Austria, and rendered 
Czechoslovakia defenseless. Whatever ambitions Bush might have had for 
leadership in the coming conflict, one thing is clear. As second in command 
at M.I.T. there was little chance that he would have a national role to play. 

But as president of one of the nation's leading scientific organizations, 
with headquarters in Washington, his status was much changed. Bush 
already had some contacts in Washington as a member of the National 
Advisory Committee for Aeronautics, and soon after becoming President 
of Carnegie Institution, he was named Chairman of the N.A.C.A. This 
brought him into even closer contact with official Washington, including 
Congressional committees. One of the contacts that automatically followed 
his move to Carnegie was with Frederic Delano, who served as Secretary 
of the Board of Trustees from 1930 to 1948. Mr. Delano was an uncle of 
Franklin Delano Roosevelt, and the younger man often counseled with 
his relative. 

In his book Pieces of the Action Bush mentioned nothing about his 
relationship with Delano or his thoughts on the move to Washington. His 
story begins in 1940 during the so-called phony war. At that time, many 
people thought the Maginot Line in France would hold back the Germans 
anrl that the I'nited States could avoid involvement. But many scientists 
and engineers, including Bush, were dubious. The lack of preparedness in 
this country made them uneasy. They were especially troubled that the 
armerl forces were doing so poorly in applying science to military hardware. 
Aside from improvements in aircraft and the Naval Research Laboratory's 
work in developing radar, little was being done. 

On the civilian side, there were the National Academy of Sciences, 



REPORT OF THE PRESIDENT O 

which had been created during the Civil War to advise the government, 
and the National Research Council, an arm of the NAS established for 
the same purpose during World War I. Both organizations had the same 
weakness: Their charters specified that they were to advise the govern- 
ment only when asked. 

The atmosphere in Washington changed drastically in May and early 
June 1940 as the German armies overran France and the Lowlands. 
England was in peril, and the resources of Western Europe were available 
to Hitler. 

Bush was ready with a plan for a National Defense Research Com- 
mittee. He had already established a good relationship with Roosevelt's 
closest aide, Harry Hopkins, and so was able to bring his plan to President 
Roosevelt under favorable sponsorship. It was set forth in four paragraphs 
on one sheet of paper, and F.D.R. initialed it during a ten-minute meeting 
with Bush. 

In the next few days Bush talked the matter over in greater detail with 
Harry Hopkins and submitted to the President a list of proposed members 
of the N.D.R.C. These included F. B. Jewett, President of the National 
Academy of Sciences, and Conway P. Coe, Commissioner of Patents, both 
to serve ex officio. Other members were J. B. Conant, President of Harvard 
University; Karl Compton, President of Massachusetts Institute of Tech- 
nology; and Richard C. Tolman, Dean of the Graduate School, California 
Institute of Technology. Later Roger Adams, head of the Department of 
Chemistry, University of Illinois, was added as well as representatives of 
the Army and Navy. 

In Pieces of the Action Bush made what was for him an unusually 
blunt statement : 

There were those who protested that the action of setting up 
N.D.R.C. was an end run, a grab by which a small company of 
scientists and engineers, acting outside established channels, got 
hold of the authority and money for the program of developing 
new weapons. That, in fact, is exactly what it was. Moreover, 
it was the only way in which a broad program could be launched 
rapidly and on an adequate scale. To operate through established 
channels would have involved delays — and the hazard that inde- 
pendence might have been lost, that independence which was the 
central feature of the organization's success. The one thing that 
made launching it at all possible was the realization by the 
President that it was needed. 

Immediately after obtaining a charter, the N.D.R.C. set up an effective 
organization, and soon top scientists were responding eagerly to invitations 
to participate. 

There was never any question who was Chairman of N.D.R.C. or, sub- 



6 CARNEGIE INSTITUTION 

sequent ly. who was Director of the Office of Scientific Research and De- 
\elopnient. A chain of command and a pyramid structure \vere maintained 
at all times. But tlie chain carried connnunications in both directions. A 
good idea could easily move from below to the top. 

No research and development was carried out at headquarters. But there 
were an enormous number of tasks to be performed in Washington if 
defense research was to be conducted smoothly and effectively. Besides, a 
new device was worthless unless it was manufactured, deployed, and used 
properly. Bush was superb in all aspects of expediting. 

A most impressive feature of Bush's performance was the surefooted way 
he operated in what is to many the Washington jungle. He enjoyed in- 
creasingly cordial relations at the White House, and Roosevelt came to 
depend on him as his science adviser. Bush won the good will of the rele- 
vant committees of Congress, and he managed to evade problems created 
by bureaucrats. Establishing good w^orking relations with the Armed 
Forces took some doing. There was suspicion at mere civilians dabbling in 
matters considered to be in the province of the military. There was also a 
natural concern about secrecy. Later these attitudes changed as a result of 
achievements and the demonstrated ability to keep secrets. 

In technical matters. Bush made decisions quickly. He sought the best 
counsel, but even w^hen his advisers were uncertain, he was decisive. In 
his directing of scientific efforts for national defense. Bush brought to the 
situation a remarkable set of talents: good judgment, organizational know- 
how, political adroitness in the best sense of the words, decisiveness, and 
integrity. The Carnegie family is proud of his accomplishments and pleased 
that the presidency provided his base of operations. 



Proximity Fuze 

In terms of the effect on the course of combat, the VT (variable time) 
proximity fuze was probably the most important technical improvement 
in weaponry to come out of World War II. It was essentially a radio set in 
an artillery shell. When the shell came close to a target, the radio circuit 
triggered the detonation. Before the war no such device existed, but by 
the end of the war tens of millions of the fuzes had been assembled at a 
cost of many billions of dollars. Artillery using such shells was five to ten 
times more effective in knocking down enemy aircraft, for example, than 
artillery using conventional contact detonators. The fuze was extremely 
useful to the Navy in the Pacific in destroying enemy bombers and kami- 
kazes. It was crucial against the V-1 buzz bombs: On the last day of those 
attacks, 100 of 104 buzz bombs failed to reach their targets. The VT fuze 
was used in ground combat for the first time in December 1944, when it 



REPORT OF THE PRESIDENT / 

helped turn back the Germans' Ardennes offensive (the ^'Battle of the 
Bulge"). The enemy was astounded by the effectiveness of our artillery fire. 

Many individuals had independently thought of making a proximity 
fuze. But a few moments' consideration of the practical problems stopped 
most of them. When a shell is fired from a gun, it undergoes an accelera- 
tion 20,000 times that of gravity. In addition, the rifling of the barrel 
imparts a rapid spin to the shell with correspondingly great centrifugal 
forces. Vacuum tubes then commercially available could not withstand 
such forces. If the tubes were strengthened, vibration of the tube elements 
during flight could lead to premature firing. A further constraint was that 
the fuze had to be small enough to fit inside an artillery shell. 

One Sunday in August 1940, Merle Tuve burst into the laboratory of 
a colleague at the Carnegie Department of Terrestrial Magnetism (DTM). 
He had been listening to radio reports of a massive air raid on London, 
and he was greatly disturbed by the destruction and the civilian casualties. 
He spoke with determination of the necessity to develop better antiaircraft 
defense. 

On August 17, 1940, Tuve received the directive he needed from the 
National Defense Research Committee to develop ^^influence" fuzes. At 
that time Tuve, the Chief, had at his disposal four Carnegie ^'Indians" — 
Lawrence R. Hafstad, Richard B. Roberts, George K. Green, and Robert 
Myers. They were energetic, innovative physicists, but their experience 
with ordnance amounted to a few weeks in summer R.O.T.C. camp. 

But by the evening of the day Tuve got his go-ahead, they had already 
shown that some vacuum tubes could withstand 5000 g, and in the next 
few days their results were even more encouraging. They put a tube inside 
a lead ball and dropped it from the top of a building at DTM onto a 
concrete pad. From the indentation of the lead, they were able to show 
that the tube had withstood a force of 20,000 g. They realized, though, 
that an acceleration of short duration was not equivalent to the longer 
effect in a gun, so they built their own cannon for more realistic testing. 

In the months that followed, Tuve expanded the scientific and engineer- 
ing staff at DTM to 100. He also negotiated contracts with outside com- 
panies for development of rugged components. At the same time he w^as 
already looking ahead to the use of proximity fuzes in combat. For example, 
he was concerned that gun crews should not be exposed to the hazard of 
premature explosion, so he saw to it that the fuzes were designed with 
many safety features. 

During the succeeding phases, encouraging developments were followed 
by a continuing series of almost crippling discouragements. It seemed 
that everything that could go wrong went wrong. But the effort to over- 
come unexpected problems was relentless. Failures were analyzed and the 
necessary countermeasures devised. 



8 CARNEGIE INSTITUTION 

By January 1942 a model of the VT fuze had been successfully tested 
by the Navy, and the fuze was in pilot-scale production, with full-scale 
production ordered. At that point the cost of development to the govern- 
ment was only SI million. In March the proximity fuze project was trans- 
ferred from DTM to the new Applied Physics Laboratory of The Johns 
Hopkins University, where development continued on an expanded scale 
with Tuve still in charge. ]\Iany other models of the fuze were devised 
there, and large-scale production was monitored. 

Tuve was a tough taskmaster who did not allow his organization to 
become complacent from success. There was much work to do in improving 
reliability of the fuzes and in tailoring them to be more highly effective 
against specific types of targets. Something of the philosophy with which 
the organization operated was encapsulated in the following quotation 
from Xew Wcapo?is for Air Warfare, edited by Joseph C. Boyce: 

Nothing can iUiistrate the spirit with which Tuve infused his 
workers hetter than the following representative set of ^'Section 
T Verbal Rules," or unwritten informal ^'operating rules." The 
elastic organization of the Applied Physics Laboratory allowed 
full scope for the operation of these rules. Under this code of 
operation it was surprising to note to what degree the initiative 
and personal responsibility of staff members expanded. . . . 

Operating Rules 

1. "1 don't want any d — n fool in this laboratory to save 
money, I only want him to save time. 

2. "We don't want the best unit, we want the first one. 

3. ''There are no private wires from God Almighty in the lab 
that I know about — certainly none in my office. 

4. "The primary duties of any supervisor are initiative and 
forethought, he is supposed to make his team do the work. 

5. "Any function or area of a total job which can be described 
and manned should be assigned. Articulate your work. 

6. "The trouble is always at the top. 

7. "The Navy says so! Who is the Navy? That was only the 
opinion of the man you were talking to. 

8. "A good short paper in your hand at the right instant and 
place is a marvelous hatchet for getting action. ^Red tape' is a 
tool; use it, but use discrimination in your paper work. 

9. "Responsibility and authority always have the same bound- 
aries; this is axiomatic. 

10. "Our moral responsibility goes all the way to the final 
battle use of this unit; its failure there is our failure regardless 
of who is technically responsible for the cause of failure. It is our 
job to achieve the end result. 



REPORT OF THE PRESIDENT 9 

11. ''Run your bets in parallel, not in series. This is a war 
program, not a scientific program. 

12. 'The final result is the only thing that counts, and the only 
criterion is, does it work then. 

13. "Shoot at an 80% job, just a passing grade, we can't afford 
perfection. Don't try for an A, in a war a D is necessary and 
enough but an F is fatal. Don't forget that the best job in the 
world is a total failure if it is too late." 

The consequences of this pragmatic philosophy were displayed in con- 
nection with the German buzz bomb. Tuve learned that the enemy might 
be developing such a device. Long before the British were convinced of 
the need for ground-based anti-buzz bomb devices, the appropriate fuze 
had been developed at the Applied Physics Laboratory, production had 
begun, and large quantities of fuzes had been sent to England. The British 
attempted to cope with the buzz bomb using their aircraft. This effort was 
only partially effective. When the task was assigned to artillery located 
near the coast of England and equipped with the proximity fuze, the buzz 
bomb attack was stopped. 



LEADERSHIP IN WORLD WAR I 

When Vannevar Bush took the initiative in mobilizing scientific effort 
for national defense during a world war, he was not the first Carnegie 
person to do so. George Ellery Hale, then Director of the Mount Wilson 
Observatory, had played a similar role in World War I. 

In July 1915, shortly after the sinking of the Lusitania, he proposed 
to the President of the National Academy of Sciences that the services 
of the Academy be offered to President Wilson for the purpose of organiz- 
ing scientific research agencies to foster national preparedness. This pro- 
posal was not acted on immediately. But Hale was Foreign Secretary of 
the Academy and thus a member of its Council, and another submarine 
attack created an opportunity for him to try again. This time he brought 
the matter up himself, and in April 1916 the Council adopted the follow- 
ing resolution : 



Resolved, That the President of the Academy be requested to 
inform the President of the United States that in the event of a 
break in diplomatic relations with any other country the Academy 
desires to place itself at the disposal of the Government for any 
service within its scope. 

President Wilson accepted this offer and asked that the Academy coor- 
dinate the country's scientific resources and secure the cooperation of all 



10 CARNEGIE INSTITUTION 

agencies, governmental, academic, and industrial, in which research facili- 
ties were available. 

Hale was named chairman of the organizing committee whose activities 
led to the formation of the National Research Council on September 20, 

1916. Hale served as Chairman of the NRC until April 30, 1919. Under 
his leadership there was substantial mobilization of scientific effort. 

Hale did not confine his attention to the United States. In the spring 
of 19 IS. he submitted to the Council of the National Academy a ^'Sug- 
gestion for the International Organization of Science and Research," partly 
to secure closer cooperation among the scientific men of the Allies in the 
solution of war problems and partly to build a framework for international 
cooperation in research after the war. This suggestion was adopted by the 
Council and Hale, as chairman of the American delegation, presented it 
at a conference of Academies called by the Royal Society in London in 
October 1918. Hale's initiative led directly to the creation of international 
scientific unions and to a superstructure to coordinate them — the Inter- 
national Council of Scientific Unions, which is today a vital force for 
bringing about international scientific cooperation. 

Optical Glass 

At the beginning of World War I, Jena in Prussia was the world's center 
for the manufacture of high grade optical glass. In consequence, the 
Germans enjoyed superiority in the various devices that required such 
glass, including scientific instruments and military optics. The United 
States manufactured ordinary glass, but the product was inferior for optical 
applications. When the United States entered the war, a serious shortage 
of optical glass was felt at a time of enormous demand for new ordnance. 

Scientists at our Geophysical Laboratory had no experience in the com- 
mercial production of glass. But their laboratory experience with silicate 
melts and especially their understanding of phase equilibria in silicate 
systems were unique, and that knowledge proved to be decisive. Leason H. 
Adams and E. D. Williamson quickly outlined a faster, superior method 
of annealing. Frederick E. Wright devised a highly sensitive technique of 
quality control of the finished glass. 

In April 1917, Arthur L. Day, Director of the Geophysical Laboratory, 
was asked to guide research to aid the country's optical glass production. 
Fred Wright went to the Bausch & Lomb plant in Rochester, New York, 
anr] applied his knowledge to improving production. At the same time, he 
became familiar with the techniques of commercial glassmaking. By June 

1917, Wright had been put in charge of production of optical glass at 
Bausch (fe Lomb and was turning out a high quality product. The progress 
there was so impressive and the demand for glass so great that the Geo- 



REPORT OF THE PRESIDENT 11 

physical Laboratory was invited to take charge of production at two other 
major plants. 

The United States had entered the war in 1917 importing all its optical 
glass. By late in the war, it was a net exporter of optical glass. Of the 
675,000 pounds of glass produced for war purposes, 95% was made under 
the direction of the Geophysical Laboratory, with 10 men in the field and 
13 at work at the Laboratory. 



PEACETIME ACTIVITIES 

During major wars members of the Institution showed their flexibility 
in tackling highly practical tasks. Their efforts involved high priorities, 
short deadlines, and management decisions affecting many thousands of 
lives. 

During peacetime, the tempo and outlook of staff members are com- 
pletely different. Instead of secrecy, the policy is complete openness. In- 
stead of a highly directed effort, the guiding principle is maximum indi- 
vidual initiative. Instead of immediate objectives, the goals are long range. 
Instead of emphasis on quick practical applications, there is a search for 
understanding. But at Carnegie the ivory towers have windows, and the 
staff are aware of society's needs. 

Thus it should not be surprising that some of the fundamental research 
conducted by the Institution has resulted in important practical ap- 
plications. These include hybrid corn, radar, geophysical prospecting 
equipment, improved ceramics, refractories, glass, and cement. These 
achievements alone abundantly justify the existence of the Institution. 
Measured in dollars, the cumulative benefit to society of development of 
hybrid corn has been more than $100 billion. In contrast, the total endow- 
ment of Carnegie Institution was $32 million and the cumulative expendi- 
tures have been about $180 million. 

But the major contributions of the Institution are not measurable in 
financial terms. They are parts of a grand edifice of knowledge in the 
design of which the Institution has had a significant role. 

Department of Terrestrial Magnetism 

During the first half of its existence, beginning in 1904, the Department 
of Terrestrial Magnetism maintained a program consonant with its name. 
But in the last three decades the activities have been much broader than 
the name, and the Department has been a leader and made major contri- 
butions in many fields. Its role in creating and fostering the discipline of 
geophysics was crucial. 



1-3 CARNEGIEINSTITUTION 

When Carnegie's Department of Terrestrial Magnetism was established, 
the earth's magnetic and electric fields had been explored in only a few 
areas. Little was known about the oceans, covering three quarters of the 
area of the globe, or about the vast polar regions. To fill in these gaps in 
oiu' knowledge of the earth, the Department launched a major program 
oi magnetic observation. From 1909 until her destruction by fire in 1929, 
the nonmagnetic brig Carnegie made seven long cruises, covering all the 
oceans and reaching the boundaries of the north and south polar-ice areas. 

In those days, knowledge of the earth's magnetic field was particularly 
useful for ships at sea. During World War I, the staff helped develop a 
magnetic navigational device for aircraft, and they were a little ahead of 
the times in developing the magnetic mine. 

From about 1920 to 1940. the Department was the world's leading center 
for geophysics. One of the most far-reaching events of that period was the 
invention of radar and its use in studies of the ionosphere. Commenting on 
this development in Carnegie Year Book 51, Vannevar Bush wrote, "Radar, 
in its essence, is the method of locating objects in space by propagating a 
beam of short pulses of electromagnetic energy and measuring the time 
between the pulse and its echo at the sending station. The pulsation is an 
essential element of the process. On July 10, 1925, Merle A. Tuve and 
Gregory Breit, then both of the Department of Terrestrial Magnetism, 
sent out pulses from a Navy transmitter they had modified for the purpose 
and observed echoes from the ionosphere. During the next few years, as 
they were studying the ionosphere, they were troubled by echoes coming 
from airplanes, which interfered with their measurements. These experi- 
ments introduced the first effective electrical method of surveying the 
ionosphere and the first observation of the echoes of pulses from airplanes." 
Later this radar method was developed further by Lloyd V. Berkner and 
others to permit measurement of variations of the electron density and 
heights of ionized layers of the ionosphere. Such changes in the ionosphere 
are closely related to radio communication. Suitable practical and auto- 
matic apparatus was developed to send radio pulses yielding echoes from 
the ionosphere which were continuously recorded at a wide range of 
frequencies. These measurements provided a record of events throughout 
the range of about 100 to 300 km and higher within the ionosphere, for 
study in connection with geomagnetic and other phenomena observed at 
ground level. 

Based in part on the studies of oceanic electrical measurements con- 
ducted aboard the Carnegie, staff at DTM discovered that the negative 
electric charge over the earth's surface as a whole varied periodically by 
about 30% of its average magnitude every 24 hours, independently of 
local time. This finding led two Staff Members, George R. Wait and Oliver 
H. Gish, to investigate the role of thunderstorms. In 1947 and 1948 Wait 



REPORT OF THE PRESIDENT 13 

and Gish, then close to retirement age, made 65 traverses over the center 
of thunderstorms at altitudes of up to 48,000 feet. They found that in 
some storms a substantial current flowed in a direction opposite that noted 
in fair weather. From these observations they were able to prove that 
thunderstorms are the source of the current maintaining the earth's nega- 
tive charge, which would otherwise be reduced to a fraction of its observed 
value in a matter of minutes. 

Gish, along with William J. Rooney, was also responsible for new experi- 
mental approaches to the study of natural and induced earth currents. 
They found that the time variations in earth-current potentials are pro- 
duced by variations in geomagnetic fields of external origin. One practical 
result of their studies was a technique of measuring earth resistivity which 
is still widely used in geophysical prospecting. 

To the staff of DTM, physics has never been just a matter for laboratory 
study. Like the long, dangerous voyages on the Carnegie and the flights 
of Wait and Gish over electrical storms, DTM's worldwide observatory 
program has been a means of recording physical phenomena right at the 
source. For example, in the 1930s seismographs were installed at Huancayo, 
Peru. And Carnegie's Cosmic Ray Committee sponsored a network of 
observatories in Maryland (USA), Peru, New Zealand, Mexico, Greenland, 
and Puerto Rico. Staff Member Scott Forbush used data from these sta- 
tions to show that the sun emits cosmic rays. 

Some of the other terrestrial-solar phenomena that are better under- 
stood because of the Department's observatory program are: the deter- 
mination that the daily and lunar geomagnetic variations are caused by 
the ultraviolet radiation from the sun and the motions of the upper 
atmosphere in the presence of the earth's magnetic field; closer linkage of 
specific (solar flare) and average solar conditions with variations in geo- 
magnetism, the ionosphere, aurora, and cosmic rays; and the description 
of worldwide geomagnetic variations of various periods at different times 
in the sunspot cycle and their possible electric current systems in the 
atmosphere. The results of the observatory program were also useful in 
practical applications such as the improvement of long-distance radio 
transmission. 

Nuclear Physics 

In the 1930s and shortly thereafter, DTM was a leading center for 
nuclear physics. The study of the atomic nuclear reactions was then just 
beginning in this country. Merle Tuve pioneered in the construction and 
use of Van de Graaf generators for the observation of nuclear forces and 
reactions. The paper by Tuve, Lawrence R. Hafstad, and Norman Heyden- 
burg on proton-proton scattering was widely hailed. The work established 



IJf. CARNEGIE INSTITUTION 



the nature of forces existing when two charged bodies come close together. 
This was in effect the first measurement of the diameter of a proton 
(10~^^ cm). Tuve also served as a catalyst in the interaction of nuclear 
theoretical physicists. Superb conferences on this topic were held each 
year: they included leaders like Bohr, Fermi, Wigner, Bethe, Teller, and 
Gamow. Out of one of those conferences came Bethe's first explanation 
of nuclear reactions in the sun. At another conference, in January 1939, 
Bohr first disclosed to an American group the discovery of uranium fission. 
That night the discovery was confirmed at DTM. Shortly after that, 
Richard Roberts and Robert C. Meyer discovered delayed emission of 
neutrons during uranium fission. This delayed emission is crucial to the 
control of present-day reactors. 

Early in 1940 P. H. Abelson arrived independently at the hypothesis 
that element 93 (neptunium) was being formed during irradiation of 
uranium by neutrons. He devised a chemical method for testing this 
hypothesis and proved it to be correct in joint research with Edwin Mc- 
Millan at Berkeley. Proof of the existence and properties of neptunium 
was obtained in five days of effort. He then developed a liquid thermal 
diffusion method for separating uranium isotopes. Work on the process 
was later fostered by the Navy and the method was ultimately used in 
the ^lanhattan Project to speed the production of the first substantial 
amounts of U^^^. 



Biophysics 

The time immediately following World War II was one of reevaluation 
and new beginnings. Tuve, Roberts and Abelson agreed that to participate 
at the forefront of nuclear physics would involve building huge and costly 
accelerators or working on secret projects such as new weapons systems. 
But that kind of research would have been incompatible with a peacetime 
Carnegie Institution. They wanted to engage in research more likely to 
leave a constructive residue. The group decided that biophysics held the 
opportunities they were looking for. Their reasoning was that physicists, 
with their penchant for analysis and separation of variables and their 
ability to devise new instrumentation, might be able to crack some of the 
complex puzzles in the realm of living matter. 

One of their first projects was a series of experiments using radioactive 
tracers that permitted insights into the dynamic character of biological 
processes. By 1951 the Biophysics Section had crystallized. There were 
four physicists — Roy J. Britten, Dean B. Cowie, Roberts, and Abelson — 
and a biologist, Ellis T. Bolton, whose background included service as a 
radar officer in the Marine Corps during World War II. 



REPORT OF THE PRESIDENT 15 

The group concentrated on studies with the bacterium Escherichia coli. 
That organism had been chosen because of its supposed simplicity. Actu- 
ally, within a volume of a fraction of a cubic micron, thousands of 
coordinated chemical reactions go on in E. coli, and thousands of enzymes 
function in harmony. Given proper nutrients and conditions, the organisms 
are highly dependable. They are also very efficient. 

Using radioactive tracers, the Biophysics Section explored the marvelous 
capabilities of that very competent chemical engineer, E. coli. For example, 
it was found that when a chemical that E. coli would ordinarily synthesize 
and use is added to the medium, in many cases the bacteria stop mak- 
ing the chemical and obtain it from the medium. And if a substance 
is added that is a chemical intermediate in the synthesis of a final product, 
the bacteria may stop synthesis of the intermediate and pick it up instead 
from the medium. This discovery enabled the group to work out in detail 
the synthetic pathways. Supplementary studies with other microorganisms 
showed that they use many of the same kind of synthetic pathways found 
in E. coli. These studies led to numerous journal articles and were brought 
together in a book published in 1955, Studies of Biosynthesis in Escherichia 
coli, which won acclaim from microbiologists around the world. 

There were also benefits from the activities of the Biophysics Section 
not measured in the scientific literature. Members of the group shared 
in an exciting learning experience in which each taught the others. At the 
time, they were in their late thirties, but intellectually they were like 
youngsters in university. They experienced a thrilling rejuvenation. 

Abelson left the Biophysics Section and DTM in 1953 to become Di- 
rector of the Geophysical Laboratory. There he used some of the knowledge 
and techniques he had acquired in a new venture in organic geochemistry. 
The Biophysics Section continued its creative ways. In the next 20 years it 
produced about 200 professional papers and two additional books. Roberts 
listed 18 of the Section's achievements in an historical summary which 
appeared in Year Book 7^. 

Two major areas of the later studies stand out. One had to do w^ith 
macromolecules. A second involved the structure of chromosomes. 

In a series of imaginative experiments, the group was able to show for 
the first time that the machinery of protein synthesis consisted of ribo- 
somes. Other studies of ribosomes led to four papers describing the kinetics 
of synthesis of ribosomes including both nucleic acid and the protein 
components. The group also demonstrated that in newly formed bacterial 
RNA, one third is messenger RNA and the rest, ribosomal precursor. 

A useful technique for studying RNA was to immobilize single-stranded 
DNA on an agar column. Complementary RNA could then be immobilized 
on the bound DNA. Complementary DNA could also be held up. This 
technique, invented by Bolton and Brian J. McCarthy, led to another 



16 CARNEGIE INSTITUTION 

column procedure in which the mineral hydroxyapatite formed the column 
bed. Double-stranded DNA is bound to the column while single-stranded 
DXA passes through. These techniques led to studies of the relatedness of 
DXAs from various organisms. Later, they also made possible an important 
finding about the structure of DNAs from all animals. 

When chromosomes are heated in a solution to about 85°C, the double 
strands dissociate into single strands. If the solution is cooled to about 
GO^'C. the strands find their appropriate complementary mates and re- 
associate rather quickly. If the chromosomes are cleaved into smaller pieces 
and the heating and partial cooling procedure is followed again, the pieces 
reassociate. If unrelated DNA is introduced, it does not interfere with the 
reassociation. 

Using these techniques, Britten made discoveries that have been de- 
scribed as the most important advances in genetics of the past 15 years. 
He found that chromosomes of an animal contain many repeated identical 
structures. For several years, most of the work of the Biophysics Section 
was devoted to exploring the ramifications of this finding. 

Among the discoveries were: (1) Repeated DNA sequences were noted 
in all species tested in all the various phyla above the fungi. (2) From 
20'7r to SO^r of the total nuclear DNA was repeated DNA. (3) In a given 
genome there were many families each having from 50 to 20,000,000 
related sequences. (4) The degree of relatedness within families ranged 
from bare detectability to nearly perfect identity. (5) The repeated DNA 
sequences were scattered throughout the length of the genome. (6) Pat- 
terns of frequency of repeated DNA vary widely even among vertebrates. 
(7) RXA complementary to some repeated DNA sequences has been ob- 
served in every cell type examined. (8) Different sets of repeated sequences 
are transcribed in different tissues and stages of development. 

This significant work could be undertaken because of the unique struc- 
ture of the Carnegie Institution, which encourages to an unusual degree 
the taking of creative scientific risks. In few if any other places in America 
could a handful of scientists previously untrained in a discipline be 
nurtured in it to a point of such high achievement. 

Crustal measurements. In 1946 Tuve and his co-workers undertook the 
first continuing program of deep crustal measurements with instruments 
adequate to the task. At that time the ideas of R. A. Daly, H. Jeffreys, 
and B. Gutenberg concerning a simple layered structure of the crust were 
very influential, and questioning those ideas was not fashionable among 
seismologists. 

For the next seven years the DTM group had this field nearly to 
itself. New instruments were developed which improved the sensitivity 
to the subangstrom level, and new techniques, such as subcritical reflec- 
tions, were used to identify the base of the crust. Tuve's group found that 



REPORT OF THE PRESIDENT 17 

the evidence for a layered crust was more of a mathematical convenience 
than a geophysical reality, and that the thickness of the crust was highly 
variable and not in accordance with previous notions of isostatic com- 
pensation. Various seismic arrivals which had been interpreted as indicating 
crustal layering were found to be only locally coherent and of no funda- 
mental significance, and p-wave velocities in the uppermost mantle were 
shown to be variable. All this went against prevalent geophysical theory, 
but gradually the power of this method and the significance of these results 
were recognized. These pioneering studies gave seismologists the tools they 
needed ten years later, when nuclear test detection became an issue. The 
seismic community took the opportunity to increase our knowledge of 
the earth while carrying out a practical political task. 

In contrast, the need for a practical method of measuring geological 
time was generally recognized in the late 1940s. But the direction opened 
so brilliantly by University of Minnesota physicist A. 0. C. Nier during 
the 1930s was not favored, on the grounds that the required instrumenta- 
tion and chemical techniques were beyond those feasible in a geological 
laboratory. 

The DTM group, led by L. Thomas Aldrich, with collaborators at the 
Geophysical Laboratory, took up where Nier left off and made the measure- 
ments needed to really understand what was going on with isotopes in 
rocks. The currently accepted decay constants for potassium and rubidium 
were found to be seriously in error. The conditions under which natural 
systems were chemically open were identified, and the basic distribution 
of rocks as a function of age was established for several continents. 

By about 1958, it was recognized that the Carnegie approach was su- 
perior, and the field grew rapidly during the next decade. By 1969 when 
the lunar samples were distributed and the Allende meteorite fell, the 
techniques of K-Ar, Rb-Sr, and U-Pb dating had been developed into 
very accurate and sophisticated tools suitable for the job of measuring 
the small but significant isotope differences found in these materials. The 
interpretation of these results has had far-reaching consequences in our 
present concept of the development of the solar system. 

Image tubes for astronomy. In the mid-1950s President Bush established 
a major program within the Institution to develop electro-optical devices 
that could increase the sensitivity of astronomical telescopes by a factor of 
10 or more. This cooperative program, involving many institutions and 
industrial laboratories, was organized at DTM under the chairmanship of 
Tuve. The effort was directed toward developing and demonstrating elec- 
tronic image intensifiers that were practical for routine observational use. 

From the beginning, the goal of the Carnegie Image Tube Committee 
was to develop a device that would make smaller telescopes as effective 
as larger telescopes with conventional detectors. In the early 1960s such 



IS CARNEGIE INSTITUTION 

a system was demonstrated. From 1963 to 1970 the Carnegie Committee, 
with National Science Foundation funding, built and distributed 34 highly 
successful image intensifier systems to observatories in this country and 
abroad. For many observatories, these ^'Carnegie Image Tubes" have be- 
come the major observing tool and have made possible many varied 
astronomical observing programs that otherwise could not have been 
undertaken. 

Image tubes also increased the power of the largest telescopes. Success 
with image tubes stimulated the development of other electronic devices for 
use at the observing end of telescopes. This trend is continuing, and it 
represents a revolutionary development in astronomy. 

Geophysical Laboratory 

In many ways the Geophysical Laboratory occupies a unique position in 
a field where science and technology overlap. It has made major contri- 
butions in both pure and applied research. The Geophysical Laboratory 
scientists have contributed to physical chemistry and geology, and as a 
group they have served as leading interpreters and advocates of the appli- 
cation of the exact sciences, including physics and chemistry, to the solu- 
tion of problems in the earth sciences. Examination of five of the principal 
advanced textbooks on petrology reveals that about one fourth of the 
literature cited covers work that was performed at the Geophysical Labora- 
tory. The Laboratory has also made important contributions through its 
work in mineralogy and volcanology. The establishment of the scale for 
high temperatures, the phase equilibrium studies, and other physico- 
chemical investigations have earned the Laboratory a niche of its own in 
the physical sciences. Today the Laboratory is one of the leading centers 
of investigation of chemical phenomena at very high pressures. 

Experimental results obtained at the Geophysical Laboratory have had 
important applications in many industries. The basis for modern manu- 
facturing procedures in the Portland cement industry, for instance, is a 
1010 paper by George A. Rankin and Fred Wright on the melting be- 
havior of mixtures of lime, alumina, and silica ('The ternary system CaO- 
ALO.'.-SiOii"). Their article has been called ''the bible of the Portland 
cement industry" because it answered scientifically the long-standing 
questions about cement clinker composition and the setting and hardening 
characteristics of Portland cement. Another technological application of 
the Laboratory's researches is in glass manufacture. A paper by G. W. 
Morey and N. L. Bowen showed for the first time which of the ternary 
melts could be readily quenched to glass. This work standardized and 
improved the manufacture of glass worldwide. With J. W. Greig, Bowen 
also wrote "The system Al20.',-Si02," which showed that the place to look 



REPORT OF THE PRESIDENT 19 

for improved refractories was not in the 1:1 molecular ratio of the two 
oxides, as had been supposed, but in the 3:2 ratio of the new mineral 
mullite. 

Major programs of the last two decades have included extensive studies 
of the behavior of silicates at high temperatures and pressures in the 
presence of H2O and CO2. These studies duplicate conditions deep in the 
earth. Another major trend has been the development of a series of equip- 
ment capable of unprecedented high static pressures. Another notable 
program has been a successful pioneering effort in organic geochemistry. 

Studies in igneous petrology have been a major activity of the Geo- 
physical Laboratory. This emphasis was established early with the devel- 
opment of the quenching method for studying the melting relations of 
silicate materials, and the Laboratory continued on the forefront of petrol- 
ogy on the basis of this type of research for more than half a century. Its 
success in this field is often attributed to the highly perceptive work of one 
staff member in particular, Bo wen, but it was also the contributions of 
many other scientists at the Laboratory that produced the high reputation. 
These men demonstrated many of the important principles and processes 
of igneous petrogenesis, such as (1) the role of fractional crystallization 
in producing a diversity of igneous rocks, (2) the reaction principle 
whereby one mineral is resorbed in a cooling melt while another crystal- 
lizes, (3) the nature of the processes that occur when foreign material is 
assimilated by magmas, and (4) the nature and role of liquid immiscibility 
in magmas. Pioneering studies were made on such important topics as 
(5) the solubility of water in magmas and diffusion in silicate melts, and 
at the same time there was produced a tremendous body of (6) basic data 
on equilibrium relations between crystals and melt in a wide variety of 
silicate systems approximating igneous rocks in composition. 

To complement the experimental studies, field investigations of the 
igneous rocks themselves were frequently carried out. This work did much 
to guide the direction of the experimental research and included classic 
studies on particular areas, such as the Hawaiian and Aleutian Islands, 
and on specific rock suites such as ultramafic rocks and anorthosites. 

In a survey article published in 1974, the late W. W. Rubey, one of 
the most distinguished geologists of this century, evaluated some of the 
great developments of the 50 years of the earth sciences. Referring to 
contributions of the Geophysical Laboratory, he wrote: 

In petrology, major new developments have profoundly modi- 
fied the course of research on problems of igneous, metamorphic, 
and sedimentary rocks. Perhaps the most far-reaching develop- 
ment, in its consequences, has been the application of the prin- 
ciples of physical chemistry to the study of igneous, and later, 
metamorphic rocks. . . . The basic principle guiding the program 



'20 CARNEGIE INSTITUTION 

at this laboratory has been that all experimental work is done 
on materials of known purity and under accurately known 
conditions. . . . 

Bowen's differentiation theory has had tremendous influence 
in this country an(i abroad, although questions still remain about 
how universally it may be applied. However, it is })robably fair 
to state that the science of petrology has been made over by the 
results of exjierimental work at the Geophysical Laboratory and 
by Bowen's theory. Perhai)s an even greater contribution of the 
Laboratory is one that extends beyond petrology into many other 
fields of science. This is the demonstration that j^'oblems of 
seemingly hopeless complexity may be divided into simj^ler, more 
tractable parts and brought into the laboratory for analysis and 
solution. 

The Geophysical Laboratory has an unexcelled record in the develop- 
ment of equipment that opens new^ frontiers for experimentation. In recent 
years there have been innovations in apparatus for amino acid analysis, 
for the electron microprobe, for high-temperature and high-pressure crys- 
tallography and for dating rocks. 

A major continuing contribution has been in the development of equip- 
ment for general high-pressure, high-temperature research. 

The extent to which knowledge of the earth's interior can be gained 
depends largely upon the capability of high-pressure apparatus used in 
the laboratory to simulate the pressure-temperature conditions of the 
earth. Equipment developed at the Laboratory has been adopted by most 
of the major high-pressure laboratories all over the world. ^'One of the 
striking features of the [Geophysical] Laboratory," wrote R. S. Bradley 
at the beginning of his series of books High Pressure Physics and Chemistry, 
''is the way in which visiting scientists, of whom the writer was one, are 
encouraged to pick up the know-how; they also benefit greatly from an 
injection of enthusiasm." 

The record of development of high-pressure apparatus during the past 
three decades has been impressive. The cold-seal pressure vessel, designed 
by Tuttle, has been adopted worldwide as the most commonly used vessel 
for hydrothermal studies. The single-stage, solid-media apparatus designed 
by Boyd and England has been widely copied. It is estimated that about 
200 of such single-stage units are now being operated in laboratories in 
the United States and about 100 in Europe. 

H. K. Mao joined the Laboratory in 1968 and initiated the extensive 
development of a diamond-anvil high-pressure cell, a concept originated 
by A. Van Valkenburg some years ago. A diamond-anvil cell recently de- 
signed by Peter M. Bell and Mao is capable of maintaining 2000°C at 
1500 kbar when heated by the beam of an Nd-doped YAG laser. The 
sample between the diamond anvils can be observed at high pressure by 



REPORT OF THE PRESIDENT 21 

microscopy, infrared spectroscopy, x-ray diffraction, and Mossbauer spec- 
troscopy. In addition, the electrical conductivity and optical absorption 
of the sample can be measured at high pressures. 

The new diamond-anvil cell extends greatly the range of static high 
pressure in the previous apparatus and offers a powerful tool for studying 
the behavior of materials at great depths in the earth. It gives access to 
phenomena pertaining to about 85% of the earth by volume but about 
which little was known owing to previous limitations of high-pressure 
apparatus. Because of the versatility of the diamond-anvil cell, a broad 
spectrum of physical and chemical properties of the lower mantle can now 
be studied. 

Research at the Geophysical Laboratory has in general related to the 
petrology of igneous and metamorphic rocks. But the sedimentary rocks 
which cover most of the surface of the earth also present important puzzles 
and phenomena to investigate. The geochemistry associated with sedi- 
mentary processes is greatly affected by the activities of living matter, 
which can create a highly reducing environment and which produces vast 
quantities of organic chemicals. The amounts that appear as petroleum, 
natural gas, coal, and oil shale are only a tiny fraction of the organic matter 
of the earth's crust. 

Most of what is known about past life forms has been inferred from the 
fossil record, which is satisfactory during the last 600 million years but 
sparse and not very informative for 3000 million years before that. More- 
over, while the hard parts of the fossils are important, the essence of life 
resides in organic matter. 

The organic matter that is formed each year is, for the most part, rela- 
tively quickly destroyed, but some escapes destruction and persists for long 
periods. What can studies of the organic constituents of rocks tell us about 
ancient life? How do organic chemicals in rocks change with time as a 
function of the conditions to which they are exposed? 

A notable beginning to examination of such questions was made by 
A. Treibs during the 1930s in his studies of porphyrins, but the work then 
languished. In 1953, Abelson began work that stimulated new interest in 
organic geochemistry. He discovered that many fossils contain amino acids. 
The initial work was performed on shells of the clam Mercenaria mercenaria, 
commonly known as the quahog. This mollusc also flourished 20 million 
years ago and fossils from that period contain some of the amino 
acids present in modern shells. It was apparent that the dense mineral 
structure of the shell (aragonite) had protected at least some of the amino 
acids from bacterial attack and that the chemicals remaining had possessed 
sufficient chemical stability to last 20 million years. The absence of some 
of the amino acids suggested that they lacked long-term stability. This 
hypothesis was tested by conducting incubations of amino acids for ex- 



1^2 CARNEGIE INSTITUTION 

tended periods at moderately elevated temperatures. An excellent correla- 
tion between laboratory tests and fossil data was fomid. The compounds 
that remained in the fossils possessed the greatest stability in laboratory 
tests. These findings made it evident that under favorable conditions 
interesting biochemicals (biochemical fossils) could endure for hundreds 
of millions of years. By the early 1960s the study of biochemical fossils 
was being conducted in a number of laboratories and information derived 
from such studies is finding application in petroleum exploration. 

Many other pioneering studies related to organic geochemistry were 
conckicted at the Laboratory, including epimerization and isomerization 
of amino acids, use of changes of amino acids as a dating tool, mechanisms 
of formation of humic acid and kerogen and the low temperature conver- 
sion of kerogen to hydrocarbons. 

Two lines of experimental work, one by T. C. Hoering and Abelson, and 
the second by Hoering, produced strong evidence that organisms living 
more than 3000 million years ago engaged in photosynthetic processes at 
least in part similar to those employed today. The evidence came from 
studies of carbon isotope fractionation that accompanies photosynthesis. 
They measured isotopic fractionation in some present-day widely different 
photosynthetic organisms, some thought to be primitive, including a blue- 
green alga and an anaerobic photosynthetic bacterium. They found the 
carbon isotope fractionation in the compounds of the various organisms 
to be closely comparable. 

Hoering examined suites of rocks, including both modern and ancient 
samples in which he could compare carbonate from the matrix with associ- 
ated reduced carbon. The difference in C^^/C^^ isotopes between the car- 
bonate and reduced carbon was found to be closely comparable throughout 
the whole time span. This difference was about the same as the difference 
in isotope ratios of growth mediums and that fixed in the photosynthetic 
organisms. Studies by others had shown that the major part of the isotope 
fractionation occurs at the moment of CO2 fixation in the photosynthetic 
organisms. 

In summary, the work with biochemical fossils and with carbon isotopes 
pointed toward a long enduring continuity in very important biosynthetic 
processes. 

Astronomy 

For most of this century world leadership in observational astronomy 
has rested in Pasadena, California. During the first five decades, Carnegie's 
Mount Wilson Observatory was the primary center. Later, when the 200- 
inch telescope on Palomar became operational, Carnegie scientists partici- 
pated with astronomers from the California Institute of Technology in the 



REPORT OF THE PRESIDENT 23 

joint operation of facilities on both mountains. The combined operation 
has continued under the aegis of Hale Observatories. During the past 
decade new, advanced equipment of the highest quality has become avail- 
able at other sites around the world. Many of these facilities are supported 
by governments or consortia that provide several times the amount of 
funding available to Hale Observatories. Despite its comparatively small 
budget, Hale continues its tradition of excellence at the frontier of astro- 
nomical research. 

George Ellery Hale, the founder and first Director of the Mount Wilson 
Observatory, was relentless in the search for excellence, and his spirit 
remains at Pasadena. By a combination of skill, judgment, and intuition 
he chose the site at Mount Wilson, where the best seeing conditions in 
North America are found. The telescopes erected there were of the best 
quality. Hale was also a leader in applying to astronomy the advances in 
physics, especially those in spectroscopy. 

The equipment and techniques were put to good use by many astrono- 
mers, but among them Edwin P. Hubble stands out. We now know that 
the universe is populated by galaxies, many of them like our own. But 
until recently this fact was not recognized. What are now known as galaxies 
were called nebulae. They were bright patches in the sky, usually spiral 
in form. But even the nearest one in the northern hemisphere, Andromeda, 
was so distant that stars in it were not resolved. Using the superior equip- 
ment at Mount Wilson and aided by good seeing conditions, Hubble was 
able to identify individual stars in Andromeda. He also found that some 
of the stars varied in their intensity, the period being a function of their 
luminosity. These '^Cepheid variables" had been studied both in our own 
galaxy and in the Magellanic Clouds, and their distance from Earth had 
been measured. Thus, it was possible to calculate the distance to the 
Andromeda spiral and to note that it was far removed from our galaxy. 
From this beginning, the concept of a many-galaxy universe evolved. 

The development at Mount Wilson of instrumentation capable of 
spectroscopy of very faint sources was helpful to Hubble in making another 
discovery — that of the expanding universe. He followed up on an earlier 
observation by V. M. Slipher, who had noted a redshift that seemed to be 
related to the distance galaxies are from us. After a survey that included 
many galaxies, some of them far removed, Hubble concluded that the 
universe was indeed expanding. His conclusion raised some basic questions : 
What was the universe like earlier? Did it begin with a ''big bang"? How 
fast is the universe expanding? Will it continue to expand forever or will 
it ultimately reach a maximum size and then begin to contract as gravi- 
tation overcomes initial expansion? 

Many of these questions are still not settled. One of them — how fast is 
the universe expanding? — has been of special interest. The measurement 



2J^ CARNEGIE INSTITUTION 

of redshifts is not easy. The problem is to establish an accurate distance 
scale for far-off galaxies. As one of many accomplishments, Allan R. 
Sandage of Carnegie has conducted painstaking work over many years 
to improve the distance scale. 

Hale's early efforts to apply precise spectroscopic techniques were con- 
tinued at Blount Wilson's Pasadena headquarters at Santa Barbara Street. 
A machine for ruling gratings was built that supplied the needs of Mount 
Wilson and many other observatories around the world. The gratings are 
an essential component of the coude spectrograph attached to the 100-inch 
Hooker telescope, still one of the best in the world. With this equipment 
it was possible to resolve complex spectra of many stars and obtain infor- 
mation about the chemical content, temperature, pressure, density, strength 
of gravity, electric fields, and the magnetic fields in specific regions of a 
star. Other observatories also participated in this effort, but Carnegie was 
the leader. The huge body of data accumulated was later employed in the 
formulation and testing of models of nuclear synthesis and nuclear re- 
actions in the stars. 

In connection with his work on nucleogenesis, Paul Merrill at Mount 
Wilson made an interesting discovery: the presence of technetium in stars. 
Technetium (element 43) occurs on earth only as short-lived radioactive 
isotopes made by neutron activation of molybdenum in nuclear reactors. 
No stable form exists. Thus the discovery of technetium in stars means 
that neutron activation of molybdenum (element 42) is occurring in stars. 

Another major long-term study that has made a difference in astronomy 
was the series of observations by Walter Baade. He discerned and named 
two types of stellar populations in nearby spiral galaxies. The population 
II stars appear to have been formed early. They are, for the most part, 
distributed in spherical pattern around the galaxy. The population I stars 
tend to lie in the plane of the galaxy. Some of them are young stars that 
give evidence of having formed in the presence of hydrogen. Baade's 
observations gave rise to the suggestion that galaxies are formed by con- 
densation of enormous gas clouds. This mechanism is still under active 
investigation. 

The Hale Observatories had a crucial role in the optical identification 
of quasars. Radio astronomers had discovered major sources of radio noise 
at various places in the sky. But they could not associate the noise with 
any particular object. In 1960 Thomas A. Matthews, a radio astronomer 
at Caltech, was able to provide precise locations for some of these radio 
sources, and Sandage from the Carnegie side was able to fix upon cor- 
responrling optical sources. He saw that they had unusual optical spectra. 
Later, Maarten Schmidt of Caltech proved that the reason for the odd 
spectrum was an enormous redshift. That is, the objects were at distances 
as great as 15 billion light years. 



REPORT OF THE PRESIDENT 25 

Genetics 

The Carnegie Institution has a long history of distinguished involve- 
ment in genetics. During the life of the Department of Genetics at Cold 
Spring Harbor (1902-1962), Carnegie did more to nurture this science than 
any other institution. 

The first outstanding contribution at Cold Spring Harbor was the de- 
velopment of hybrid corn by George Harrison Shull. Later there was 
important activity in genetic mapping and study of mutations and be- 
havior of chromosomes in Drosophila. Another notable activity that con- 
tinues today is the work in plant genetics conducted for many years by 
Barbara McClintock. Her discovery that genes that control other genes 
can move around in the chromosomes is today one of the single most 
exciting issues of molecular biology. For many years Cold Spring Harbor 
was a major center of molecular biology and the site of Nobel Prize- 
winning experiments by Alfred D. Hershey and Martha Chase. 

More recently, major advances in genetics have also been made at other 
Carnegie laboratories. During the 1960s Roy Britten and his colleagues 
developed in the Biophysics Section of the Department of Terrestrial 
Magnetism new and powerful tools for determining the details of chromo- 
some structure. They found that while bacterial genomes consist essentially 
of several thousand different genes, eukaryotic DNA consists of families 
of more or less related sequences as well as sequences occurring in only a 
single copy per genome. At our Department of Embryology splendid 
progress has been made in gene isolation during the past decade. 

Hybrid corn. George Harrison Shull's development of hybrid corn has 
been this century's single most important scientific contribution to agri- 
culture. The economic value of the development is now estimated at more 
than 100 billion dollars. 

In two papers, published in 1908 and 1909, Shull presented recommenda- 
tions to the American Breeders' Association. Shull noted that corn farmers 
used simple techniques of selective breeding, choosing seed corn each 
year from the better specimens of the past crop. This, however, produced 
injurious effects in the long run because by repeated self-fertilization a 
relatively pure but fragile genetic strain would evolve. Shull suggested 
that the corn-breeder, instead of seeking the best pure line, should find 
and maintain the best hybrid combination. 

First of all, he said, the practical agriculturist should systematically 
develop multiple pure-line specimens. This was to be done by repeatedly 
self-fertilizing descendents of a single specimen, from generation to genera- 
tion, until an essentially pure (homozygous) state was reached for a 
number of breed lines. Then, from the multiple lines developed, every pair 
combination would be crossed. The qualities of each resulting hybrid 



'36 CARNEGIE INSTITUTION 

offspring woukl be studied, and the most desirable set of parents identified. 
Tlie proiluction of seed-corn could then take place, using a method devised 
by Shull. He developed two nearly homozygous specimens, and he showed 
tliat cross-breeding them brought a marked improvement m the first- 
generation offspring. 

At first there was some resistance to Shuirs reconmiendations. One 
obstacle was the general view that obtaining the hybrids would be too 
costly for widespread use. A few agricultural experimentalists, however, 
were impressed by Shull's results, and in 1919 a member of the Connecticut 
Experiment Station published details of a double-cross technique involving 
foiu' inbred strains. Serious efforts at developing hybrids followed, but 
results unavoidably awaited passage of many growing seasons. The first 
advertisement for commercial seed-corn appeared in 1926. The use of 
hybrid corn spread rapidly during the 1930s, and by 1946 two thirds of 
American corn acreage was in hybrid corn. Today virtually all United 
States corn comes from hybrid seeds as does much of the corn grown 
abroad. Today yields are about triple those of the pre-hybrid era. Part 
of the improvement is the result of fertilizers and other factors, but most 
of it can be attributed to hybrid seeds. 

Shull's work receives credit in every modern writing on the development 
and impact of the hybrid corn idea. For this work Shull received the 
Marcellus Hartley Medal of the National Academy of Sciences in 1949 
"in recognition of his services in the application of principles of the pure 
line and of hybrid vigor to the improvement of the quantity and quality 
of the maize crop." 

The passing years have added to the significance of Shull's discovery. 
Success with corn hybrids led to the use of similar approaches to obtain 
hybrid vigor in a wide variety of other plants and in some animals. 

The professional staff of the Department of Genetics was of modest 
size; the usual complement of permanent senior investigators was about 
five. However, most of the great names of genetics were in one way or 
another connected wdth it. Milislav Demerec, writing in 1942, mentions 
some of the geneticists whose work had been fostered by the Institution. 
The list of Research Associates included: W. E. Castle, E. B. Wilson, 
T. H. Morgan, C. B. Bridges, A. H. Sturtevant, C. E. McClung, R. Pearl, 
H. E. Crampton, E. B. Babcock, H. D. Goodale, L. R. Dice, F. B. Sumner, 
Th. Dobzhansky, and J. Schultz. Demerec noted ''A particularly strong 
measure of support was provided during those early days when genetics 
w^as in special need of recognition and assistance. This backing given to 
genetical research by the Institution undoubtedly accounts to a large 
degree for the fact that the United States now occupies a leading position 
in this branch of science." 

In the two decades after 1910, the most significant research in genetics 



REPORT OF THE PRESIDENT 21 

was that of Thomas Hunt Morgan, who studied Drosophila melanogaster 
(the fruit fly). He received regular grants from the Institution, and he 
published some of his important results in Carnegie monographs and in 
its Year Books. Morgan and researchers at Cold Spring Harbor regularly 
exchanged comments on one another's work. 

In the early 1930s the center of Drosophila work was Cold Spring 
Harbor. Demerec carried on studies of x-ray induced mutations and 
deficiencies in the animal. Of special interest was the role of gene mutation 
in ontogeny. One of the early contributions of the radiation work was the 
relation of induced deficiencies to cell lethality. 

With the introduction of salivary gland chromosome analysis, the work 
on deficiencies and other types of chromosome aberrations advanced rap- 
idly, in collaboration first with Margaret Hoover and later with B. P. 
Kaufmann, Eileen Sutton, and others. Demerec also examined factors con- 
trolling spontaneous mutability. He studied the differences in mutability 
in various wild-type strains of D. melanogaster, and identified a mutability- 
stimulating gene in the Florida stock. 

Demerec and Kaufmann are also known for a small handbook of simple 
experiments with fruit flies, published in 1940. Nearly 300,000 of their 
Drosophila Guides have been sold to secondary schools and colleges, as 
well as to individuals who wanted an introduction to ^^hands-on" genetics 
research. 

Demerec had unusually fine talents as an administrator. He was quick 
to recognize the emergence of new important ideas from whatever source. 
He organized the world's best annual symposia on quantitative biology, 
which brought together experts from all over the world. Cold Spring Harbor 
in the summer was a place of great intellectual ferment. 

Salvador E. Luria, one of the founders of molecular biology, has given 
his evaluation of the role of Cold Spring Harbor as an intellectual cradle 
for molecular biology. 

There are starry years in the history of science. For genetics 
one such year was 1941. Under new guidance by Milislav Demerec 
the Department of Genetics of the Carnegie Institution of Wash- 
ington and the Biological Laboratory of Cold Spring Harbor set 
in that year one of the foundations on which molecular genetics 
was born and successfully grafted upon the stock of Mendelism. 
The 1941 Cold Spring Harbor Symposium saw physicists, chem- 
ists, and geneticists begin to create and to speak a common 
language, just as in the Department of Genetics itself Demerec, 
McClintock, Kaufmann, and Fano were breaking down the 
disciplinary barriers in the hunt for the gene as molecule. 

The trend was not ephemeral. It was rooted in the insight put 
forward by Muller and Delbriick that molecular paradigms had 
to be substituted for formal paradigms if genetics had to explore 



iS8 CARNEGIE INSTITUTION 

not only the order of genes but also their nature and their func- 
tion. With this in mind Demerec welcomed and cultivated the 
buddint!; field of bacteriophage research between 1941 and 1950. 
Phage courses and "old" and young phagologists were at home in 
Cold Spring Harbor and brought to it bacterial and phage 
genetics. Witkin joined the Genetics Department in 1945 and 
made it into a center of bacterial radiobiology. (For many of us 
sinnmer visitors she was also a patient interpreter of the exciting 
but not readily understandable discoveries by McClintock on 
generegtilation.) 

Bacteria and phage brought to Cold Spring Harbor a crowd 
with more biochemical and biophysical savvy: Roberts, Stent, 
and many others. Hershey settled in the Department of Genetics 
and in 1952 discovered the transfer of DNA from phage to 
bacterium and dissipated the last questions as to the nature of 
the genetic material. Watson spent in Cold Spring Harbor the 
summers of 1948 and 1949 and returned in 1953 with the Holy 
Grail whose hunt Cold Spring Harbor had inspired: the molecular 
structure of the gene. 

The stimulus provided by the intellectual ferment at Cold Spring 
Harbor ^vas for the most part manifested in research performed elsewhere. 
However, the stimulus was not lost on the small staff resident there. When 
Alfred D. Hershey set out to show that the phage nucleic acid (and not 
its protein) performed the genetic role, success in surmounting the major 
technical difficulties came quickly. With Martha Chase, Hershey tagged 
the phage nucleic acid with radioactive phosphorus, its protein with sulfur. 
Hershey and Chase first confirmed that the phage injected only its nucleic 
acid into its victim, and that the phage protein shell remained attached 
to the victim cell membrane. The researchers next employed a centrifuge 
and a high-speed mixer in several experiments designed to strip away all 
viral protein residue from victim cells. The production of viral progeny 
was unaffected. This result demonstrated that DNA is the sole genetic 
agent of the phage, and confirmed that nucleic acid was involved in the 
heredity of all creatures. 

One of the Institution's guiding principles, as set forth by Andrew 
Carnegie is: ''To discover the exceptional man . . . and enable him to 
make the work for which he seems specially designed his life work." 

Few scientists have so magnificently justified the Institution's support 
as has Barbara McClintock. She came to be regarded as the world's lead- 
ing cytogeneticist, and in 1970 received the nation's top civilian science 
award, the National Medal of Science. 

In 1967 Marcus M. Rhoades, himself a distinguished geneticist and a 
member of the National Academy of Sciences, evaluated her work: ''Among 
McClintock's outstanding contributions is her analysis of the control of 
gene action in maize and the discovery of the two-unit interacting system. 



REPORT OF THE PRESIDENT 29 

This concept was the precursor of the regulator-operon theory of gene 
regulation that won for its promulgators, Jacob and Monod, the Nobel 
Prize in 1965. Her finding that the transposition of controlling elements 
from one chromosomal location to another was accompanied by a change 
in gene action afforded a new and revolutionary insight into chromosome 
structure and genie expression. Genetics would not occupy its present high 
estate were it not for McClintock's magnificent and pioneering contri- 
butions.'' 

In the decade after 1967, the significance of this contribution has become 
widely appreciated. Others have shown that the type of control system 
McClintock noted in maize was universal. The phenomenon has been 
popularly called ^^ jumping genes," and among the experts the term trans- 
posons is now used. 

Much of McClintock's work was done in the late 1940s and 1950s, but 
her ideas were so revolutionary that they were slow of acceptance. Her 
findings occurred before the discovery of the double helix and the genetic 
code. Now it is understood that the phenomena McClintock described 
arose from either the insertion of a small piece of DNA into a gene or its 
later movement out of the gene. 

Rhoades also listed some of McClintock's other accomplishments which 
have had major impact on genetics: 

Her first major contribution was the demonstration that the 
chromosomes were individually recognizable by their relative 
lengths and arm ratios, distinctive chromomere patterns, and 
deep-staining knobs in characteristic positions. This was followed 
by such significant studies as the analysis of translocation 
heterozygotes, the correlation of cytological and genetical cross- 
ing over, the assignment of linkage groups to specific chromo- 
somes, the physical location of gene loci by deficiencies, the 
formation of dicentric bridges and acentric fragments as a result 
of crossing over in inversion heterozygotes, the somatic and 
meiotic behavior of unstable ring chromosomes, the occurrence 
of nonhomologous pairing, the structure and function of the 
nucleolar organizing region, the production of viable homozygous 
deficiencies that stimulated gene mutation and formed a pseudo- 
allelic series, and the genetic and cytological consequences of the 
bridge-breakage-fusion cycle. Her studies on the evolutionary 
history of races of maize as disclosed by the number and location 
of specific chromosome knobs have been conducted with typical 
precision and elegance. 

Department oj Plant Biology 

When carbon dioxide is fixed by plants, the process is often written 
CO2 + H2O + h/x -^ CH2O + O2. That is, photosynthesis gives rise to 



so CARNEGIE INSTITUTION 

carbohydrates plus oxygen. Behind the shnple equation is a complex 
reality. ]\lany different carbon compounds are produced. Of equal im- 
portance are the steps in converting light energy into the chemical energy 
that drives the synthetic processes. It is now known that when light falls 
on chlorophyll and other pigments, a series of excitations and electron 
transfers takes place. Some of the steps occur as quickly as about 10~^^ 
second; others proceed more slowly. It is also known that for photosyn- 
thesis to function at top efficiency two pigment systems must be excited. 

Recognition of the latter phenomenon was a crucial step in the under- 
standing of photosynthesis. Knowledge of the two-pigment process was 
largely derived from work at the Department of Plant Biology. The first 
indication of a two-pigment system came from the work of Robert Emer- 
son, a Research Associate of the Institution in 1938. He found that the 
efficiency of photosynthesis was anomalously low at the far red end of 
the spectrum. To explain this finding he suggested that there were two 
pigment systems, and that one of them did not absorb at the far red end 
of the spectrum. At first, his suggestion was not generally accepted. But 
it was later confirmed by C. Stacy French and Jack Myers, who conducted 
further experiments with short flashes of light (that is, a short exposure to 
far infrared light was followed by a dark period and then by a flash of 
light at shorter wave lengths, for example, in the red. Photosynthesis pro- 
ceeded efficiently. Thus, the two light reactions could be separated in time. 
The observations were extended to a series of photosynthesis organisms 
having a variety of pigments, and the phenomenon was shown to be 
general. 

In most plants the predominant effective pigment is chlorophyll. The 
existence of the two-step process with one step effective in the far infrared 
suggested that there might be physically different forms of chlorophyll, 
each with its own light absorption characteristics. To investigate this 
possibility, French designed and built an instrument that permitted him 
to measure the first derivative of the absorption spectrum. With this 
apparatus he was able to show that there are as many as four distinct 
forms of chlorophyll in amounts varying from plant to plant. 

A major activity at the Department of Plant Biology has been the study 
of the nature and organization of photosynthetic pigments. Harold H. 
Strain pioneered in development of chromatographic methods for the 
separation of carotenoids and chlorophylls that had been extracted into 
organic solvents. Beginning with the work of French, Harold W. Milner, 
and others, fractionation of chloroplast materials into active components 
has been continued to the present. L. M. N. Duysens discovered a light- 
induced absorption change at 515 nanometers in the alga Chlorella which 
has led to clarification of the role of carotenoid reactions in photosynthesis. 
Victoria H. Lynch and French discovered that carotenoids could be re- 



REPORT OF THE PRESIDENT 31 

moved from dried chloroplasts by petroleum ether extraction and later 
added back in active form. David C. Fork subsequently clarified the role 
of the copper protein plastocyanin in the electron transport chain between 
system II and system I. Such studies have continued to the present with 
the recent work of Jeanette S. Brown on purification and characterization 
of reaction center chlorophyll-protein isolated from a wide variety of 
photosynthetic organisms. 

Another discovery of major importance was the observation by James 
H. C. Smith of the light-driven transformation of protochlorophyll to 
chlorophyll in extracts of leaves of dark-grown plants. This work, followed 
by that of Kazuo Shibata showing absorption shifts in vivo for the newly 
formed chlorophyll a, marked the beginning of our understanding of the 
biochemistry of pigment changes occurring in chloroplasts of leaves when 
they are exposed to light for the first time. 

Today laboratories at the forefront of photosynthesis studies use very 
sophisticated equipment, including the latest in electronics coupled into 
dedicated or general computers. The Department of Plant Biology has 
often been a leader in the invention and use of advanced equipment. 
French and Fork have contributed to such developments. One of French's 
inventions is a comparatively simple but very useful device that forces 
cells through a needle valve as a way of breaking them open while leaving 
their intracellular structures relatively intact. The instrument is now used 
all over the world by plant biologists, bacteriologists, molecular biologists, 
and others. 

Plants can be grown in a greenhouse and studied in the laboratory, but 
by going to nature and studying plants in a wide variety of circumstances, 
undreamed of lessons can be learned. Such a program has long been an 
important aspect of the Department's research. California is an ideal spot 
for this kind of work. Within easy access are the heat of Death Valley, 
the frigid temperatures of the Sierras, and the cool, damp environment of 
the coastal areas. Taking advantage of some of the opportunities for study, 
Jens C. Clausen, David C. Keck, and William M. Hiesey, in collaboration 
with Malcolm A. Nobs, performed a remarkable series of experiments in 
which they transplanted representatives of a species found in diverse en- 
vironments from one environment to another. They discovered that differ- 
ences between plants from two different locations were primarily genetic — 
not just a function of the cooler or warmer environment affecting growth. 
This work and the extensive genetic analysis accompanying it provided 
the basis for our knowledge of ecological races as an early step in the 
evolution of plant species. The work is discussed in detail in every modern 
textbook of plant evolution and finds its way into books on animal evolu- 
tion as well. 

An outgrowth of the experimental studies by Clausen, Keck, and Hiesey 



5J8 CARNEGIE INSTITUTION 

was a program to develop improved range grasses using the techniques 
oi hybridization and transplantation developed in the studies already 
mentioned. With extraordinary thoroughness, these investigators assembled 
a massive number of collaborators and had their test species and hybrids 
grown all over the United States. The C-1 strain of Poa pratensis discov- 
ered at that time now contributes as much as 80% of the seed in commer- 
cial lawn mixtures all over the West, Midwest, and Northeast. C-1 stands 
for Carnegie number 1. 

Another result of the studies by Clausen, Keck, and Hiesey was the 
development of a mobile laboratory that now enables Olle Bjorkman in 
collaboration with Harold A. Mooney of Stanford University to make 
sophisticated studies of photosynthesis and respiration and related gas 
exchange on plants growing in severe climates. Field studies are being 
conducted in the deep shade of the rain forest and the intense summer 
heat of Death Valley. The results are integrated with those of laboratory 
studies in controlled-environment chambers, leading to precise characteriza- 
tion of biochemical, physiological and physical characteristics that enable 
plants to survive under such extreme conditions. 

While these studies have been important in showing the significance of 
already known adaptations such as C4 photosynthesis, they have also led 
to the discovery of new adaptations. For example, James R. Ehleringer 
has showm that Encelia species growing under desert conditions use a dense 
layer of epidermal hairs to reflect back as much as 70% of the light that 
falls on their leaves. By this mechanism, leaf overheating is prevented 
witli a minimum of evaporative cooling. Bjorkman and Joseph A. Berry 
have found that certain desert plants in situ can tolerate water stresses as 
great as — 50 bars without any effect on the quantum efficiency of photo- 
synthesis. One of the desert plants, Tidestromia oblongifolia, gives a re- 
markable demonstration of thermal stability. The optimal temperature 
for its growth is near 46°C (114.8°F), and it can photosynthesize effectively 
at still higher temperatures. Under optimum conditions, this plant doubles 
its dry matter every two and a half days. 

The combination of intensive comparative laboratory and field studies 
of plants from extreme environments has been a major program of the 
Department for the past ten years. It has provided the foundation for 
much of modern physiological plant ecology. 

D ppart m (m t of Em bryo logy 

An uncommon and important characteristic of Carnegie departments is 
the abihty to evolve drastically but in an orderly manner. Programs are 
not changed for the sake of change or to follow the fashion of the times, 
but because major programs have been completed or because other insti- 



REPORT OF THE PRESIDENT 33 

tutions appear ready to carry them on. Such circumstances do not arise 
very often. When they do, careful thought is given to the directions new 
programs will take. 

These remarks are particularly applicable to the Department of Embry- 
ology. The Department had made superb contributions in the study of 
human and primate embryology, but by 1955 the challenges were diminish- 
ing and other institutions were entering the field. James D. Ebert and 
President Haskins determined that new directions should be followed while 
existing work was gradually phased out. Today the Department of Em- 
bryology is still at the frontiers of developmental biology, but the program 
is completely different from that of two decades ago. 

When the Department's work was initiated in 1914, knowledge of human 
embryology, particularly that of the first trimester of pregnancy, was in 
a primitive state. As a result, the original program of research was centered 
on descriptive embryology. Objectives for study included (1) curve of 
growth, (2) anatomy of various stages; modeling and dissection of internal 
structure, (3) morphology of the brain, (4) histogenesis: the differentiation 
of the various tissues, (5) the causes of spontaneous abortion, (6) study 
of monsters, (7) study of moles (proliferative malformations of the 
placenta and membranes), and (8) comparative and experimental em- 
bryology. 

By 1955, Ebert 's predecessor, George W. Corner, could say that the 
Department possessed a collection of human embryos that was by far 
the largest in the world, one that was well-prepared, safely housed, and 
kept usable by good records and ample indexes. The statement is still 
true, although the Carnegie Collection is now at the University of Cali- 
fornia at Davis. 

Corner believed that the problem of the curve of growth had been 
solved: 

We now know the external appearance and dimensions of the 
human embryo and fetus day by day from the two-cell stage to 
birth. The time schedule of development has been worked out 
with a fair degree of certainty, so that the age of an embryo 
can be determined from its external appearance with an error of 
plus or minus one day, in the first seven weeks, and to the correct 
week in later stages. The records and data on this time schedule 
include a superb collection of photographs and models, a descrip- 
tive catalogue . . . which furnish norms of growth in weight and 
length of the body, and various other useful dimensions through- 
out gestation. 

In the study of the anatomy of growth stages. Corner thought that the 
special accomplishment of the Carnegie laboratory had been the accurate 



Sj^ CARNEGIE INSTITUTION 

aiul dot ailed reconstruction in three-dimensional models of the internal 
structure throughout the embryonic period. 

Another major accomplishment was the series of studies of the embry- 
oloiry oi nonhuman primates. The Department established a monkey 
colony wliich made possible comprehensive study of the reproductive 
cycle, includinii' menstruation and the cyclic changes in the uterus and 
ovaries. Development of embryos in humans and in rhesus monkeys fol- 
lows closely parallel courses. The period of gestation is the same, and while 
there are small differences in the schedule of comparable events, these 
variations can readily be taken into account. Thus, studies of rhesus mon- 
keys can be used to fill gaps in our knowledge of human development. 

Information derived from monkeys has been particularly valuable in 
providing knowledge about the establishment of the placenta and about 
blood circulation during labor. 

For example, in Year Book 70, Dr. Elizabeth R. Ramsey of the Depart- 
ment wrote. '^An amazingly lucky find caught a 10-day monkey ovum at 
its moment of attachment to the endometrial surface. The first tropho- 
blastic cell is slipping between two maternal epithelial cells. No comparable 
stage has yet been found in man. ... At 11 days the trophoblastic plate 
is still solid, but a day or so later fluid-filled lacunae begin to appear in it, 
some of them containing maternal blood cells, indicating that maternal 
capillaries have now been 'tapped.' " The later stages were elucidated in 
comparable detail. 

Labor is a crucial event in the feto-maternal relationship, and the 
quality of placental circulation is of particular importance at that time 
because impairment can lead to anoxia and varying degrees of damage. 
Ramsey recognized the importance of seeing the blood circulating in living, 
intact animals. Ramsey, together with associates at Carnegie and with 
]\Iartin Donner and others at the Department of Radiology of The Johns 
Hopkins Hospital, used advanced techniques of still and cineradiography 
to observe and record the circulation process. They were able to trace the 
pathways of inflow of maternal blood and the drainage back into the 
maternal systemic circulation. They showed that muscular contractions 
curtailed or halted both arterial inflow and return drainage, and they 
demonstrated the basic relationship between maternal and fetal circulations. 

The new program initiated at the Department by Ebert has already 
yielded results of major significance. In 1963, Irwin Konigsberg published 
his "Clonal Analysis of Myogenesis," in which he demonstrated that single 
muscle cells could divide in culture and differentiate into muscle tissue. 
Until that time it was believed that cells in culture lost their specialized 
traits, a process referred to as '^dedifferentiation." This erroneous view had 
a profound influence on the field because it implied that cell culture 
methods were not useful in studying the specialization of individual cells. 



REPORT OF THE PRESIDENT 35 

Konigsberg showed that when muscle cells were nurtured carefully, they 
maintained their specialized traits and could be kept alive for many 
generations. Since that demonstration with muscle cells, many kinds of 
specialized cells have been maintained successfully in culture, including 
liver cells and cartilage cells (also first carried out in the Department), 
several kinds of hormone-producing cell lines, nerve cells, and various 
kinds of blood cells. Cell cultures are important because they permit study 
of cell differentiation and because tissue cultures can be used in practical 
applications. Viruses that infect only specialized cells can be cultured for 
vaccine production. 

Because of its complexity, the cell surface has been a difficult object 
for study. Yet it must be analyzed, for it contains some of the most im- 
portant secrets of developmental biology. Through its surface the cell 
senses its surroundings and transmits signals to the nucleus and cytoplasm. 
Cell surfaces selectively take up nutrients, hormones, and drugs in ways 
which profoundly influence development and metabolism. To probe cell 
surfaces systematically, it is necessary to identify and characterize indi- 
vidual components free from the complex array of molecules in the cell 
surface membrane. Owing in large part to Douglas Fambrough and his 
colleagues, detailed information is available on one such membrane com- 
ponent — the acetylcholine (ACh) receptor on muscle membranes. Fam- 
brough and associates have analyzed the synthesis and degradation of ACh 
receptors and have obtained information about the assembly and metabo- 
lism of cell surfaces. From his knowledge of the abundance and distribution 
of ACh receptors, Fambrough predicted that they are disturbed in the 
disease myasthenia gravis. He collaborated with Dan Drachman of The 
Johns Hopkins Hospital in a study that demonstrated this effect, and 
Drachman was inspired to carry the matter further to a successful new 
treatment of myasthenia gravis. 

Traditional genetics involves selecting for mutants of a gene, mapping 
them, and analyzing the altered gene function. Animals and plants are so 
complex that this approach has been of limited usefulness in determining 
how their genes work, especially during embryogenesis. Research in the 
Department from 1962 to the present has helped to establish a new kind 
of animal genetics, ^^genetics by gene isolation." In 1964, Donald Brown 
and John Gurdon found that a mutant of the frog Xenopus was incapable 
of synthesizing the RNA of ribosomes. This led to a series of experiments 
which first characterized the RNA molecules in ribosomes, then analyzed 
their synthesis in embryos, and finally led to the isolation of the genes 
for these RNAs. The ribosomal RNA genes of Xenopus were the first 
animal genes ever isolated. It was accomplished in 1966 by Wallace and 
Birnstiel at Edinburgh. Brown, I. B. Dawid, R. H. Reeder, and their 
colleagues have made a series of important discoveries on these purified 



S6 CARNEGIEINSTITUTION 

genes. The discovery that "spacer" regions are adjacent to functional genes 
was first made with ribosomal RNA genes. In 1968, Brown and I. B. Dawid 
showed that frog oocytes specifically amplify ribosomal RNA genes. Gene 
amplification is now recognized as an important mechanism for gene con- 
trol in tlevelopment. In 1971. Brown and his colleagues purified and 
characterized a second gene family of known function from the frog. This 
gene (gene family) also encodes for a ribosomal RNA called 5S RNA. This 
very simple gene has been completely sequenced by Nina Fedoroff and 
Brown, and recently the purified gene has been shown to function in a 
cell-free system (Brown and Gurdon). Isolated genes permit the study of 
gene function and control without traditional genetics. We hope eventually 
to understand what switches genes on and off in development and what 
accounts for the differential function of genes in specialized cell types. 



Department of Archaeology 

Mayan archaeology. The Institution made a great contribution to the 
study of ancient civilizations by providing substantial support over an 
extended period for archaeological explorations. Most of the effort was 
concentrated in Middle America. 

The Maya w^ere the most brilliant aboriginal people of the Americas. 
Their civilization had its beginnings in a primitive farming culture several 
centuries before the birth of Christ. During the Classic Period, which 
began about A.D. 300, magnificent temple-adorned cities were built, in- 
cluding Tikal, Copan, Uxmal, and many other cities of lesser splendor. 
After the Classic Period, the stimulus of the foreign Toltec culture helped 
produce the great city of Chichen Itza in northern Yucatan, which rose 
to prominence about A.D. 1000. 

Among the Maya's intellectual triumphs was extraordinary astronomic 
and calendrical knowledge surpassing that of any of their contemporaries 
on the Eurasian landmass. The Maya produced hieroglyphic inscriptions 
and were the only New World people who consistently and accurately 
recorded dates. The Maya had no telescopes, of course, only their eyes, 
and patience, and careful records. They computed the solar year at 365.2420 
days. Present-day calculations, made with the most advanced computers 
and chronometers, give a value of 365.2422. 

The Carnegie Institution entered the Maya field in 1914 when Sylvanus 
G. Morley was appointed a Research Associate. For ten years he explored 
the Maya area, visiting practically all the known sites and discovering 
many new ones. His explorations greatly enhanced our knowledge of the 
territory occupied by the Maya at different periods and the state of devel- 
opment of their civilization at those times. Morley was an expert in de- 



REPORT OF THE PRESIDENT S7 

ciphering Mayan inscriptions, many of which he discovered, and much 
of his work was based on these glyphic time-markers. 

In 1924, Carnegie's archaeological efforts were intensified. Chichen Itza 
was the primary site chosen by Morley at the beginning of the campaign. 
The site is accessible and salubrious. It is famous for the number and 
architectural distinction of its buildings. When the new venture began, 
Morley and the Carnegie Institution established a policy that was uncom- 
mon for its time. Instead of building a '^Carnegie Collection" of priceless 
artifacts, the Institution's archaeologists handed over the treasures they 
found to the host governments. 

Morley wanted to make Chichen Itza a lasting and beautiful monument 
to the genius of the ancient Maya. This again involved behavior uncom- 
mon at the time. To obtain the data he needed would have been simple. 
Plazas could be trenched, pyramids torn open, and the ruined temples 
stripped of protective mounds. These procedures would have been quick 
and cheap. But they would soon have been followed by destruction by 
weather and vegetation, leaving a meaningless jumble of stones. Both the 
Mexican Government and the Carnegie Institution understood the neces- 
sity for care in digging and leaving all cleared structures in a condition to 
resist deterioration. Morley's efforts have endured. Recent visitors to 
Chichen Itza have remarked on the excellent appearance of the place. 
They have also said that the names Sylvanus Morley and Carnegie are 
mentioned with reverence. 

Major studies of the Maya continued until 1956, although digging 
slowed after 1940. The late 1920s and the 1930s were marked by prodigious 
efforts at many sites, leading to scores of books, monographs, and articles 
containing thousands of illustrations. 

In the study of the Maya, the Institution made a difference. It also 
served as a model for others in the conduct of archaeological investigation. 

Ceramics. Ceramics are some of the most important artifacts of ancient 
civilizations. Emil Haury, the distinguished anthropologist-archaeologist, 
has said, ^'Ceramics are to the archaeologist what fossils are to the paleon- 
tologist." Clays, the raw materials of ceramics, are well-nigh universal, 
and the production of simple, useful objects is easy. Consequently, enor- 
mous numbers of potsherds have been found. During digs at one Maya 
site, 500,000 items were recovered for study. Often, with time, the types 
of ceramics produced in a given place changed, and archaeologists use the 
physical appearance of objects as an important source of information. 

But sometimes, puzzling or misleading specimens are found. Ceramics 
makers may have displayed originality or bad technique. Ceramics from 
another locality may have been introduced. Indeed, knowledge of such 
importations and of their source is useful as an indicator of commerce and 
interchange. In principle, much information can be obtained from chemical 



S8 CARNEGIE INSTITUTION 

and niineralogical analysis of the objects, since the composition of clays 
varies from place to place. 

Anna Shepard, an archaeologist of the Carnegie staff, recognized the 
value of obtaining and using expert knowledge of the physical chemistry 
and mineralogy of ceramics. She studied the subject thoroughly, including 
in her education a stay at our Geophysical Laboratory, and she spent 
considerable time making ceramic objects. Ultimately she distilled her 
knowledge into a 414-page book, Ceramics for the Archaeologist. First 
published in 1956, it has been reprinted nine times and continues to be 
used as the standard text. 



FACTORS FOSTERING EXCELLENCE 

The ability of the Institution to make a difference did not arise by 
accident. That ability is rooted in the precept that has guided the Institu- 
tion since its inception — to "encourage, in the broadest and most liberal 
manner, investigation, research, and discovery, and the application of 
knowledge to the improvement of mankind. . . ." 

Acting within this framework, Vannevar Bush, with the concurrence of 
the Board of Trustees, set forth the following description of a point of 
view that continues to guide our activities : 

Our field is fundamental science. And by this I mean that we 
seek out the facts of nature and their interrelationships, without 
attempting to apply them immediately to the needs and desires 
of man for physical comfort, power to control the forces of nature, 
or freedom from disease. We seek to acquire and correlate 
knowledge, not to participate in its applications. 

We know there may he a long interval between our work and 
its practical application, that the disconnected relations we find 
must often })e joined with those found by many other investi- 
gators before a useful pattern emerges. And yet this does not 
trouble us; for we are conscious of the problems that the race 
will struggle with long after our work has been merged in the 
general advance of science, and later generations will finally 
complete work we have l)egun. 

Most universities would assert that they follow similar policies with 
respect to scientific research. But the Institution differs from its academic 
counterparts in the way it conducts research. Patterns of our operation 
have evolved that make it possible for our people to be considerably more 
effective than many others of perhaps equal gifts. One factor is that the 
departments of the Institution have tended to be problem oriented in 
contrast to the project orientation or discipline orientation customary at 
universities. 



REPORT OF THE PRESIDENT S9 

An important benefit of problem orientation is that it creates a team 
spirit. If the problem is complex and requires an interdisciplinary approach, 
the necessary colleagues are recruited. From the beginning, the Institution 
has successfully fostered work on major problems that were best tackled 
by the interdisciplinary approach. 

One advantage of the interdisciplinary nature of the Institution's de- 
partments is that people can teach one another. When they are working 
together on a problem, something from each person rubs off on the other 
members of the group. This interaction tends to produce people of consider- 
able professional breadth. 

Some of the factors that foster creativity are stimulating and appreci- 
ative colleagues, the ability to achieve total immersion and the ability 
to avoid distracting interruptions. 

With our departmental structure we maintain intellectual islands. People 
on the islands can, if they wish, interact with others outside, but they 
can also withdraw and be free of interruptions for weeks at a time. Each 
place has its own particular esprit de corps, its own drive for excellence. 
Ability to be creative is enhanced when a group shares a set of enthusi- 
asms and compatible values. 

The Institution has functioned successfully under a wide variety of 
circumstances. It has adjusted to different economic climates, world wars, 
and a drastically changing scientific scene. 

In the early days, the amount of research in universities and industry 
was relatively small. After World War II, an enormous expansion of aca- 
demic and industrial research took place. In monetary terms, the impact 
of the Institution diminished although its activities in its chosen fields 
maintained their excellence. 

During the past decade and especially the past five years, the quality 
and quantity of the nation's support for fundamental research has de- 
teriorated. A marked shift has occurred in industrial research and develop- 
ment toward emphasis on quick pay-offs through improvement of existing 
products. Government support of research has become increasingly tangled 
in red tape with attendant requirements for very extensive documentation 
and associated delays. An especially regrettable development has been the 
government's virtual abandonment of support of postdoctoral fellowships. 
These adverse trends have occurred at a time when it is becoming clear 
that in the future trained minds and scientific knowledge will be even 
more important to society. 

The Institution's programs are geared to meeting educational and 
creative challenges. At the same time, much of our activity is in problems 
that relate to future human needs. 

One example is our Department of Plant Biology's fundamental studies 
of plants. There are two paths that the long-term solution to our energy 



40 CARNEGIE INSTITUTION 

problems can take. One of them is the breeder reactor and the other is the 
use o\ the sun. It is easier to collect the sun's energy in plants than it is 
to collect the sun's eneriiv via mirrors. What is more, the chemicals that 
are made in plants are more useful than the heat energy that the sun 
furnishes. There are many ways to make electricity, which fills a small 
part of energy needs, but what of the fuel requirements of a mobile society? 
What oi the many chemicals that enter all facets of the economy? The 
probabilities are that in the long run at least half the world's energy will 
come from biomass. Thus, the work at Plant Biology is in tune with long- 
term human needs. Fortunately we are in position to move decisively. 
Already there are in progress fundamental studies on the photosynthetic 
jM'ocess and investigations into mechanisms by which plants adjust to 
harsli environments. We have new facihties in an ideal central location 
at tlie Stanford campus. If this facility is not already the world center of 
plant biology research, it is about to become so. It has all the necessary 
characteristics of place and people and leadership. 

Another activity that will meet some of the important needs of the 
future is work that is going on at the Geophysical Laboratory. For many 
years the staff have been studying the rocks of the earth's crust and 
mantle. It has emphasized the study of silicates of which the world has 
an abundance. In the end, humanity must become increasingly adept in 
using abundant materials. 

Another aspect of the w^ork going on at the Geophysical Laboratory 
holds promise of yielding an understanding of the mechanisms by which 
ores are formed. These processes have long been a mystery. The textbooks 
of economic geology are full of speculations on how the various concen- 
trations of ore have occurred. No single model of ore formation has been 
accepted. In part, the problem was that too many puzzles were involved. 
The nature of ore-forming fluids was unknown, as well as why they should 
move. The means by which particular elements were carried, how they 
were concentrated, also was a mystery. 

What helps make the study of these matters more feasible at this time 
is understanding that has come from the concepts of colliding continental 
plate.^. It has become apparent that at least some of the ore-forming 
processes are a by-product of the collisions and subduction of plates. Such 
collisions and later related magmatic intrusions give rise to necessary 
temperatures and permeabilities of rocks that result in motions of fluids. 
If we completely understood the ore-forming processes, we would know 
how to interpret the outliers that accompany the ores. These are often 
found at some distance from the ore-body itself. Once the processes were 
understood, a limited amount of drilling could provide a large amount 
of information and guidance. The advantage of understanding deep-seated 
processes would be substantial, since the cost of drilling deep holes is very 



REPORT OF THE PRESIDENT 4^ 

high. If we are to find the deeper ores, we must have a better understand- 
ing of the processes by which they are concentrated. 

An important activity at the Geophysical Laboratory is its continuing 
development of super-high-pressure equipment in which experimentation 
can be carried out under unprecedented extreme conditions. In the past 
such pioneering has always led to new insights. Often it has resulted in 
unexpected practical applications. 

An important characteristic that sets humans apart is a search for 
understanding — a need to know. All of our departments, of course, seek 
to meet this need, but none is so clearly identified with this effort as the 
Hale Observatories. Who can look at the stars on a clear night and not 
be touched with wonder? 

With the new Irenee du Pont telescope in Chile, and the telescopes 
on Palomar and Mt. Wilson, our astronomers have at their disposal some 
of the world's best instruments. The effectiveness of this equipment is 
being continually upgraded by new and powerful accessories. The use of 
electronics in the detection of incident quanta permits subtraction of sky 
background and gives an important broadening of the spectrum that can 
be detected and measured. Where the optical telescopes were once limited 
to a range of about 0.3-0.7 micron, the spread is now about 0.3-100 
microns. 

The ability to work with the additional wavelengths in the infrared has 
created many new opportunities. A National Science Foundation Astron- 
omy Advisory Committee, which included participants from the Hale 
Observatories, recently listed nearly forty important areas for optical- 
infrared investigation. They were grouped under four main headings: 
Interstellar Medium, Galaxies, Quasistellar Objects, and Cosmology. Among 
the items listed under Interstellar Medium were: formation and miner- 
alogy of dust; the dynamical role of magnetic fields; the chemical evolution 
of the interstellar medium, in particular the return of stellar material after 
processing, and the galactic distribution of H2. 

Recommended studies of Galaxies included: determination of mass 
distributions in galaxies ; investigation of the problem of the missing mass ; 
study of the chemical evolution of galaxies, in particular the development 
of composition gradients; observation of events in galactic nuclei; deter- 
mination of the source and mechanism of ejected material. Other topics 
were relationships to sources of chemically processed material, dust forma- 
tion and ejection, infrared excesses in galaxies — their origin and the impli- 
cations for energetics, and the evolution of physical properties of galaxies 
with redshift. 

Quasistellar objects remain a source of puzzles and questions. They 
represent one of our best modes of observing events close to the beginning 
of time. 



J^iS CARNEGIE INSTITUTION 

Cosmology deals with such questions as whether the universe is open 
or closed — whether it will continue to expand indefinitely. This matter 
will be investigated intensively during the coming decade. 

Under its new Director, George Wetherill, the Department of Ter- 
restrial Magnetism has been reshaping its activities toward a more cohesive 
program. Many of the earlier activities will continue, for they have been 
fruitful and tliey fit into the desired pattern. Some of the questions being 
asked include: How was the solar system formed? How^ was the earth 
assembled? Was the earth put together by the assembly of heterogeneous 
pieces? How do the rocks beneath the continents differ from those beneath 
the oceans? What can be said about the structure of the deep interior of 
the earth? 

These are questions that have been asked many times, but until recently 
little substantive information was available to provide a basis for answers. 
But (hiring the past decade the solar system has been investigated using 
manned and unmanned spacecraft. It has been possible to compare the 
evolution of the earth with that of other planets, and to study and chemi- 
cally analyze planetary surface materials older than any found on earth. 
Clues about the origin of the solar system have been obtained from 
meteorites. 

Important advances have also been made in the study of the earth itself. 
The plate tectonic revolution has drastically altered our concepts of moun- 
tain building; it seems clear that the principal dynamic process determining 
the development of the crust and upper mantle is the movement of large 
lithospheric plates — the destruction of these plates in oceanic trenches 
and the formation of new plates at mid-ocean ridges. 

The Department of Terrestrial Magnetism has been active in many 
studies relating to these two lines of development and is moving to build 
upon them. 

To provide a comparative background for understanding our own solar 
system, optical and radio astronomical studies are under way bearing on 
the origin of stars, particularly observational evidence for supernova- 
triggered star formation. Observations on pre-main sequence stars of one 
solar mass are planned to provide observational constraints on questions 
such as the origin of the sun's slow rotation, the relationship of this to a 
possible T-Tauri stage of solar evolution, and the luminosity of the early 
sun. These are coupled with theoretical and numerical studies concerning 
the solar nebula and early solar system, investigations of possible isotopic 
anomalies of lithium using new techniques, and studies of charged particle 
tracks and microcraters in meteorites resembling lunar regolith breccias. 

In the earth sciences the staff are exploiting the insights afforded by 
understanding of plate tectonics to investigate the earth's mantle by means 
of a combination of geophysical and geochemical techniques. Discoveries 



REPORT OF THE PRESIDENT 4^ 

SO far lend support to models of the earth's origin whereby the planet was 
formed on a long time scale (about 100 million years) by the slow accumu- 
lation of large bodies, possibly including some as large as the moon. These 
models suggest an initial state of the earth that was thermally, mineralogi- 
cally, and probably chemically heterogeneous, and in which the working 
out of these primordial disequilibria is likely to represent to this day an 
important internal process. 

Other research projects currently under way at DTM which will con- 
tribute to our newly emerging picture of the earth's mantle include: (1) 
Seismological studies of the upper mantle beneath continents, island arcs, 
and oceans. (2) Geochemical and isotopic studies of rocks derived from the 
mantle. (3) Laboratory studies of diffusion in silicate melts and minerals. 

(4) Laboratory studies of attenuation and other seismic parameters in 
rocks (joint project with Carnegie Institution's Geophysical Laboratory). 

(5) Combined theoretical and experimental studies of the earthquake 
source mechanism. 

Some of the future of the Department of Embryology has been visualized 
by Ebert, and the following is adapted from his predictions: 

The techniques of gene isolation will be exploited, proceeding from the 
earlier successes in isolating and characterizing the genes. Animal genes 
are being produced in large quantities using the new recombinant DNA 
technologies. It will be possible to study the way in which sequential 
functions are related to spatial arrangements of genes. Such sequences 
should give information about the control mechanisms which regulate 
gene expression. 

Even more direct attacks on gene regulation may be made. It should 
be possible to understand the relations of genes to the proteins with which 
they interact. 

Ultimately it should be possible to faithfully reconstruct animal gene 
action in vitro. 

The cell membrane presents an attractive set of ^^targets." It serves not 
only as a port of entry, facilitating the selective transport of materials 
into and out of the cell but also as a site of organized biochemical activity. 
The central role of membranes in cellular organization has focused atten- 
tion in recent years on the structure of the membrane and the relation of 
this structure to function and properties. 

While it is apparent that the protein components of cellular membranes 
play the important structural and functional roles, it has become increas- 
ingly clear that the influence of the membrane lipid may be considerable, 
both in maintaining a suitable local environment for particular membrane 
proteins and in contributing to the spatial organization of membrane 
elements through lateral phase separation of membrane lipids. 

Just as it has been necessary to isolate and characterize specific genes, 



J^ CARNEGIE INSTITUTION 

SO it will be essential to isolate specific functional membrane components, 
for example, the specific "receptor sites" at which other cells or molecules 
interact with a given cell type. The field is a continuum in which we must 
take account of the biogenesis and turnover of membrane macromolecules ; 
membrane genetics and the differentiation of functional components in 
specialized cell membranes; the molecular basis of membrane changes in 
response to hormones; and the basis of changes related to cell differenti- 
ation and growth, both normal and abnormal. 

Within the next decade we should have a far better understanding than 
we have today of the structure, functions, and biogenesis of both genes 
and cell membranes. We should know the intimate workings of cells that 
we perceive today only in bold outline. We should have begun to lay the 
groundwork for a concerted attack on the mechanisms whereby cells inter- 
act, leading to an attack on the factors that shape tissues and organs 
like the brain. 

EDUCATION 

This report has emphasized practical achievements and research ac- 
complishments. Little space has been devoted to educational activities. 
Nevertheless, w^e are as proud of our fellowship program and our alumni 
as we are of the more visible achievements. 

The Institution has fostered the intellectual development of young 
people and aw^arded fellowships for study at the departments. Soon after 
Caryl Haskins became president in 1955, he expanded the fellowship 
program, and the fruits of this initiative are now being seen in distin- 
guished alumni. The program was very successful during the late 1950s 
and 1960s even while federal funds were readily available for fellowships. 
Developments of the last decade have made the program even more 
desirable. Government support of fellowships has been drastically cut. 
Most postdoctoral stipends that are available are made part of grants or 
contracts and bear the title of research associate. What should be a fellow- 
ship with the challenges and freedoms that the word implies is instead a 
job of work with a definite employer-employee relationship. 

At the Carnegie Institution our policies and circumstances encourage 
maximum development of the fellows. Equipment, materials, and counsel 
are readily available. The fellows are not just part of a team; they are 
expected to apply initiative, imagination, judgment, and energy to the 
problems they have chosen. 

President Haskins' decision in 1955 had an important bearing on events 
in 1970. Legislation had been enacted that placed restrictive burdens on 
foundations. But, because the Institution had established itself as an edu- 
cational institution, it was granted the tax status enjoyed by universities. 



The Year in Review 



DEPARTMENT OF EMBRYOLOGY 

The regulation of cell surface properties during development and the 
role these properties play in the interactions between cells are among the 
most important phenomena of biology. To study these phenomena one 
might choose among many systems. Douglas Fambrough and his colleagues 
have made an excellent choice: the relationship of nerves and skeletal 
muscles. That relationship is of obvious importance to most forms of life. 
The system is a particularly apt one for study because such diverse crea- 
tures as leeches, flies, mice, and men use many of the same chemicals and 
enzymes in their neuromuscular interactions. Since disruptions of the nor- 
mal interactions between nerves and muscles are associated with many 
debilitating diseases in man, this parallelism among organisms is of great 
potential value as a route to the discovery of cures for human afflictions. 

A great array of experimental techniques has been brought to studies of 
the nerve-muscle system in the past few years. All the latest developments 
in embryological methods have been applied: radioactive tracers, heavy 
isotopes, ultracentrifugation, enzymes, and laser beams. This research has 
focused to a large extent on the acetylcholine receptors of skeletal muscle 
fibers, including the role of acetylcholinesterase. 

The acetylcholine receptors are glycoproteins embedded in the plasma 
membranes of skeletal muscle fibers. They function as the recognition 
system for signals from motor nerves. The number and distribution of 
acetylcholine receptors in skeletal muscle fibers are regulated during de- 
velopment and in the continuing interactions between nerve and muscle. 
An important aspect of this regulation is control of the biosynthesis and 
degradation of receptor molecules in the muscle fibers. It has been one of 

45 



Jfi CARNEGIE INSTITUTION 

Fambrough's major research efforts to elucidate the mechanisms of re- 
ceptor metabolism. 

In this year's Report Fambrough and P. N. Devreotes summarize studies 
which indicate that the lipid intermediate pathway of the protein gly- 
cosylation (involving dolichol phosphate) operates early in receptor bio- 
synthesis. Newly synthesized receptor molecules, already containing 
significant carbohydrate, are located in the Golgi apparatus where they 
may reside for about 2 hours before transport to the cell surface. They 
constitute about 10% of all receptors in the system. In the plasma mem- 
brane the receptors are targets for the cells' degradation mechanism, which 
involves interiorization of receptor molecules, transport to secondary lyso- 
somes, and proteolytic destruction. John M. Gardner has investigated 
receptor degradation and found that the normal half-life for a receptor in 
the plasma membrane of tissue-cultured embryonic skeletal muscle is about 
17 hours. 

Another glycoprotein prominently involved in neuromuscular inter- 
actions is the enzyme acetylcholinesterase. This enzyme is manufactured 
by the muscle in several different molecular forms, occurring variously as 
a cytoplasmic enzyme, a cell surface enzyme, and an enzyme released from 
the muscle fibers into the extracellular milieu. Richard Rotundo has 
directed attention to this enzyme as a likely means of getting at the 
mechanisms of nerve-muscle interaction during the formation of neuro- 
muscular connections. The study of the acetylcholinesterases has been 
conducted using methods developed during the study of acetylcholine 
receptor metabolism. These methods facilitated the determination of the 
interrelationship of the' molecular forms of the esterase. Comparisons of 
receptor metabolism and esterase metabolism may illuminate the relation 
between the biosynthesis of plasma membrane glycoproteins and the bio- 
synthesis and secretion of secretory glycoproteins. 

When considering interactions of cells, a relevant matter is the nature 
of their respective membranes. Are the components of a membrane fixed 
spatially or are they free to move about? Considerable evidence has been 
adduced that some components are mobile. 

Fambrough and Richard E. Pagano have begun a collaborative investi- 
gation of the freedom with which various surface constituents of cells 
move in the plasma membrane. They attach fluorescence molecules to the 
cell surface and bleach a tiny region of it with a fine laser beam. The 
rate at which the bleached region is then filled is determined by the 
fluidity of that portion of the membrane. They have found that ACh 
receptors, unlike other regions of the membrane, are anchored to the 
surface. 

Most of the studies of nerve-muscle interactions at the Department have 
been directed toward the muscle component. Kenneth J. MuUer has been 



REPORT OF THE PRESIDENT 4^ 

devoting his attention to the nerves. For his experimental subject he has 
chosen the medicinal leech, which has a relatively simple nervous system 
in which changes can be followed in detail. When a neural connection is 
severed, regeneration usually follows, with the proper connection being 
reestablished. Muller describes the sprouting and directional growth of 
axons from a crushed neuron toward the distal stump of a neighboring 
neuron. The target stump sends detectable electrical transmissions toward 
the regenerating fiber until contact is made; then the stump disappears. 

One of the goals of the Department has been to isolate genes and study 
their activities in vitro. This objective has often seemed unlikely of attain- 
ment, but recently substantial progress toward it has been made. The first 
breakthrough was the isolation of small amounts of the gene 5S DNA 
from the frog. The amounts obtained were very small, but once small 
amounts of a gene are available the new recombinant DNA techniques 
can be used to replicate the genie material many times. This is accom- 
plished by inserting the gene into a specific chromosome of the genome of 
the K-12 strain of Escherichia coli and then culturing the altered bacteria 
so as to produce a large number of them, and thus of the desired gene. By 
the use of established restriction enzyme techniques, the animal gene 
material can be extracted from the bacterial chromosome and the genes 
then isolated. 

This technique was employed by Donald Brown and colleagues to pro- 
duce substantial quantities of frog 5S DNA. Subsequently, in a collabora- 
tion involving Brown and John Gurdon of the MRC Unit of Molecular 
Biology at Cambridge, England, the 5S DNA was injected into the nuclei 
of frog oocytes. It was observed that the added 5S DNA had been tran- 
scribed by the apparatus within the nucleus to form 5S RNA. This result 
seems important, for one can visualize two further lines of experimentation. 
The oocyte system could be used as a testing ground either for studying 
the action of genes or for determining what components are essential for 
DNA transcription. 

In other work related to the 5S DNA gene, Nina Fedoroff has used 
techniques pioneered by F. Sanger of the MRC Unit in Cambridge to 
work out the nucleotide sequence of one full repeating unit of 5S DNA 
from Xenopus laevis. This is the first animal gene and its spacer regions 
to be sequenced entirely. The sequence says a great deal about the evolu- 
tion of the spacer region and helps to localize possible control regions in 
the DNA. 

In examining the behavior of genes in making specialized substances, 
Yoshiaki Suzuki and Brown have devoted considerable effort — and with 
good success — to studying the production of fibroin by the silkworm. 
In 1972 they isolated the messenger RNA for the protein silk fibroin. 
Suzuki, Patrick Gage, and Brown then used the mRNA as a probe to 



48 CARNEGIE INSTITUTION 

show that cells that do not express the gene have the same number of 
genes as those that do express the gene. They found that in the case of 
silk fibroin the gene number is one per set of chromosomes. Since that 
time, tliis superlative developmental system has been explored by a series 
of workers in the Department. These studies have culminated recently 
in the isolation of the silk gene by Suzuki with the recombinant DNA 
methodology. There was little hope of isolating the gene from the animal's 
own n\A, since it is present in only one copy per haploid set of genes 
(one part in 40,000 of the animal's DNA). Only indirect studies could 
be carried out on this gene. Now, milligram amoimts of the gene are 
available in pure form. DNA regions on either side of the gene are present 
in some of the cloned gene fragments. These should contain sequences 
that control the expression of the silk gene in the living cell. 



DEPARTAIEXT OF PLANT BIOLOGY 

During the past two years a remarkable increase in the tempo of edu- 
cational activities and research has taken place at the Department of 
Plant Biology. Located in the middle of the Stanford University campus 
and having new laboratory space and new equipment, the Department 
interacts with Stanford botanists and students and with scientists of other 
universities. The research activity now consists of four major programs: 
photosynthesis, membranes, plant DNA, and physiological ecology. These 
programs interact and sustain each other, so that the sum is more than 
the total of the constituent parts. For example, photosynthesis involves 
chloroplasts and membranes. As another example, the ability of some 
plants to withstand and thrive in high temperatures is related to the 
thermal stability of their photosynthetic apparatus. The inability of some 
plants to thrive in temperatures close to but above freezing is related to 
the congealing effects of cold on the membranes. 

In general, techniques and understanding cultivated by one group are 
often utilized by the others. The DNA group, which is quite new, is devel- 
oping a body of information that may one day give it an important part 
in this interaction. One of the long-range goals is to improve the char- 
acteristics of plants. To do so will necessarily involve some kind of change 
in their DNA composition. First, however, one must look at the genomes 
of existing plants. Later the detailed information that is gathered about 
photosynthesis, membranes, and physiological ecology will provide criteria 
for choosing which DNA changes to make. 

Support of these important activities, particularly those related to 
photosynthesis, has been significantly bolstered by a much-appreciated 
grant from the Andrew W. Mellon Foundation. 



REPORT OF THE PRESIDENT 4-9 

The physiological ecology group has done extensive experimentation 
on the effects of temperature on whole plants or plant parts. Ulrich 
Schreiber and Joseph A. Berry, working with leaves of plants with large 
differences in heat tolerance, have monitored the changes in fluorescence 
either with gradually increasing temperature or with a sudden temperature 
jump under conditions yielding either fixed or variable fluorescence. They 
were able to rank the plants by heat stability and to distinguish differences 
in heat tolerance in specimens of a single species grown at different tem- 
peratures. They also showed that high light intensity can provide sub- 
stantial protection against heat damage. 

H. A. Mooney, Olle Bjorkman, and James Collatz studied photosynthesis 
in Larrea divaricata seedlings from Death Valley grown under three differ- 
ent temperature regimes in growth chambers. They found that the tem- 
perature optimum for photosynthesis was higher in plants that had been 
grown at higher temperatures, and established that the difference in be- 
havior was unrelated to differences either in the C02-fixing enzyme or in 
some aspect of photorespiration. They examined the effect of water stress 
on the quantum yield of photosynthesis for Larrea plants grown under 
ample water supply. When the stress was — 36 bars, the quantum efficiency 
was less than half that of amply watered plants. In contrast, the same 
plants growing in Death Valley showed a normal quantum efficiency and 
little change between — 20 and almost —50 bars. The results show that 
Larrea can photosynthesize effectively under remarkable drought stress in 
nature, but they also prove that one cannot extrapolate from greenhouse 
and growth chamber experiments without careful field studies. 

Paul A. Armond, Schreiber, and Bjorkman isolated chloroplasts from 
the Larrea plants grown under the three sets of temperature regimes, and 
investigated fluorescence properties of the chloroplasts with heating. Plants 
grown at the highest temperature regime showed little change in fluores- 
cence spectra with heating, although they had the largest photosynthetic 
units. Chloroplasts from plants grown on the other two regimes, however, 
showed marked heat damage to the mechanism of energy transfer from 
chlorophyll b to chlorophyll a at temperatures well below those required 
to inactivate electron support. 

More detailed experiments by Schreiber and Armond showed heat dam- 
age to the transfer of energy among forms of chlorophyll a as well; but 
during heat inactivation those reaction centers which were still active 
were fully active, and the photosynthetic unit size unchanged. These 
studies have added substantially to our knowledge of how one plant copes 
with drought stress and of the mechanisms of heat damage w^hen it occurs. 

In another study on heat damage, Bjorkman and Murray R. Badger 
investigated the thermal stability of 14 different photosynthetic enzymes 
from the high-temperature-adapted C4 species Tidestromia ohlongijolia 



50 CARNEGIE INSTITUTION 

ami the cool-temperature C4 species Atriplex sabulosa. Of the 14 enzymes 
studied. 4 had identical or similar heat stabihties in the two species, while 
another 6 showed differences of 6-10°C. 

Badiier. Aaron Kaplan, and Berry have also continued work begun last 
year on the mechanism by which the alga Chlarnydomonas reinhardtii 
adapts to growth on low concentrations of CO2. Their results show that 
the adaptation involves development of a system to concentrate CO2 from 
the external medium. This system is unrelated to C4 photosynthesis in 
higher plants. 

Fork has continued his studies of the influence on photosynthetic activi- 
ties of the physical phase transitions of thylakoid membrane lipids. In 
chloroplasts of lettuce and spinach that have high concentrations of un- 
saturated fatty acids, these phase transitions occurred well below 0°C. 
Fork and Xorio Murata obtained evidence that increasing either the 
magnesium or the potassium concentration in chloroplasts from spinach or 
lettuce markedly depressed phase transition temperatures. In contrast to 
the lettuce and spinach, in which the phase transition temperatures were 
all below 0°C, the thermophilic blue-green alga Sy7i echo coccus lividus — 
capable of growing photosynthetically at 75°C — showed a phase transition 
near 43°C when grown at temperatures above 55°C. When the algae were 
grown at lower temperatures, lowered phase transitions were seen. Con- 
sistent with the results obtained earlier with the blue-green alga Anacystis, 
the photosynthetic electron transport capacity of Synechococcus declined 
sharply below the phase transition temperature. 

]\Iurata and Fork also found that phase transitions could be detected by 
measuring the dark decay of the light-induced carotenoid change. These 
studies showed that chilling-sensitive plants had a phase transition above 
0°C that varied with growth temperature, while chilling-resistant plants 
did not. 

Fork and Mordhay Avron, who is on sabbatical leave from the Weiz- 
mann Institute in Tel Aviv, studied the influence of temperature on the 
rate of proton efflux through thylakoid membranes as monitored by the 
fluorescence of 9-aminoacridine. They found the rate sharply temperature 
dependent and an excellent indicator of phase transitions and other 
temperature-dependent membrane parameters. This technique also demon- 
strated differences between chilling-sensitive and chilling-insensitive higher 
plant chloroplasts. 

Avron and Schreiber describe use of the 9-aminoacridine for monitoring 
proton pumping and efflux, to determine how closely proton pumping 
parallels changes in the reduction of the primary system II electron 
acceptor when reverse electron transport is driven by exogenous ATP. 
Under a wide variety of conditions, the buildup of protons in the thylakoids 
was remarkably parallel to the reduction of the primary acceptor, strength- 



REPORT OF THE PRESIDENT 61 

ening the chemiosmotic hypothesis for energy transduction in chloroplasts. 
In addition, they found conditions under which electron transport could 
be driven backward to the photosystem II reaction centers with ATP, and 
they were able to monitor the process by chlorophyll luminescence. 

Larry N. Vanderhoef, on sabbatical leave from the University of Illinois, 
collaborated with Briggs in completing a detailed study on the influence 
of red light on elongation of the first internode of germinating corn 
seedlings. Red light treatment brings about an inhibition of growth that 
can be reversed by adding the plant hormone auxin. The inhibition shows 
two phases, one in response to extremely low doses of light and the other 
requiring far larger doses. An action spectrum for the first phase shows 
that there is a peak at about 665 nm, indicative of the action of the well- 
known photomorphogenic pigment phytochrome, but there is a second 
sharp peak at 640 nm which cannot be attributed to phytochrome. Earlier 
workers had noted the peak but otherwise ignored it. In membrane frac- 
tions from corn, Steven J. Britz, Suzanne Widell, and Briggs have detected 
a pigment absorbing near 630 nm that is effectively bleached by both red 
and blue light. They present evidence that it is a reasonable candidate 
for the 640-nm photoreceptor (pigments frequently show spectral shifts 
upon extraction). These studies point toward the existence of a photo- 
morphogenically active photoreceptor other than phytochrome absorbing 
in the red region of the spectrum. 

In other work on pigments, Robert Brain, Dow Woodward, and Briggs 
obtained evidence that Neurospora mutants deficient in 6-type cyto- 
chromes were also deficient in light-reducible cytochrome in membrane 
fractions and showed significantly impaired photosensitivity. That the 
reduced photosensitivity was not simply an indirect result of lowered 
respiratory capacity in the mutant was suggested by the appearance of 
normal photoreducible cytochrome responses in membrane preparations 
from another kind of respiratory mutant with normal cytochromes. These 
results, together with some obtained with pea and methylene blue, are 
the strongest to date implicating the flavoprotein-cytochrome complex in 
the blue light photoreception process. 



HALE OBSERVATORIES 

Anyone acquainted with investigators at the Hale Observatories must 
be impressed with the scope of their activities. A small staff, including ten 
members on the Carnegie side and eleven Caltech members, operate the 
telescopes on three mountains. They conduct deeply scholarly studies that 
are at the forefront of astronomy. They develop many new forms of elec- 
tronic and other instrumentation. They .act as hosts each year to some 60 



5f CARNEGIE INSTITUTION 

guest investigators from many institutions in this country and abroad. 
During the past seven years, staff have also devoted considerable attention 
to the design, construction, and testing of the new Irenee du Pont tele- 
scope on Las Campanas in northern Chile. Completion of this instrument 
removes a burden as it creates new opportunities for the staff. 

The design of a modern telescope that meets high standards of excel- 
lence necessarily entails many thousands of decisions, with a corresponding 
number of ways in which something can go wrong. Manufacture of the 
components also involves many occasions for errors. In addition, the 
logistical effort required to bring everything together on a remote moun- 
tain like Las Campanas is enormous. The task of building a telescope on 
Las Campanas is less demanding than that of building one on the moon, 
but not very much less. Everything that is needed must in both cases be 
brought to the site over a long supply line. 

Thus the staff, especially Horace W. Babcock, Director, and Arthur H. 
Vaughan, Assistant Director for Las Campanas, deserve warm congratula- 
tions on bringing the telescope into operation. 

Excellent photographic plates have been obtained from the instrument, 
and it is now being used for astronomical research. Additional auxiliary 
equipment is still being installed, but the major tasks are completed. 

The quality of the first large photographic plates is particularly im- 
pressive. The instrument and the accompanying plate-holder were designed 
for square plates 51 cm on a side, with star images that are no larger than 
0.25". The high quality of the plates attests to the overall excellence of 
design and construction of the telescope. The quality of the plates also 
ensures that the instruments will be very valuable in sky surveys. 

Alembers of the Hale staff enjoy certain traditional and organizational 
advantages. A small organization can be especially flexible and responsive 
to new opportunities. Hale astronomers enjoy many nights a year of tele- 
scope time, so they are able to undertake long-range research projects and 
address fundamental questions of the cosmos which can only be answered 
by the accumulation of large amounts of data. 

One such program is the one now being brought to completion by Allan 
Sanflage and G. A. Tammann on the observed velocities (redshifts) of all 
the brighter galaxies. It has involved the compilation of a consistent body 
of observational data over a forty-year period. The effort was begun in 
1936 by Hubble in his contacts with N. U. Mayall of the Lick Observatory 
and in direct collaboration with Milton Humason at Mount Wilson. Its 
aim was the acquisition of data either by direct spectroscopic observation 
or by compilation from published sources, to give the redshifts of all of 
the 1249 bright galaxies of the vShapley-Ames catalogue. That catalogue, 
published by the Harvard College Observatory in 1932, lists positions, 
angular sizes, and estimated magnitudes. A 1956 paper by Humason, 



REPORT OF THE PRESIDENT ' 53 

Mayall, and Sandage summarized results of the program up to that time. 
New spectroscopic observations, including many obtained by Sandage in 
Australia in 1969 and others he made at Palomar between 1970 and 1977, 
have resulted in 670 new redshift values for bright galaxies. Sandage and 
Tammann, in collaboration, have now compiled all known redshifts for 
the galaxies in the catalogue. It is expected that the revision will be pub- 
lished by the Carnegie Institution in 1978. 

The revised Shapley-Ames catalogue will include the reclassification 
as to type (spiral, elliptical, irregular, etc.) of all listed galaxies using the 
Hubble system. This reclassification was initiated by Hubble in 1946 on 
the basis of improved direct photographs. Over the years, Sandage has 
accumulated plates obtained with the 5-meter Hale telescope in the north 
and with the 1-meter Swope telescope at Las Campanas in the south. 
These photographs, together with others in the collection of plates made 
with the Mount Wilson telescope, form the basis for the classification of 
the more than 1200 new galaxies appearing in the upcoming publication. 

The immediate purpose of Sandage and Tammann in compiling the 
redshift observations is to provide a data sample that will permit deter- 
mination of the sun's motion (and of the motion of our Galaxy) relative 
to the inner metagalaxy — '^our part of the Universe." Analysis of the new 
body of data, with its nearly complete velocity coverage, has been begun 
by A. Yahil of Tel Aviv University and Tammann, with the aim of 
measuring perturbations of the local velocity field in the presence of 
density contrasts. Their goal is to assess the role of gravity in determining 
the global world model by using the velocity perturbations as measures 
of the local ratio of kinetic energy to gravitational potential energy. 

The subject of the structure and evolution of galaxies is now very active, 
and significant new insights are being achieved. A few years ago, Leonard 
T. Searle reported the discovery of chemical composition gradients across 
the disks of spiral galaxies. The discovery has been confirmed, and atten- 
tion has turned to the origin of the gradients and to the detailed physics 
of the ionized regions whose spectra provide evidence for these gradients. 
In the past year, Searle has collaborated with G. A. Shields of the Uni- 
versity of Texas in analyzing new observations of emission regions in the 
spiral MlOl. Searle and Shields find that in addition to the well-established 
abundance gradient there is also a gradient in temperature of the ionizing 
stars, the hottest stars occurring far from the center of the galaxy. Assum- 
ing that the ionizing stars share the abundance gradient of the gas, they 
show that this has important effects on the character of the ionizing 
radiation emitted by these stars. When these effects are both taken into 
account, the detailed models produce an excellent fit to the new observa- 
tions, and Searle and Shields find that the 0/H abundance ratio falls off 
as r~^^^ when r, the distance from the center of the galaxy, lies between 



54 CARNEGIE INSTITUTION 

5 ami 25 kiloparsecs. The observations rule out a theoretical prediction 
that the abundance would decrease linearly with radius. 

Stephen A. Schectman and George W. Preston have initiated a search 
for stars oi very low metal abunchmce in the halo of our Galaxy. The 
discovery of such objects would place important constraints on the early 
history oi nucleosynthesis during the contraction phase. For this survey, 
they have equipped the 4G-cm Schmidt telescope at Palomar with a large 
interference filter and an objective prism. The filter limits the extent of 
each spectrum to 100 A around the H and K lines of ionized calcium. This 
technique, with a survey limit near the 14th magnitude, permits easy 
rejection of the vast majority of stars showing normal H and K line 
strengths. The residual group of rarer objects includes w^hite dwarfs, nuclei 
of planetary nebulae, and the very-low-metal-abundance stars that are 
the objects of the survey. 

The use of the SIT Vidicon Cassegrain spectrograph and the multi- 
channel spectrometer has resulted in the discovery of over 50 additional 
degenerate stars by Jesse L. Greenstein and collaborators. They continue 
to find evidence for stratification in the atmospheres of degenerate stars 
and for the presence of relatively sharp but weak hydrogen lines in the 
spectra of quite cool objects that are dominated by helium. Two red 
degenerate stars studied by Greenstein and W. F. van Altena of Yale 
I'niversity are among the intrinsically faintest known, with visual lumi- 
nosity of about lO"** that of the sun. 

The new application of heterodyne spectroscopy at submillimeter wave- 
lengths has been started at the 5-meter telescope by T. Phillips and T. 
Huggins of the Bell Telephone Laboratories and Gerry Neugebauer and 
Michael W. Werner of the Hale Observatories. The receiver, based on an 
InSb hot-electron bolometer mixer, is mounted at the prime focus of the 
telescope. Its use has resulted in the first detection in an astronomical 
source of the ./ = 3-^/ = 2 line of CO at 345 GHz. The line has been 
mapped over the central few arc-minutes of the Orion molecular cloud. 
The emission peak is within 10" of known infrared sources. 

Jerome Kristian, Sandage, and James A. Westphal are continuing their 
program for measurement of the redshifts and magnitudes of the brightest 
cluster galaxies to extend the Hubble diagram to large redshifts. They 
now present new photometry for 33 clusters and new redshifts for 50 
clusters, extending to ^ = 0.75. The new data, combined with earlier sam- 
ples, show evidence for a positive curvature of the Hubble diagram, with a 
formal value for the deceleration parameter go (uncorrected for evolution) 
of 1.6. 

To avoid possible selection effects for the largest redshift clusters, 
Kristian, Sandage, and Westphal restricted the analysis of their sample to 
clusters with z < 0.4. The currently available data samples show, for the 



REPORT OF THE PRESIDENT 65 

first time, a significant departure of the Hubble diagram from a straight 
hue, with persistent indication of a positive curvature. If no evolutionary 
corrections are applied, the formal best-fit value for qo is 1.6 ± 0.35. The 
dispersion in the absolute magnitudes of the brightest cluster galaxies 
continues to be strikingly small: The best-fit values are Mv = —23.28 and 
Mr — — 24.09, with a dispersion of 0.28 mag for the first-ranked cluster 
galaxy in each passband. 

After a lapse of nearly fifty years since Bubble's original discovery of 
the redshift-distance relation, and the extension of observed distances by 
a factor of 200 since then, the data appear to be near to fulfilling their 
original promise as a possible test for cosmological models. The validity 
of this approach for finding go is now dependent on the outcome of efforts 
to understand the nature and size of galaxy-evolution effects during the 
look-back time. To consider two opposite cases, the present data show that 
if the universe is nearly empty {q^ ^ 0), then galaxies must have been 
about 1 mag brighter at z =^ 0.4. On the other hand, if there has been no 
net brightness evolution since z = 0.4, then the data show that the universe 
is firmly closed, finite, and oscillating. 

Althea Wilkinson and J. Beverley Oke have completed a study of the 
absolute spectral energy distributions of 54 brightest galaxies in faint 
clusters. About 15 objects have redshifts between z = 0.10 and 0.21 and 
constitute the sample with short look-back time. The remaining 39 clusters 
have redshifts between 0.21 and 0.47. Over the range in time corresponding 
to ^ = 0.10 to 0.46, B — V is found not to change by more than 0.03 mag. 
Other effects of size comparable to or greater than any color evolution 
are present, and a comparative analysis of the individual spectral-energy 
distributions suggests that one significant effect may be a dispersion in 
metallicity by a factor of 4 among the galaxies in the sample. 



DEPARTMENT OF TERRESTRIAL MAGNETISM 

To the huge populations that live in areas such as the Pacific rim, 
earth tremors are a continuing menace against which most inhabitants 
feel resigned and helpless. To Selwyn Sacks at DTM, earthquakes pre- 
sent great challenges. He joins with others in seeking ways of predicting 
the occurrence of quakes; but he also employs seismic waves as a tool to 
study the structure of the earth, including the deep interior, the roots of 
continents, and the properties of subducting tectonic plates. 

In such studies he uses information from other scientists from seismic 
arrays such as the WWSN (Worldwide Seismic Network). He supplements 
these data with observations made with very effective instruments invented 



56 CARNEGIE INSTITUTION 

and built at DTM, and he maintains his own inexpensive but productive 
international seismic array. 

Japan, the People's Republic of China, the Soviet Union, and the 
United States are carrying on large programs aimed at earthquake pre- 
diction. To date, the most useful program has been that of the Chinese. 
However, they completely missed predicting the huge quake of July 28, 
1976. Evidently the relatively simple models of events preceding earth- 
quakes leave out important phenomena. One of these is ''slow earthquakes,'' 
a phenomenon described in this Report by Sacks, Shigeji Suyehiro, Alan 
T. Linde, and J. Arthur Snoke. These are extremely low frequency seismic 
events characterized by large strain energy but radiating almost no energy 
in the normal frequency band. They are not detected by ordinary seis- 
mometers but can be observed with the borehole strainmeter developed by 
Sacks and Dale W. Evertson. This instrument extended the spectrum of 
measurable seismic frequencies to zero Hertz. 

Using evidence obtained from borehole strainmeters located in Japan, 
Sacks and his associates now suggest that slow earthquakes may play a 
major role in the redistribution of strain energy preceding a major earth- 
quake, and that this redistribution may not occur until shortly before 
the earthquake. Because of this, it may not be possible to predict large 
earthquakes until a few days before they occur, since the necessary high 
stresses may not be present in the earthquake source region before then. 

In another study Kiyoshi Suyehiro and Sacks report measurement of the 
velocity structure of a slab of lithosphere in the Japan arc that is undergoing 
subduction into the interior of the earth. Observations like these are 
making it clear that the subducted slab is more than a hypothetical entity 
required to satisfy conservation of mass. It is a real and mappable feature 
of the earth. The new measurements supplement earlier investigations 
of the slab by Sacks, Hiromu Okada. and others that showed the slab to 
have a higher seismic velocity and Q than the surrounding asthenosphere, 
and identified the boundary between the slab and the underlying astheno- 
sphere. The new work shows that the seismic velocity within the subducted 
slab is not constant, but increases toward the lower boundary of the slab 
and can be interpreted in terms of a two-layer model of the slab. This 
model is in general agreement with the thickness and structure of the 
normal oceanic lithosphere in the western Pacific, and shows that for the 
most part these characteristics are preserved as the lithosphere undergoes 
subduction. 

Recent work is showing that the distinction between continent and 
ocean is a fundamental one and that a continent is characterized not only 
by its superficial crust but by a characteristic upper mantle as well. The 
continental lithosphere is found to be hundreds of kilometers thick, in 
contrast to the much thinner oceanic lithosphere. This is most apparent 



REPORT OF THE PRESIDENT 67 

in South America, where Sacks and Snoke identified seismic velocity re- 
versal at a depth of 400 km as marking the hthosphere-asthenosphere 
boundary. 

In their present report, Sacks, Snoke, and Husebye extend this con- 
clusion to the Baltic shield. Using the Norsar seismic array in Norway, 
they collected data on the seismic arrival designated Sj) (waves from 
distant earthquakes which propagated through the mantle as shear waves 
and converted to compressional waves at the continental lithosphere- 
asthenosphere boundary). From the arrival times of this phase, they 
calculated a boundary depth of 250 ± 15 km. Furthermore, the polarity 
of this converted Sp arrival relative to the normal shear wave arrival was 
used to show that the velocity decreased with depth at this boundary. 
This strengthens the interpretation of the boundary as one between a rigid 
lithosphere and a partially melted underlying asthenosphere. 

When combined with surface wave data, Q structure, and heat flow 
studies, this picture of a distinctive continental mantle of great thickness 
seems likely to be valid. Moreover, last year Christopher Brooks, David 
E. James, and Stanley R. Hart interpreted isotopic data from this and 
other laboratories as indicating that the continental lithosphere was old as 
well as thick. In this regard it seems similar to the deeper oceanic mantle 
beneath the asthenospheric source of the abundant ocean ridge basalts, 
which also shows isotopic evidence of preserving heterogeneities over a 
major portion of the earth's history. 

Our solar system was formed about 4.6 billion years ago, some 10 billion 
years or more after some of the earliest stars were born. The chemical 
composition of the planets provides evidence that the material of the 
solar system was once part of an antecedent star or stars. Studies of 
meteorites have shown that they too were assembled from materials that 
a relatively short time before had been part of a stellar nuclear reactor. 
What happened in the few millions of years before the solar system was 
assembled? 

One hypothesis that has long been considered is that new stars are 
formed from the remains of old ones. This year substantial evidence has 
been accumulated in support of this suggestion. William Herbst and George 
Assousa report both radio and optical evidence that the formation of stars 
is triggered by the shock waves associated with the explosion of super- 
novae — stars in the final stages of their evolution. They describe a region 
in Canis Major that they have identified as a supernova remnant by its 
circular structure and by 21-cm radio observations of an expanding hydro- 
gen cloud of a kind characteristic of supernova remnants. 

Another likely candidate of this type is also described by Assousa, Herbst, 
and Kenneth C. Turner. The discovery of even a few such objects is a 
strong argument that the process is an important one in star formation. 



58 CARNEGIE INSTITUTION 

Most identifiable supernova remnants are so young that star formation 
cannot yet have occurred in them, while in most known regions of star 
formation the process is so advanced that any evidence of an earlier 
supernova in the region has disappeared. 

George Wetherill has carried out new numerical and theoretical work 
on the important role played by relatively small planetary bodies in solar 
system events. The most complete quantitative treatment of the accumu- 
lation of a cloud of planetesimals into a terrestrial planet like the earth 
has*been given by Safronov and his co-workers. This earlier work considers 
the case in which planets are assumed to move in circular orbits, with 
negligible mixing of material from the vicinity of one planet to that of 
another. The present work extends this to the case of multiple planet 
growth with a planet's eccentricity, inclination, and distance from the sun 
allowed to vary as it will during its growth, in conformity with the laws 
of conservation of energy and angular momentum. It is found that con- 
siderable mixing of material should occur between one terrestrial planet 
and another : if the terrestrial planets did actually accumulate in this way, 
it is unlikely that their composition can be interpreted simply in terms 
of condensation from a solar nebula at temperatures determined by their 
solar distances, as is now commonly believed by cosmochemists. 

In a separate report, an investigation is made into the fate of the ^'left- 
overs" from this planetesimal swarm after the planets have grown to nearly 
their final mass. It is found that this evolutionary history may provide 
a natural explanation of the characteristics of the ''late heavy bombard- 
ment" of the moon and terrestrial planets which ended about 3.9 billion 
years ago, long after the formation of the planets themselves. Some 
members of this residual swarm may still be observable in the innermost 
asteroid belt. A third study, coauthored with J. G. Williams, describes 
why these particular asteroids are likely to be the present-day sources of 
iron meteorites as well as of meteorites which have experienced igneous 
differentiation, particularly the basaltic achondrites. 



GEOPHYSICAL LABORATORY 

In chemical laboratories, under carefully controlled conditions, remark- 
ably quantitative separations of constituents can be obtained. Elements 
originally present in very low abundances can be isolated in essentially 
pure form. On the earth's surface, in the oceans, and in the interior of the 
earth, enormous quantities of material are chemically processed by nature. 
On the surface of the earth, rocks and soils are selectively leached by 
water containing carbon dioxide and organic acids. In the oceans, sub- 
stances arriving from land are exposed to a higher pH and salinity than 



REPORT OF THE PRESIDENT 59 

that normally found on land, and reactions and sedimentation occur. In 
parts of the ocean, substances are exposed to anoxic environments con- 
taining hydrogen sulfide and organic chelating materials. Under these 
conditions, a great deal of chemical processing and concentrating of ele- 
ments occurs. 

In the interior of the earth, partial melting of rock and formation of 
magmas occur with partial chemical separation. When the magmas solidify, 
particularly when they cool slowly, there are further concentrations. 

Important mechanisms that give rise to ore deposits of some elements 
occur relatively close to the surface of the earth. These processes involve 
the movement of very hot water containing dissolved substances through 
rocks that have been partially fractured. Some constituents of the rocks 
are more readily dissolved than others. Near the surface many events 
occur; for example, as the solutions cool, solid materials are deposited. 

Large volumes of the earth's crust have participated in one or more 
episodes of weathering and subsequent sedimentation in the oceans. Some 
of the sediments have been subducted as part of tectonic plates. Thus, the 
history of the chemicals of the crust has been very complex. The scientific 
approach to assembling a basis for judgment on such complex phenomena 
is to break the larger problem into more manageable pieces. 

Qualitative features of the foregoing processes are well known ; what has 
been missing are many of the quantitative details, especially those involved 
in the formation and cooling of magmas and in the processes occurring 
when hot fluids interact with crustal materials ultimately to form ore 
deposits. 

These phenomena have come under increasing attention at the Geo- 
physical Laboratory. This year's reports describe many studies of the 
partitioning of trace elements during partial melting and solidification. 
They also summarize new studies aimed at working out the nature of 
ore-bearing fluids. 

This year Ho-Kwang Mao and Peter M. Bell used the diamond anvil 
pressure cell to produce pressures as high as 1,500,000 bars in experiments 
simulating conditions in the upper mantle of the earth. Their experiments 
revealed that perovskite is the most common structure found at these high 
pressures. 

In the diamond cell, Ho-Kwang Mao and Peter M. Bell determined the 
specific volumes of Cu, Mo, Pd, and Ag to approximately 1 Mbar. The 
specific volumes were referred to the pressure-volume Hugoniot data 
obtained in shock waves. These metals were selected because their Hugo- 
niot data require little correction and because they are considered the best 
available material in terms of physical properties for studies of equations 
of state. In addition, the spectral shift of the ruby Ri fluorescence line 
was measured in each experimental run ; thus the volume data on the four 



60 CARNEGIE INSTITUTION 

metals constitute primary pressure calibrations of the ruby spectral shift. 
The ruby fluorescence shift can now be used as a secondary pressure 
calibration. 

Mao. Takehiko Yagi. and Bell have begun an extended investigation of 
the experimental mineralogy of the deep mantle with the diamond cell. 
They report quenching experiments in the system Mg-Fe-Ca-Al-Si-0 in 
which new products could be identified by x-ray diffraction. The experi- 
ments done at 100-450 kbar and 1000°-1200°C produced complex assem- 
blages dominated by phases with the perovskite structure. One long- 
standing prediction about the mineralogy of the deep earth (300-1200 km) 
was that the known minerals in the upper mantle would be converted 
mainly to perovskite structures in the lower mantle. The results of the 
new experiments confirm that perovskite is a major phase. The possibility 
exists that all mineral compositions invert in part to perovskite structures 
at high enough pressures, but the present results indicate that the assem- 
blages will be more complex. The study includes in situ x-ray diffraction 
measurements to identify nonquenchable phases. 

Yagi. Mao. and Bell systematically studied the end members of the 
common rock-forming minerals in rocks at high pressures to ascertain the 
compositional limits of the perovskite structure. They were successful in 
synthesizing a perovskite structure, essentially a single phase, from the 
enstatite composition, MgSiO.^, and in determining its structure. The struc- 
tural determination led to a number of conclusions that may prove useful 
in understanding the behavior of other minerals at the high pressures of 
the earth's mantle. 

First, the metal-oxygen bond distances are significantly greater in the 
more dense perovskite than in pyroxene, olivine, or the oxides — perovskite 
has closer packed oxygen atoms. The metal site is very large, and the 
crystal-field intensity is greatly reduced. This reduction particularly affects 
the partitioning of iron, causing it to be excluded from the perovskite 
structure. 

Because of this, the perovskite structure is probably not as dominant in 
the mantle as would be predicted from density considerations alone. This 
leads to the suggestion that in the deep mantle perovskite and mineral 
oxide phases are coexistent. 

In another area of high-pressure experimentation, Robert M. Hazen 
anrl Larry W. Finger have modified a diamond-anvil cell for use on a four- 
circle, single-crystal x-ray diffractometer. The modified cell permits the 
determination of crystal structure while the crystal is at pressures of up 
to 100 kbar, making it possible to relate the physical properties of a 
crystal to its structure at the same pressure. The modified high-pressure 
cell combined with a new crystal-mounting technique and data collection 
procedure has resulted in the collection of a wider array of diffraction 



REPORT OF THE PRESIDENT 61 

data, better resolution, and a higher pressure range of greater stabihty. 
Studies on pyroxene, ruby, sihcate spinels, phlogopite, and a chlorite were 
carried out with the modified cell. 

In high-pressure refinements of the fassaitic clinop5n:'oxene from Angra 
dos Reis meteorite, Hazen and Finger have demonstrated the anisotropies 
in bond compression that exist in some silicates. In general, larger poly- 
hedra with cations of lower valence compress more than smaller polyhedra 
with cations of higher valence. Furthermore, longer bonds in large poly- 
hedra compress more than shorter bonds. On the basis of these observa- 
tions, they suggest that the packing of oxygens in clinopyroxene becomes 
more regular at high pressure. 

Finger and Hazen refined the crystal structure of a synthetic ruby 
doped with 0.4 mole % Cr at pressures up to 80 kbar. This pressure is 
considerably higher than had been previously obtained with a single- 
crystal, diamond-anvil high-pressure cell. The compression is linear within 
experimental uncertainty; however, the compressibility of the c axis is 
50% greater than that of the a axis. Under compression, the longer Al-0 
distance decreases more than the shorter one does; thus the structure 
becomes more regular as the pressure is increased. 

In most of the studies made on rock-forming materials the substances 
are subjected to high temperature and high pressure for a day or more. 
The materials are then very quickly cooled (quenched). Often the chemical 
compounds existing under the extreme conditions remain essentially un- 
changed during the quick cooling. However, this is not always true and 
major questions remain about the properties of silicates at high tempera- 
tures and pressures. Two studies are particularly noteworthy. One showed 
that the chemical nature of a molten silicate containing iron was sub- 
stantially altered by pressure. The other showed that when a fraction of 
a rock melts there is a simultaneous and very large change in its electrical 
conductivity and in the transmission of sound waves through it. 

David Virgo and Bjorn 0. Mysen employed Mossbauer techniques to 
study changes in the valence state of iron, particularly the effects of 
pressure on the redox states of iron in the melt. They noted a disappear- 
ance of part of the Fe^+, which they attribute to a change in the degree 
of polymerization of the silicate melt. 

The presence of liquid in a rock may have a major effect on its physical 
properties. For example, the decrease in seismic velocities in some regions 
of the upper mantle has been attributed to the presence of a small amount 
of melt. To examine this effect, Tsutomu Murase, Ikuo Kushiro, and 
Toshitsugu Fujii measured the compressional wave velocity in a peridotite 
in the region of its beginning-of-melting temperature at 1 atm. The 
velocities observed were almost constant at temperatures below that of 
the solidus but dropped rapidly to values close to those of molten basalt 



62 CARNEGIE INSTITUTION 

at temperatures just above the solidus. The variation of volume of melt 
with temperature and the aspect ratio of the thin films of melt observed 
confirmed that just a small amount of partial melt had had a considerable 
efi'ect on the wave velocity. 

Simultaneous with the change in w^ave velocity at the point where 
peridot ite bciiiins to melt, a large increase in electrical conductivity was 
noted at both 1 atm and 15 kbar. This sharp increase may be useful for 
marking the solidus temperature. 

LOSSES 

Although he will not retire until the end of fiscal 1977, I want to 
acknowledge in this Report the contributions of Horace W. Babcock to 
astronomy and to Carnegie Institution. 

He was born and grew up in Pasadena, California, not far from Mt. 
Wilson Observatory, w^iere his father worked as a physicist. He took his 
B.S. degree from the California Institute of Technology and his Ph.D. 
from the University of California. After serving as an instructor at the 
Yerkes Observatory in Wisconsin and the McDonald in Texas, he moved 
to Boston to do research on radar at M.I.T.'s Radiation Laboratory. The 
next year. 1942, he returned to Caltech for a project in rocketry. 

After the War, Dr. Babcock joined the Mt. Wilson and Palomar 
Observatories (now^ Hale Observatories) as a Staff Member of Carnegie 
Institution. His first project there was a search for magnetic fields in sharp- 
line stars. To detect the fields, he designed and built the Zeeman analyzer. 
This sensitive instrument enabled Babcock to find strong magnetic fields in 
a great many stars. He was then able to classify them according to the 
variability of their field strength and the reversal of magnetic polarity. 

Later, Dr. Babcock's focus shifted to the magnetic fields over the surface 
of the Sun. With his father, he devised the solar magnetograph, an electro- 
optical system for measuring and recording the strength, polarity, and 
distribution of the fields. Dr. Babcock also found ways to improve the 
ruling machine that prepared diffraction gratings, and he supervised a 
ruling laboratory where the ruled gratings were for many years produced 
and distributed as a service to astronomers around the world. 

When the 200-inch telescope was being erected on Palomar, he designed 
a precise automatic guider for steering it during stellar observations. 

Since 1964 Dr. Babcock has directed the Observatories during a period 
of great challenge and opportunity. Perhaps the two outstanding achieve- 
ments of the Observatories during Babcock's administration were the 
cosmological studies done by Sandage, Schmidt, and others, which changed 
our conception of the Universe; and the establishment of a major optical 
installation in the southern hemisphere, at Las Campanas, Chile. 



REPORT OF THE PRESIDENT 63 

The Institution's first Distinguished Professor, Elburt F. Osborn, re- 
tired this year. Dr. Osborn's career in petrology has included two periods 
of association with our Geophysical Laboratory. He was a Staff Member 
at the Laboratory from 1938 to 1945. And in 1973 he returned as Dis- 
tinguished Professor of Carnegie Institution. In the intervening years 
Dr. Osborn was Professor of Geochemistry at the Pennsylvania State 
University, where he also served as Dean of the College of Mineral Sciences 
and Vice President for Research. In 1970 he was appointed Director of 
the U.S. Bureau of Mines of the Department of the Interior, a post he 
held until rejoining Carnegie Institution in 1973. 

Dr. Osborn's work on hydrothermal studies and crystallization phe- 
nomena and on phase equilibria has generated more than a hundred publi- 
cations and has brought him numerous honors, including the Roebling 
Medal of the Mineralogical Society of America, the John Jeppson Award 
of the American Ceramic Society, and four honorary degrees. 

. . . AND GAINS 

Maarten Schmidt, 47, has been chosen by Carnegie Institution and the 
California Institute of Technology to direct the Hale Observatories, be- 
ginning July 1, 1978. 

Dr. Schmidt is best known for his recognition of the large redshifts in 
the spectra of quasars, a finding that led to the conclusion that they are 
the most distant and most powerfully radiating objects in the Universe. 
Quasars continue to be an important part of Dr. Schmidt's research pro- 
gram, along with radio sources of other kinds and x-ray sources. Recently 
he has been studying stars that are relatively close to us — only about a 
hundred light-years away. 

Dr. Schmidt's association with the Observatories began in 1956 when 
he came to Pasadena as a Carnegie Fellow, after taking his Ph.D. in 
astronomy at the University of Leiden. After his fellowship he went home 
to The Netherlands but returned to the U.S. in 1959 to become a Staff 
Member of the Observatories and an Associate Professor at Caltech. He 
has served as Executive Officer for Astronomy and Chairman of Caltech's 
Division of Physics, Mathematics, and Astronomy. In his new post of 
Director of Hale Observatories, Dr. Schmidt will continue as Professor of 
Astronomy. 

In Maarten Schmidt the Hale Observatories will have an outstanding 
scientist of international reputation and an experienced administrator to 
carry on a tradition of excellence in astronomy. 

The following honors were awarded to Staff Members during the past 
year: 



^4 CARNEGIE INSTITUTION 

George W. Wetherill, Director of the Department of Terrestrial Mag- 
netism, was elected President of the International Association of Geo- 
chemistry and Cosmochemistry at the Association's General Assembly 
in Paris in May 1977. 

L. Thomas Aldrich of DTM was reelected General Secretary of the 
American Geophysical Union for a two-year term that began in July 1976. 

A'era C. Rubin of DT]\I was appointed a member of the Visiting Com- 
mittee of the National Radio Astronomy Observatory and a member of 
the Msiting Committee of the Department of Astronomy, Harvard Uni- 
versity. 

Winslow R. Briggs. Director of the Department of Plant Biology, 
was elected President of the California Botanical Society for the year 
1977-1978. He was also elected a Fellow of the American Association for 
the Advancement of Science. 

James E. Gunn and George W. Preston of the Hale Observatories were 
elected to the National Academy of Sciences. 

Peter M. Bell of the Geophysical Laboratory received the Exceptional 
Scientific Achievement Medal at the 1976 NASA Annual Honor Awards 
Ceremony in November 1976. 

During the past year the Institution has enjoyed the generosity of its 
trustees, employees, and friends, who contributed a total of $241,302 to aid 
the Institution in its work. 

Grant support has been equally gratifying. The Andrew W. Mellon 
Foundation has endowed the Institution with $200,000 a year for the next 
three years to be used for research in photosynthesis at the Department 
of Plant Biology. The Max C. Fleischmann Foundation has given a 
quarter-million-dollar grant for renovating and equipping the building in 
which the Embryology Department is housed in Baltimore. The Carnegie 
Corporation of New York has agreed to extend fellowships in the natural 
sciences for the next four years, and is providing $90,000 a year for this 
purpose. All the departments of the Institution will benefit from this 
grant. In the past year the National Science Foundation provided addi- 
tional grants of $340,000 which went to DTM, Hale, and the Geophysical 
Laboratory. NASA gave grants in the amount of $114,000 for research at 
Hale Observatories, and the Embryology Department benefited from 
grants totaling $353,000 from the U.S. Public Health Service. Other grants 
were received from the Whitehall Foundation, the Helen Hay Whitney 
Foundation, the Office of Naval Research, the Muscular Dystrophy Asso- 
ciation, and the Corning Gla.ss Works Foundation. 



REPORT OF THE PRESIDENT 



65 



FACULTY, FELLOWS, AND STUDENTS 

1976-1977 



DEPARTMENT OF EMBRYOLOGY 

Baltimore, Maryland 

Director 

Donald D. Brown 

Staff Members 

Igor B. Dawid 
Douglas M. Fambrough 
Kenneth J. Muller 
Richard E. Pagano 
Ronald H. Reeder 
Yoshiaki Suzuki 

Fellows 

Peter Botchan 
Salvatore T. Carbonetto 
Diana Card 
Jeffrey Doering 
Mark Dworkin 
Scott Emmons 
Nina Fedoroff 
Paul Geshelin 
Elizabeth Godwin 
Lawrence J. Korn 
Eric Long 
Yasumi Ohshima 
Keiko Ozato 
Richard Rotundo 
Alex Sandra 
Barbara Sollner-Webb 
Masatoshi Takeichi 
Katherine Tepperman 
Yoshihide Tsujimoto 
Walter Wahli 
Harvey Wahn 
Peter K. Wellauer 

Students 

Jeffrey Chernak 
Brian Cooley 
Peter Devreotes 
John M. Gardner 
Margie M. Goldberg 
Robert A. Hipskind 
Les Katzel 
Marc C. Krauss 



Jose Ramirez 
Shigeru Sakonju 
Nancy A. Union 



GEOPHYSICAL LABORATORY 
Washington, D.C. 

Director 

Hatten S. Yoder, Jr. 

Carnegie Institution 
Distinguished Professor 

Elburt F. Osborn 

Emeritus Research Associate 
Emanuel G. Zies 

Staff Members 

Peter M. Bell 
Francis R. Boyd, Jr. 
Felix Chayes 
Gordon L. Davis 
David H. Eggler 
Larry W. Finger 
John D. Frantz 
P. Edgar Hare 
Thomas C. Hoering 
T. Neil Irvine 
Ikuo Kushiro 
Ho-Kwang Mao 
Tsutomu Murase 
Douglas Rumble III 
David Virgo 

Fellows 

Nicholas T. Arndt 
Timothy M. Benjamin 
John M. Ferry 
Anthony A. Finnerty 
Toshitsugu Fujii 
Robert M. Hazen 
John I. Hedges 
Bjorn O. Mysen 
Howard R. Naslund 
Robert K. Popp 



66 



CARNEGIE INSTITUTION 



Joseph L. Ritchey 

Frank S. S}H\ir 
Juergon Trochimczyk 
Xoreen Tiiross 
E. Bruce Watson 
Richard F. Wendlandt 
Takehiko Yap 

Students 

Michael J. DeNiro 
.TiiUa A. Dill 
Dora Y. Lee 

Catherine A. McCammon 
Marie H. Slezak 



HALE OBSERVATORIES 
Pasadena, California 

Director 

Horace AV. Babcock 



Fellows 

William M. Adams 
A. Oer de Briiyn 
Alan M. Dressier 
Daniel Y. Gezari 
Richard F. Green 
Ediiardo Hardy 
]\Iark Hartoog 
Gordon J. Hurford 
Vincent Icke 
Frank Israel 
Stephen L. Knapp 
Daniel Kunth 
Kenneth A. Marsh 
Ronald Moore 
Larry D. Petro 
Douglas 0. Richstone 
Jack W. Sulentic 
Trinh X. Thuan 
Althea Wilkinson 
Peter Wilkinson 
Robert J. Zinn 



Associate Director 
J. Beverley Oke 

Staff Members 

Halton C. Arp 
Eric E. Becklin 
Jesse L. Greenstein 
James E. Gunn 
Robert F. Howard 
Jerome Kristian 
Robert B. Leighton 
Guido Miinch 
Gerry Xeugebauer 
S. Eric Persson 
George W. Preston 
Allan R. Sandage 
Wallace L. W. Sargent 
Maarten Schmidt 
Leonard T. Searle 
Stei)hen A. Shectman 
Arthur H. Vaughan, Jr. 
James A. Westphal 
Harold Zirin 

Staff Associates 

Robert J. Brucato 
Michael W. Werner 



Carnegie-Chilean Fellows 

Guido Garay 
Maria Teresa Ruiz 

Student Observers 

Steven V. W. Beckwith 
Kirk Borne 
Todd Boroson 
France Cordova 
David J. Diner 
Jonathan H. Elias 
John G. Hoessel 
John P. Huchra 
Steven Kent 
Barry J. Labonte 
Jorge Melnick 
Daniel Nadeau 
William C. Priedhorsky 
Douglas M. Rabin 
Russell 0. Redman 
Anneila I. Sargent 
Donald P. Schneider 
William L. Sebok 
David Sholle 
Richard J. Terrile 
Richard Wade 
Peter J. Young 



REPORT OF THE PRESIDENT 



67 



DEPARTMENT OF PLANT 
BIOLOGY 

Stanford, California 

Director 

Winslow R. Briggs 

Staff Members 
Joseph A. Berry 
Olle Bjorkman 
Jeanette S. Brown 
David C. Fork 
Malcolm A. Nobs 
William F. Thompson 

Emeritus 

C. Stacy French 
William M. Hiesey 

Fellows 

Paul A. Armond 
Mordhay Avron 
Murray R. Badger 
Heather S. Belford 
Michael R. Blatt 
John E. Boynton 
Steven J. Britz 
G. James Collatz 
John W. Cross 
James R. Ehleringer 
Arthur W. Galston 
George B. Johnson 
Aaron Kaplan 
Ulrich C. Knopf 
Jacob Levitt 
John M. Mackenzie, Jr. 
Norio Murata 
Michael G. Murray 
Peter H. Quail 
Charles E. Rogler 
Ulrich Schreiber 
Erich L. Schrott 
Alan J. Stemler 
Larry N. Vanderhoef 

Students 

Robert D. Brain 
Richard Cuellar 
Mary Enama 
Holly Gorton 
Richard Preisler 
U. M. Suzanne Widell 



DEPARTMENT OF 
TERRESTRIAL MAGNETISM 
Washington, D.C. 

Director 

George W. Wetherill 

Distinguished Service Member 
Merle A. Tuve 

Emeritus 

Scott E. Forbush 
Richard B. Roberts 

Staff Members 

L. Thomas Aldrich 
George E. Assousa 
Louis Brown 
Dean B. Cowie 
W. Kent Ford, Jr. 
Albrecht W. Hoffmann 
David E. James 
Alan T. Linde 
Vera C. Rubin 
I. Selwyn Sacks 
Fouad Tera 
Norbert Thonnard 
Kenneth C. Turner 

Research Associates 

Mordeckai Magaritz 
J. Arthur Snoke 
Kiyoshi Suyehiro 

Fellows 

Charles L. Bennett (trainee) 
Gregory S. DeWitt (trainee) 
John R. Evans 
William Herbst 
Felix J. Lockman 
George H. Pepper 
Charles J. Peterson 
R. Sundar Rajan 
Douglas 0. ReVelle 
Stuart J. Weidenschilling 
William M. White 
David J. Whitford 



Reports of Departments 
and Special Studies 



Department of Embryology 

Hale Observatories 

Department of Plant Biology 

Geophysical Laboratory 

Developmental Biology Research Group 

Department of Terrestrial Magnetism 



Department of Embryology 



Baltimore, Maryland 

Donald D. Brown 
Director 




•S ^ ^ ^ ^ 

^^ c» Q '^ 

'g ?^ 15 o" 
S ,5 .^ :t^ 



T3 






o 



bfl 

O 

m 

CD 



^ce o rt "2 

+= "^ Ph o a 

- 3 W o C^ 

03 W g g ^ 



03 
03 






S " 

- CO 



O "2 



CC 



O 



o 






o 



bC O o3 

"m ^ pq 

S a ^ §• .- 
^ cc - ^ 
o , 
;h o3 



e^ 



o 

+^ 
o 



cc 

S 'a; d 
o ^ ^ 



1— r " "—I r3 

'a gwlm I 

W)^ > ^ .S^ -5 




o3 



S <3 ^ CQ 

=^ .or. 

i.gflil 

" i2 e «> c a 









Contents 



Introduction 7 

Studies on Skeletal Muscle and Neuronal Plasma Membranes 9 

ACh receptor biosynthesis 11 

Studies on the glycosylation of ACh receptors 12 

Newly synthesized receptors reside in the golgi 14 

Regulation of acetylcholine receptor metabolism by electrical stimulation 17 

Degradation 18 

Incorporation 19 

Degradation of acetylcholine receptors 22 

Positional stability of acetylchohne receptors at the neuromuscular junction 28 

Studies on chick muscle acetylcholinesterase 29 

Properties of chick muscle acetylcholinesterase 30 

Cell surface versus internal AChE 32 

Release of AChE by chick muscle cells in culture 34 

Density shifting of acetylchohnesterase 36 

Acetylcholine receptors and a-bungarotoxin binding sites 37 

Organization and Interactions of Membrane Lipids in Mammalian Cells 41 

Studies of transbilayer distribution of phospholipids in mammalian cells 42 

Plasma membrane derivatives 42 

Asymmetry of the major phosphohpid species (PC and PE) 42 

Acyl chain asymmetry 45 

Adhesion of phosphohpid membranes to Chinese hamster fibroblasts: 

role of cell-surface proteins *..... 46 

Temperature dependence of vesicle uptake 50 

Influence of T(, on exogenous lipid incorporation by cells in suspension 50 

Mode of vesicle-to-cell adhesion 52 

Binding and capping of fluorescent dye containing lipid vesicles to 

lymphocytes 53 

Regeneration in the Nervous System : Formation of Specific Synapses in the Leech ... 55 

Regeneration of an electrical synapse 56 

The electrical synapse between S-cells 56 

Regeneration of the S-cell axon 56 

Reformation of the svnapse 57 

"Fusion" \ 58 

Survival of the distal stump 61 

The distribution of synapses of identified sensory neurons 63 

Structural and Functional Studies of the Fibroin Gene 63 

Cloning of fibroin gene plasmids 63 

Characterization of fibroin gene plasmids 67 

Definite identification of fibroin gene in the cloned plasmids 67 

Screening and restriction mapping of the fibroin gene plasmids carrying both 

mRNA coding sequence and flanking sequence (s) 68 

Determination of orientation of the cloned fibroin genes 71 

Identification of the site and sequence of the primary transcript of the 

fibroin gene 73 

Sequencing of a presumed regulatory region of the fibroin gene 75 



Ribosomal DNA and Related Sequences in Drosophila melanogaster 75 

Studies of cloned rDXA repeats 75 
Ribosomal DXA insertions in the Y chromosome nucleolus organizer of 

Drosophila 77 

Sequences homologous to ribosomal insertions occur elsewhere in the 

Drosophila genome 78 

Biogenesis of Mitochondria 82 

Mapping of 4S RNA genes in A''. laevis mtDNA 82 

Ribosomal Genes and their Proteins 84 

Structure of the nontranscribed spacers between ribosomal genes 85 

In vivo sites of RXA chain initiation on rDNA 87 

DXA replication origins in Xeiiopus rDNA 91 

Ribosomal gene chromatin 91 

Immunological cross reaction between calf and Drosophila histones 94 

Genetics bv Gene Isolation: The Dual 5»S RNA Gene System in Xenopus 96 

Xlt 5S DNA ' 97 

The oocyte injection system 97 

Sequencing studies on the 5aS DNA of Xenopus laevis 100 

The Structure of X. borealis oocyte and somatic 5S DNAs 102 

X'ucleotide sequence anah'sis of the region preceding the Xenopus borealis 

5S rRXA gene . ^ 105 

Computer analysis of nucleic acid sequences 106 

Preparation and transcription of bromodeoxyuridine-substituted Xenopus 

laevis 5S DNA 107 

The Collection of Human Embryos 108 

Developmental stages in human embryos 108 

Development of the nervous system 108 

Staff Activities ." 109 

Bibliography 110 

Personnel 112 



Carnegie Institution of Washington Year Book 76, 1976-1977 



INTRODUCTION 

A director is expected to ''chart a tion? Some p;enes make highly specialized 

course" for his department. A department substances, while others function in all 

with the title of Embryology would seem cells. What distinguishes these two classes 

to be already charted in its course. Yet of genes? 

the research in this department has Developmental biology is not a field or 

evolved remarkably. At present most of a discipline in the same sense as math, 

us use molecular tools, but this does not physics, or even some biological areas 

acurately convey our direction. Our di- like genetics. Developmental biology is a 

rection is wherever talented people take set of questions. The questions deal with 

us. Our course is charted by the staff and biological change and the influences on 

our colleagues, who follow their own sci- this change. It can safely be said that 

entific intuition. My major responsibility these questions are being attacked by 

as Director is to support these people in methods of such power that we can expect 

every way that will enhance the quality answers in the kind of molecular detail 

of their research. not even imagined ten years ago. The 

This is not an original approach. I reader of this report will find that many 

learned it from Jim Ebert. For 20 years of these new methods are in use in the 

the Department has benefited from the Department. Several of the methods have 

leadership of a man with broad scientific been developed, at least in part, here, 

interests and remarkable organizational In this report Suzuki describes the iso- 

ability. Jim Ebert emphasized the quality lation of the gene for silk fibroin with 

of research and favored independence and the aid of the new powerful recombinant 

innovation. I recognize with gratitude the DNA methodology. There was little hope 

role that he has played in encouraging of isolating this gene from the animal's 

my own research, in an atmosphere de- own DNA because it is present in only 

void of bureaucracy and irrelevant dis- one copy per haploid set of genes (one 

tractions. part in 40,000 of the animal's DNA). 

Despite the variety of projects, ani- Only indirect studies could be carried out 
mals, and materials, there is underlying on this gene. Now milligram amounts of 
continuity among the questions being the gene are available in pure form. DNA 
asked in the Department of Embryology, regions on either side of the gene are 
How are processes regulated in develop- present in some of the cloned gene frag- 
ing organisms? What influences a nerve ments. These should contain sequences 
to grow along a path toward another which control the expression of the silk 
nerve and then form a synapse at just gene in the living cell, 
the right moment? How does muscle A second, equally powerful method is 
know that it is innervated and respond DNA sequencing. Techniques pioneered 
by regulating the abundance and distri- by F. Sanger of the Medical Research 
bution of receptors on its surface? What Council (MRC), Laboratory of ]\Iolecu- 
surface molecules are responsible for lar Biology in Cambridge, England, have 
cell-cell recognition, and how is external made possible the step by step analysis 
information that impinges on cells trans- of the arrangement of the nucleotide 
lated into physiological change? Why building blocks in DNA. Nina Fedoroff 
does a gene work in one cell type but not describes the sequence of one full repeat- 
in another? Is the gene itself modified, ing unit of 5S DNA from Xenopus laevis. 
or is it directed by the molecules that This is the first animal gene and its 
associate with it? What are these mole- spacer regions that have been sequenced 
cules, and what regulates their produc- entirely. The sequence says a great deal 



8 CARNEGIE INSTITUTION 

about the evolution of the spacer region ward the degenerating fiber until contact 

and helps to localize possible control re- is made; then the stump disappears, 

gions in the DNA. Sandra and Pagano have used an in- 

Before the control of any gene can be genious method to measure the content 

reconstructed, the true "initiation" site of various lipids on each face of a cell's 

of RXA transcription must be known; plasma membrane. AVhen a cell engulfs 

and there must be a way to reconstruct a latex bead, the membrane surrounding 

faithful gene transcription in vitro. Prog- the bead is inside out. The composition 

ress toward both goals is reported here, of the inside surface has been compared 

Reeder has made use of an enzyme com- with that of the outside, which can be 

plex that can place a "cap" on the first analyzed in an intact cell. Translating 

nucleotide in an RNA molecule. He gives asymmetric lipid composition into its 

strong evidence that the enzyme can find functional meaning will be a provocative 

the initiation site of ribosomal RNA, and task for the future. Takeichi and Pagano 

Suzuki demonstrates the same for silk present evidence implicating proteins on 

fibroin messenger RNA, The second ad- cell surfaces in the interaction that these 

vance has been developed in collaboration cells can undergo with artificial lipid 

with John Gurdon of the ]MRC, Labora- vesicles. 

tor>- of ^lolecular Biology, Cambridge, Fambrough and his colleagues con- 
England. He has injected 5S RNA genes tinue their detailed and sophisticated 
(oS DNA) into the nuclei of frog oocytes, probe of acetylcholine (ACh) receptor 
and we have demonstrated that these synthesis and degradation. These recep- 
added genes can be transcribed into 5*S tors are glycoproteins and therefore bind 
RNA. A new stage of ''genetics by gene certain lectins. This feature is used to 
isolation" has begun which involves the show that glycosylation must occur 
analysis of important molecules that shortly after receptor synthesis. By 
cause genes to be transcribed faithfully in means of a specific inhibitor of this path- 
living cells. With this in mind, Wahn way, a dolichol phosphate pathway has 
and Reeder continue their analysis of been implicated for glycosylation of re- 
the ribosomal DNA chromatin isolated ceptors. Other studies are directed toward 
from oocyte nucleoli. tracing receptor proteins from their time 

Igor Dawid and his colleagues report of synthesis until their incorporation into 

progress on two projects. Some ribosomal the cell membrane. 

RNA genes of Drosophila melanog aster The protein bungarotoxin binds specifi- 

are known to contain extra stretches of cally to ACh receptors. The probe can 

DXA. The function and origin of these be labeled with ^^^I or ^^^I. New receptors 

"inserts" is unknown, but the same DNA can be synthesized in the presence of 

sequences are located elsewhere in the heavy isotopic precursors so that they are 

genome. Ramirez describes the map of distinguished from pre-existing receptor 

48 RNA genes throughout the mitochon- molecules. Using a variety of such com- 

drial genome of X. laevis. These genes binations, John Gardner and Diana Card 

are located all around the circular chro- have carried out detailed studies on the 

mosome and on both strands of the DNA. synthesis and degradation of these re- 

The medicinal leech provides a simple ceptors. 

.system in which to follow the directed Another cell-surface glycoprotein (or 

growth of one neuron until it connects group of proteins), acetylcholinesterase, 

with another. Muller describes the sprout- is being investigated by Rotundo. Various 

ing and directional growth of axons from forms of the enzymatic activity are as- 

a crushed neuron toward the distal stump sayed individually. The rates of synthesis 

of a neighboring neuron. The target and degradation of these enzyme forms 

stump sends detectable transmissions to- as well as their interrelationship will be 



DEPARTMENT OF EMBRYOLOGY 9 

compared with ACh receptor metabolism, two years at the MRC Unit of Molecular 
Fambrough and Pagano have begun a Biology in Cambridge, England, in the 
collaborative investigation of the freedom laboratory of Sidney Brenner. Brenner 
with which various surface constituents had begun studying the simple nematode 
of cells move in the plasma membrane, worm Caenorhabditis elegans. This crea- 
They attach fluorescence molecules to the ture has impressive credentials for de- 
cell surface and bleach a tiny region of velopmental and genetic research. It has 
it with a fine laser beam. The rate at a simple genome and a short life cycle, 
which the bleached region is then filled in both of which make it suitable for the 
is determined by the fluidity of that por- accumulation of genetic mutants. Dr. 
tion of the membrane. The researchers Ward's current interest is probing the 
have found that ACh receptors, unlike nature of the surface interactions between 
other regions of the membrane, are an- sperm and egg which lead to fertilization, 
chored to the surface. He will do this by obtaining mutants 

Carbonetto and Muller have discovered that interfere with gamete function. 
ACh receptors on the surface of sympa- We acknowledge the indispensable as- 
thetic neurons. This was originally found sistance of several agencies and founda- 
by bungarotoxin binding, but it has been tions to our research program. Grants 
confirmed by electrophysiological means, from the National Institutes of Health 
They are beginning studies on the metab- support in part the research programs of 
olism and biochemistry of these receptors Brown, Dawid, Pagano, Reeder, and Su- 
to determine whether they resemble the zuki. Money from the Whitehall Foun- 
well-studied ACh receptors of muscle dation. Inc., has made possible the col- 
surfaces, laborative project of Fambrough and 
We are especially pleased to welcome Pagano, mentioned earlier in this Intro- 
Sam Ward of the Department of Biologi- duction and detailed in the Report. Other 
cal Chemistry, Harvard University, as a areas of Fambrough's research have bene- 
staff member beginning in the summer of fited from a grant by the Muscular Dys- 
1977. He will occupy the laboratory va- trophy Association, Inc. Finally, I can 
cated by Jim Ebert. Dr. Ward received report the completion of extensive re- 
his Ph.D. in 1971 at the California In- modeling of unused animal quarters into 
stitute of Technology, where he studied new laboratory space. This could not 
the assembly of bacteriophage by genetic have been done without the generous as- 
and biochemical methods. He decided to sistance of a grant from the Max C. 
change to eukaryotic systems and spent Fleischmann Foundation. 



STUDIES ON SKELETAL MUSCLE AND NEURONAL 

PLASMA MEMBRANES 

D. M. Fambrough, R. E. Pagano, K. Muller, D. J. Card, J. M. Gardner, 

S. Carbonetto, R. Rotundo, and P. N. Devreotes 

with the technical assistance of D. Somerville, A. Mabin, W . Duncan, and B. Thomas 

Our research interests, broadly defined, nervous system and musculature. ]Much 

encompass the regulation of cell-surface of our research has been focused on the 

properties during development and the acetylcholine receptors of skeletal muscle 

role of cell-surface properties in the in- fibers. These receptors are glycoproteins 

teractions between cells. These two inter- embedded in the plasma membranes of 

related aspects of developmental biology skeletal muscle fibers; they function as 

are manifested most conspicuously and the recognition system for signals from 

gloriously in the development of the motor nerves. The number and distribu- 



10 CARNEGIE INSTITUTION 

tion of acetylcholine receptors in skeletal array of molecular forms by the muscle; 

muscle fibers are regulated during devel- it occurs as a cytoplasmic enzyme, a cell 

opment and in the continuing interactions surface enzyme, and an enzyme released 

between nerve and muscle. Some im- from the muscle fibers into the extra- 

portant aspects of this regulation involve cellular milieu. Our attention is being 

control of the biosynthesis and degrada- directed more and more to this enzyme 

tion of receptor molecules in the muscle because it may help us get at the mecha- 

fibers. Thus two of our major research nisms of nerve-muscle interaction during 

efforts have been to elucidate the mecha- the formation of neuromuscular connec- 

nisms of receptor metabolism, and to de- tions. Another reason for turning toward 

termine which mechanisms are most a study of the acetylcholinesterases is 

influenced during modulation of receptor that we have developed methods (during 

metabolism. We rej^ort here our findings the study of acetylcholine receptor me- 

that the lipid intermediate pathway of tabolism) that should permit us to de- 

the protein glycosylation (involving termine the relationships of the molecular 

dolichol phosphate) operates early in re- forms of the esterase. Finally, compari- 

ceptor biosynthesis. The newly synthe- sons between receptor metabolism and 

sized receptor molecules, constituting esterase metabolism may shed light upon 

about lO^r of all receptors in the system the relation between the biosynthesis of 

and already containing significant carbo- plasma membrane glycoproteins and the 

hydrate, are located in the Golgi ap- biosynthesis and secretion of secretory 

paratus. where they may reside for about glycoproteins. 

two hours before transport to the cell sur- Another cell-surface protein that has 
face. In the plasma membrane the recep- caught our attention is the binding site 
tors are targets for the cells' degradation for a-bungarotoxin on sympathetic gan- 
mechanism; this involves interiorization glion cells from the chick embryo. The 
of receptor molecules, transport to sec- a-bungarotoxin binding shows character- 
ondary lysosomcs, and proteolytic de- istics of binding similar to those of a 
struction. Our continuing investigation of cholinergic receptor, but functional tests 
receptor degradation has revealed that have been negative. Although we are un- 
the normal half-life of a receptor in the certain about the function of this a- 
plasma membrane of tissue-cultured em- bungarotoxin binding site, we can still 
bryonic skeletal muscle is about 17 hours, focus on this molecule in the studies of 
Treatment of receptors with the strongly membrane protein metabolism and its 
binding receptor blocking agent a-bun- relation to nerve growth and develop- 
garotoxin lengthens the half-life to about ment, thanks to the discovery of the 
22 hours. This increased receptor survival stabilizing effect of glutaraldehyde on the 
in the plasma membrane helps to explain a-bungarotoxin-binding-site complex, de- 
some puzzling observations related to the scribed later in this Report, 
existence of "hidden" receptor sites in The interactions between nerve and 
skeletal muscle. In the past few years muscle affect not only the metabolism 
other investigators have made a strong of the acetylcholine receptors but also the 
case for the primary role of muscle ac- receptor distribution on the muscle cell 
tivity in modulation of receptor numbers, surface. Within a few days of the forma- 
However, we have been unable to demon- tion of functional nerve-muscle contacts, 
strate that sort of connection in our ex- most of the extrajunctional receptors are 
perimental design. gone, and the remaining receptors are 
Another glycoprotein that plays a cru- clustered at high packing density in the 
cial role in neuromuscular interactions membrane opposed to the nerve terminal 
is the enzyme acetylcholinesterase. This (the postsynaptic surface). The mecha- 
enzyme is manufactured in a puzzling nism for clustering of receptors remains 



DEPARTMENT OF EMBRYOLOGY 11 

a mystery, and little is known about the receptors. As anticipated from earlier 

nature of the clustering itself. As part of findings, we found a lag of about 3 hours 

an investigation of the interactions of after switching to dense amino acid 

lipids and proteins in determining the medium before dense receptors began to 

functional properties of plasma mem- appear in the [)lasma membranes. This is 

branes, we have been studying these due not to a lag in equilibration of dense 

receptor clusters at neuromuscular junc- amino acids with intracellular amino acid 

tions. Elsewhere in this Report some pools but rather to a lengthy period of 

experiments are summarized which dem- biosynthesis and transport before recep- 

onstrate that individual receptor mole- tors are incorporated into plasma mem- 

cules at neuromuscular junctions are brane. The evidence that this is so comes 

severely restricted in their position. largely from the following observations. 

a-Bungaro toxin, which binds readily 

and almost irreversibly with acetylcho- 

ACh Receptor Biosynthesis jj^^^ receptors located on the cell surface, 

P. N. Devreotes and D. M. Famhrough ^^ unable to penetrate the plasma mem- 

brane of the muscle cells to interact with 

In previous Reports {Year Book 7 4 any receptor sites that might lie along 
and Year Book 75) we have described a the biosynthesis-transport pathway. It is 
strategy for the direct measurement of found that when muscle cells are grown 
biosynthesis of acetylcholine receptors, in the presence of a-bungarotoxin, there 
Skeletal muscle is maintained in organ is one set of receptors with which it does 
or tissue culture in a medium containing not become complexed. These receptors 
amino acids labeled with stable, heavy do, however, become available for «- 
isotopes of carbon, hydrogen, and nitro- bungarotoxin binding if membrane struc- 
gen. The receptors (and all the other tures are dissociated with non-ionic 
proteins made with such amino acids) are detergent solution. Electron microscopic 
denser than normal and can be separated evidence for the intracellular location of 
from normal receptors by velocity sedi- these receptors will be presented later 
mentation. Such dense receptors remain in the report. Our metabolic studies show 
responsive to acetylcholine and are syn- that this intracellular set of receptors is 
thesized and degraded at rates compar- actually composed of two equal-sized 
able to those of normal receptors. Since classes of receptor molecules, containing 
the magnitude of the density shift and all together about one-fifth as many re- 
the proportion of heavy and light recep- ceptors as are on the cell surface. When 
tors can be determined readily, the tech- the cells are switched to a medium con- 
nique can be used to measure the kinetics taining dense amino acids, the receptors 
of biosynthesis and the degradation of of one class quickly become labeled with 
receptor molecules. Its chief advantage is them. After about 3 hours this population 
that no purification of receptors is re- of receptors consists entirely of dense 
quired. With minor variations the tech- receptor molecules. These receptors are 
nique can be used in studies of the therefore precursors to the plasma mem- 
metabolism of other proteins, such as brane acetylcholine receptors. The ki- 
acetylcholinesterase (see below). netics of labeling of the intracellular 

In Year Book 75 we reported on the receptors are illustrated in Fig. 1. 

kinetics of appearance of newly synthe- The other class of intracellular acetyl- 

sized acetylcholine receptors in the plasma choline receptors, defined by its kinetics 

membranes of cultured chick skeletal of labeling, cannot be distinguished from 

muscles. We estimated that dense amino the receptors in the plasma membranes, 

acids had replaced the normal ones in a Why these sites are not exteriorized, we 

ratio of about four to one in the dense do not know. These receptors constitute 



12 



CARNEGIE INSTITUTION 



O 

o 
a. 

Ll_ 

o 



< 
en 



1 

KINETICS OF APPEARANCE 
OF % %'%- RECEPTORS 
IN PRECURSOR POOL 



/ 
/ 



A 



L4--t-"-'^ 



■..--i 



/F 



1 



10 



TIME (HOURS) 



Fig. 1. Kinetics of appearance of ^H, "C, ^^N-receptors in the intracellular pool. [^^]mono- 
iodo-a-bungarotoxin-receptor complexes involving the pool receptors were prepared from 
cultures incubated for the designated times in medium containing ^H, "C, ^^N amino acids. 
These receptors were analyzed by sucrose gradient velocity sedimentation to determine the 
fraction of pool receptors which were ^H, "C, ^^N receptors. 



a part of the "hidden receptor" popula- 
tion referred to in a previous publication 
(Devreotes and Fambrough, 1975). 

Studies on the Glycosylation of 
ACh Receptors 

D. Famhrough 

Biochemical studies of ACh receptors 
from eel and Torpedo electroplax have 
demonstrated that these ACh receptors 
are glycoproteins. Mammalian ACh re- 
ceptors are also glycoproteins, as judged 
by their interactions with the lectin 
concanavalin A, which binds to terminal 
a-mannoside residues of glycoproteins. 
When chick .skeletal muscle cells in cul- 
ture are treated with concanavalin A, the 
receptors can no longer be solubilized 
with 1% Triton X-100. Solubilized recep- 
tors interact with concanavalin A to form 
stable complexes which sediment rapidly 
in sucrose gradients. These interactions 



are blocked by a-methyl-mannoside, con- 
sistent with the specificity of the inter- 
action. 

Since the ACh receptors undergo such 
a long transport period between protein 
synthesis and display on the cell surface, 
we thought that part of this transport 
time might be related to glycosylation of 
receptor protein. If this were so, then it 
might follow that newly synthesized ACh 
receptors would lack the specific terminal 
sugar residues that render the mature re- 
ceptors susceptible to interaction with 
concanavalin A. We found, however, that 
all the receptors in the precursor popu- 
lation interact with concanavalin A to 
form high molecular weight complexes. 
Thus, during or very soon after biosyn- 
thesis of the receptor polypeptide chains, 
a significant amount of carbohydrate is 
added to them. 

There are two major pathways for the 
addition of carbohydrate residues to gly- 
coproteins. One is the glycosyl-transferase 



DEPARTMENT OF EMBRYOLOGY 



13 



pathway; the other is the dolichol- 
phosphate pathway. In the latter, pre- 
assembled chains of carbohydrate resi- 
dues are attached to asparagine residues 
of the protein. While there are no known 
specific inhibitors of the glycosyl-trans- 
ferase pathway, a recently discovered 
antibiotic, tunicamycin, has been shown 
to be a very selective inhibitor of the 
dolichol-phosphate pathway. 

We obtained a sample of tunicamycin 
as a generous gift from Dr. Skip Waechter 
(Department of Biochemistry, University 
of Maryland School of Medicine) and 
used it at a concentration of 1 /xg/ml in 
our culture medium in studies of receptor 
biosynthesis and incorporation into 
plasma membranes and receptor degrada- 
tion. At this concentration cultured chick 
skeletal muscle fibers survived in good 
condition for more than 50 hours (al- 
though the fibroblasts in the culture dis- 
sociated from the culture plate). The 
rate of ACh receptor degradation was 
not significantly different from that of 



control cultures at 24 hours and only 
slightly slower at 50 hours. Tunicamycin 
treatment reduced protein synthesis, as 
measured by '^H-leucine incorporation 
into proteins, by about 50% and blocked 
incorporation of ^^C-gluosamine into gly- 
coproteins by about 70%. These levels 
of inhibition developed over a period of 
3-4 hours and were stable thereafter for 
another several hours. 

In contrast to these partial effects, 
tunicamycin completely blocked the bio- 
synthesis of ACh receptors within a few 
minutes. Incorporation of ACh receptors 
into the plasma membrane was not in- 
hibited, and thus the intracellular pool 
of '^precursor" receptors was transported 
to the cell surface and incorporated into 
the membrane (Fig. 2). These results 
suggest that the carbohydrate moieties 
of the receptor include components added 
by the dolichol-phosphate pathway and 
that these carbohydrate additions are 
necessary for the biosynthesis of com- 
plete receptor units. 



ro 



U 





I 
Surface 


1 1 
= 96,500 cpm 


1 


I 1 


20 


- 


\ 




o/control 




- 


^ 


A 


A 


10 






A 

+ Tunicamycin 


2 


1 


1 1 


1 


1 1 



2 3 4 

Time (hours) 



Fig. 2. Incorporation of new ACh receptors into plasma membranes of cultured chick skeletal 
muscle (O-O). Effect of tunicamycin (1 /u,g/ml added to medium at time zero) on incorpora- 
tion (A-A). 



14 



CARNEGIE INSTITUTION 



Newly Synthesized Receptors 
Reside in the Golgi 

P. .V. Devreotes and D. Fambrough 

There are hundreds of acetylcholine 
receptors per square micrometer of plasma 
membrane in chick skeletal muscle cells 
grown in vitro. These cells also contain 
many intracellular acetylcholine receptor 
molecules, amounting to about 15-20% 
of all the receptors. ]Many of these intra- 
cellular receptors are newly synthesized 
and have not yet appeared in the plasma 
membrane. In the presence of puromycin, 
which rapidly halts protein synthesis, the 
intracellular pool of newly synthesized 



receptors decreases approximately line- 
arly to near zero in about 3-4 hours as 
an equal number of receptors appears in 
the surface membrane. Thus, in the 
present study we were attempting to de- 
termine the subcellular location of a set 
of receptor sites which (1) were unavail- 
able for interaction with extracellular 
receptor ligands, (2) were exposed to 
such ligands by techniques that render 
lipid bilayers permeable to large mole- 
cules, (3) constituted about 10-15% of 
all the receptor sites, and (4) decreased 
steadily in number when protein syn- 
thesis was inhibited until few such sites 
were present after 3-4 hours. 



b 


I.U 


^ 




1 


1 1 1 


1 




E 






\ 










o 

E 


0.8 




• 


^^ 


















\ 






O 










\^ 
















o 






o 

0) 


0.6 








X 






or 










^^ 


o 




*— 










" — 


X^ 




o 
















c 










.^-— i. 





• 


0) 


0.4 


- 








• 


c 
















**- 
















o 
















c 


0.2 


— 






' 




— 


o 
















'.«_ 
















o 
















o 
















^ 
















Ul 








1 


1 i 1 


1 


1 



2 3 4 

Time (hr) in Puromycin 



Fig. 3. Decline in saponin-revealed ACh receptors in cultured chick skeletal muscle after 
inhibition of protein synthesis by puromycin. Cultures were treated with unlabeled a-bun- 
garotoxin to block all surface ACh receptors, and puromycin was added to the medium of 
subsets of cultures at different times. Then all cultures were rinsed briefly to remove medium 
and were fixed for 1 hr at room temperature in fresh formaldehyde. After fixation the cultures 
were treated with 0.5% saponin solution for 3 min and rinsed again. Then the cultures were 
incubated at room temperature in medium containing 0.03 to 0.05 Mg/ml a-[^T]bungarotoxin 
for 90 min, rin.sed 30 min with large volumes of Hanks' balanced salt solution, and the bound 
radioactivity counted. Specific binding was defined as binding not blocked by preincubation 
of cultures for 15 min with 1.5 X 10~* M d-tubocurarine and inclusion of this concentration 
of d-tubocurarine in the medium containing a-[^T]bungarotoxin. Open circles represent 
averaged data from two to four experiments involving four to eight culture dishes for each 
point. Closed circles represent data from single experiments with four to eight culture dishes 
for each point. 



DEPARTMENT OF EMBRYOLOGY 16 

We found such a population of receptor also produced 50% inhibition. The kinet- 

sites in chick muscle cells fixed in fresh ics of a-[i^^I]bungarotoxin binding t^ the 

formaldehyde by a modification of the surface and to the saponin-revealed sites 

methods of Daniels and Vogel (Nature were indistinguishable. In each case the 

254, 339, 1975). These sites were una vail- binding curve approximated a first-order 

able for interaction with extracellular exponential with a half-time of 25 min- 

a-bungarotoxin for 24 hours prior to utes when 5 nM a-bungarotoxin was 

fixation. After fixation, the intracellular bound at 25°C. 

pool of newly synthesized receptors could Essentially all (>95%) of the binding 

be partly or completely exposed to a- sites revealed by saponin treatment were 

bungarotoxin by first treating the fixed intracellular, as determined by electron 

cells with (1) cycles of freezing and microscope autoradiography. Particularly 

thawing, or (2) Triton X-100 or sodium striking was the frequent occurrence of 

cholate, by brief extraction or (3) 0.5% silver grains directly over the Golgi ap- 

saponin, a lipophilic antimicrobial agent, paratus (Fig. 4). In cultured chick skele- 

Of these procedures, the saponin treat- tal muscle cells the Golgi apparatuses 

ment proved most useful because it mini- almost invariably sit adjacent to nuclei, 

mally altered the ultrastructure of the In our autoradiographs of control cul- 

muscle cells and quantitatively revealed tures 17% of silver grains attributable 

the intracellular receptor pool within a to specific binding of labeled a-bungaro- 

few minutes. The specific receptor sites toxin were directly over easily identifi- 

revealed by saponin constituted about able Golgi. Another 23% of such silver 

15-20% of all the sites. When the cul- grains were located over membranous 

tured chick muscle cells were treated with elements in the cytoplasm adjacent to a 

puromycin and subsequently fixed, the nucleus, but they could not unequivocably 

number of specific intracellular receptor be identified as Golgi membranes. The 

sites revealed by saponin treatment was remaining 60% of the silver grains asso- 

decreased as expected (Fig. 3) . The kinet- ciated with specific binding occurred pre- 

ics of decrease are very similar to those dominantly over membranous cytoplas- 

obtained when the intracellular sites were mic structures that could not readily be 

measured in detergent extracts obtained identified. There is very little rough 

from living cells. endoplasmic reticulum in these cells, and 

The number of acetylcholine receptors silver grains over rough endoplasmic 

in these experiments was considered to be reticulum have not been seen so far in 

the number of specific binding sites for this study. 

^^^I-labeled a-bungarotoxin. Specific bind- If the specific a-bungarotoxin binding 
ing sites were defined as sites that could sites associated with the Golgi apparatus 
be completely protected from a-bungaro- represented a portion of the pool of intra- 
toxin binding by 10~^ M d-tubocurarine. cellular receptors that were in the path- 
The inhibition of a- [^^^I] bungarotoxin way of membrane biogenesis, then there 
binding on the specific sites was studied should be fewer of those sites when pro- 
as a function of d-tubocurarine concen- tein synthesis is inhibited while recently 
tration and acetylcholine concentration, synthesized receptors are being incor- 
Inhibition curves were similar for the porated into the plasma membrane. In 
surface sites and the saponin-revealed fact, the time course of loss of receptor 
sites, a- [^2^1] Bungarotoxin binding was sites from the Golgi should reflect the 
inhibited 50% by about 3-5 X 10""^ M chronological position of the Golgi in the 
d-tubocurarine, which is similar to the pathway by which receptors proceed 
concentration needed to inhibit 50% of from their sites of synthesis to their in- 
the binding with living cells. A concen- sertion points in the plasma membrane, 
tration of 1-4 X 10~^ M acetylcholine We scored the location of silver grains 



16 



CARNEGIE INSTITUTION 




Fig. 4. Electron microscope autoradiographs illustrating the association of ACh receptors with 
the Golgi apparatus, as revealed by the binding of a-[^""'I]bungarotoxin to fixed, saponin- 
treated chick skeletal muscle cells. 



in autoradiographs of cells fixed at differ- 
ent times after inhibition of protein syn- 
thesis by puromycin. Figure 5 shows that 
the specific association of receptors with 
the Golgi begins to decrease soon after 
the inhibition of protein synthesis and 
is no longer evident 2-3 hours later. Thus 



newly synthesized acetylcholine receptors 
are located in the Golgi apparatus for 
about half of their intracellular residence 
time, mostly during the first half. 

Further studies along the lines de- 
scribed here should (1) establish more 
precisely the time course of association 



DEPARTMENT OF EMBRYOLOGY 



17 




Time 



2 
(hrs) 



in 



3 4 

Puromycin 



Fig. 5. Fraction of nowly F-ynthcsizod ACh 
receptors in tl'ie Golgi apparatus after inhibition 
of protein synthesis by puromycin. Experiments 
were performed as described in the legend to 
Fig. 3, except that after the operations de- 
scribed there, the cultures were fixed overnight 
in 2% glutaraldehyde and then osmicated, 
stained with aqueous uranyl acetate, and de- 
hydrated and embedded in Epon plastic. 1000 
A sections were cut and processed for electron 
microscope autoradiography. All the silver 
grains over many cells were counted and the 
underlying structures classified. Silver graim? 
were scored as related to the Golgi apparatus 
only if they were directly over membranes of 
the Golgi and did not overlie any portion of 
nucleus or nuclear membrane. In the absence of 
puromycin, 8.5% of the silver grains were over 
the Golgi and for cultures 5 hr in puromycin 
about 2% of silver grains were so located. In 
these experiments the intracellular pool of 
newly synthesized receptors represented about 
25% of the silver grains in the absence of puro- 
mycin. It was assumed (based upon much pre- 
vious data, including that of Fig. 3) that in the 
presence of puromycin the intracellular pool of 
newly synthesized ACh receptors declined 
linearly to zero over a period of 3.5 hr. The 
fraction of total silver grains over Golgi minus 
0.02 was divided by the fraction of silver grains 
representing the new receptor pool to obtain 
the points plotted here. This representation 
probably depicts the time course of loss of 
receptors from the Golgi fairly accurately, but 
it certainly underestimates the fraction of re- 
ceptors associated with the Golgi. This is be- 
cause silver grains not directly overlying Golgi 
are not included, and silver grains overlying 
perinuclear membranes which could not be 
unequivocally identified as Golgi were likewise 
excluded. 



of newly synthesized ACh receptors with 
the Golgi, (2) locate the receptor sites 
more precisely in certain elements of the 
Golgi and establish the polarity of the 
receptor molecules with respect to intra- 
cellular membrane systems, (3) explore 
the possible association of new receptor 
sites with rough endoplasmic reticulum, 
and (4) help to determine the sites of 
action of various inhibitors of ACh re- 
ceptor biogenesis (such as X537A, tunica- 
mycin, 2,4-dinitrophenol, 2-deoxyglucose, 
and D-glucosamine) . 



Regulation of Acetylcholine Receptor 
Metabolism by Electrical Stimulation 

D.J. Card 

Acetylcholine receptor metabolism in 
cultured myotubes and denervated adult 
muscle can be regulated by the amount 
of contractile activity of the muscle cell. 
If muscle contractions are abolished by 
the application of tetrodotoxin or lido- 
caine or by denervation, the number of 
extrajunctional acetylcholine receptors in 
the surface membrane increases. Contrac- 



18 CARNEGIE INSTITUTION 

tions elicited by decreased extracellular tion but an acceleration of the degrada- 

potassium (in mouse myotubes), by di- tion rate by a factor of more than 20. 

rect electrical stimulation or by reinner- Alternatively, electrical stimulation could 

ration of a muscle cause a dramatic cause a decrease in the number of recep- 

decrease in the number of extrajunctional tors by affecting both incorporation and 

receptors. Most previous studies have degradation rates simultaneously. 

measured acetylcholine sensitivity or the 

total number of acetvlcholine receptors t-. ■, .- 

, , r ' ^T^ • X i 1 Degradation 
on the muscle surface. \\ e are mterested 

in which aspects? of acetylcholine receptor The degradation rate of extrajunc- 

metabolism (synthesis and incorporation tional acetylcholine receptors can be in- 

into the plasma membrane, the subse- f erred from measurements of the rate at 

quent internalization of the receptors, or which ^^^I-labeled a-bungarotoxin bound 

their ultimate degradation) are most to these receptors is degraded. Concom- 

affected by muscle activity. Therefore, itantly, radiolabeled degradation prod- 

we have modified techniques already in ucts are released from the muscle fibers. 

use in this laboratory in order to study Degradation rate in adult denervated 

the effects of electrical stimulation on muscles in organ culture was measured 

denervated adult tissue. Reports on the as follows. First, the muscle was exposed 

effect of stimulation in primary tissue to a saturating dose of a-[^^^I]bungaro- 

culture and preliminary data on dener- toxin. Then the residual unbound toxin 

vated adult muscle were presented last was rinsed away. The muscle was tied 

year. with 5-0 silk around its tendons onto 

Following denervation, the num^ber of posts in a Plexiglas chamber containing 

acetylcholine receptors in adult muscle Trowell medium and 0.1% bovine serum 

increases, and the acetylcholine sensi- albumin. In the stimulation experiments 

tivity in rat soleus muscle rises to a muscles were positioned over platinum 

plateau level of about 250 mV/nC. Elec- wire electrodes with one end of the muscle 

trical stimulation (given at 100 Hz for affixed to a Grass force transducer in 

1 second, every 100 seconds) causes a order to monitor muscle tension. Contrac- 

fall in acetylcholine sensitivity to the tile tension in all muscles was noted at 

upper limits of normal (about 1 mV/nC) the beginning and end of the incubation 

in 4 days (Lomo and Westgaard, J. period. The muscles were incubated in 

Physiol ^252, 603, 1975). These changes a humidified 95% O2, 5% CO2 atmos- 

in acetylcholine sensitivity are compara- phere at 37°C. At regular intervals dur- 

ble to a change in receptor number from ing incubation the Trowell medium sur- 

100 receptors per unit area to 3 receptors rounding the muscle was removed and 

per unit area in 100 hours. saved for analysis, and fresh warm 

The total number of acetylcholine re- medium was replaced in the chamber, 

ceptors on the surface membrane at any The degradation medium was analyzed 

time is the result of a balance of the for total amount of radioactivity and for 

synthesis-incorporation rate and the the amount of radioactive label associ- 

degradation or removal rate. Therefore ated with specific molecules, namely 

the dramatic decrease in the number of ^^^I-tyrosine. As a result of acetylcholine 

surface receptors within 100 hours with receptor degradation, ^^^I-tyrosine ac- 

100-Hz electrical stimulation could be cumulates in the culture medium. The 

the result of (1) a complete inhibition rate of appearance of ^^^I-tyrosine paral- 

of the production of new acetylcholine lels the loss of radioactivity from the 

receptors, with no change in degradation muscle surface (Fig. 6). 

rate, or (2) at the other extreme, no Degradation rate for the rat extensor 

change in receptor synthesis-incorpora- digitorum longus (a fast-twitch muscle 



DEPARTMENT OF EMBRYOLOGY 



19 




20 30 

Hours 



with suprathre.sholr] stimuli. The succes- 
sive stimuli in each train were of alter- 
nate polarity to minimize the possibility 
of polarization of the stimulating elec- 
trodes. There was little change in degra- 
dation rate as a result of stimulation. In 
some cases there was a slight reduction 
in degradation rate, e.g., the half-life for 
receptor degradation in EDL muscle in- 
creased from 22 to 23 hours. 

Thus the same pattern of electrical 
stimulation which has been shown to 
promote rapid decline in extrajunctional 
acetylcholine chemosensitivity in vivo 
results in a small increase in receptor 
half-life measured in vitro. Since acetyl- 
choline receptors decrease during electri- 
cal stimulation (Lomo and Westgaard, 
1975) without any acceleration of degra- 
dation (Hogan, Marshall, and Hall, 
Nature 261, 328, 1976; Shainberg and 
Burnstein, Nature 264, 368, 1976), it fol- 
lows that electrical stimulation must 
cause a very large decrease in either the 
biosynthesis of new receptors or their rate 
of incorporation into plasma membranes. 



Fig. 6. Degradation of a-[^^^I]bungarotoxin- 
receptor complexes in 8-day denervated rat 
extensor digitorum longus muscle. The fraction 
of radiolabeled receptors remaining on the 
muscle is plotted at different incubation times. 
The half-life is approximately 20 hr. 



relying predominantly on anaerobic 
metabolism) was 2.3% per hour, a half- 
life in the membrane of approximately 
22 hours. Acetylcholine receptors in rat 
soleus (a slow-twitch muscle with pri- 
marily oxidative metabolism) were de- 
graded at 2.7% per hour, a half-life of 
18 hours. Degradation rate in these mus- 
cles was independent of length of dener- 
vation (from 5 to 11 days). Degradation 
rate was decreased by reducing the tem- 
perature to 25°C and adding cyclohexi- 
mide to the culture medium. 

To measure the effect of electrical 
stimulation on degradation rate, the 
muscles were stimulated for 5-12 hours 
at 100 Hz for 1 second every 80 seconds 



Incorporation 

Incorporation of acetylcholine recep- 
tors into muscle plasma membranes was 
measured by the appearance of new oc- 
bungarotoxin binding sites at various 
times after the existing receptors were 
blocked with unlabeled a-bungarotoxin. 
The experimental protocol was as follows. 
Five-day denervated rat muscles were 
put in Plexiglas chambers. The muscles 
were tied in place at in situ resting length 
and barely covered with Trowell medium, 
0.1% bovine serum albumin, 5 X 10~^ 
g/ml gentamicin, 2 X 10~^ g/ml fungi- 
zone, 200 units/ml penicillin, 5 X 10~^ 
g/ml streptomycin. The muscles were 
segregated into four experimental groups 
to determine the total number of: (1) 
acetylcholine receptors, (2) receptors 
available for a- [^^^I] bungarotoxin bind- 
ing immediately after saturation of the 
surface receptors with unlabeled a-bunga- 
rotoxin, (3) receptors incorporated into 



20 



CARNEGIE INSTITUTION 



the plasma membrane during incubation 
after treatment with unh\beled a-bunga- 
rotoxin. and (4) receptors incorporated 
during electrical stimulation at 100 Hz 
for 1 second every SO seconds. 

The muscles were incubated for various 
lengths of time in normal Trowell me- 
dium. Then unlabeled a-bungarotoxin 
(1.68 fig ml) was added to some of the 
muscles (groups 3 and 4) in order to 
saturate the receptors. Residual a-bunga- 
rotoxin was rinsed away, and the muscles 
were incubated for various times to await 
the appearance of new receptors. The 
number of receptors on all muscles was 
determined by placing the muscles in a 
solution of a-[^-^I]bungarotoxin at the 
end of the experiment. Unbound toxin 
was rinsed away. Then the muscles were 
homogenized and the toxin-receptor com- 
plexes extracted from a membrane pellet 
(10.000^ for 30 min) with 2.57c cholate, 
10 mM tris. The number of a-bungaro- 
toxin-receptor complexes per milligram 
of muscle tissue was determined from the 
amount of radioactive material moving 
as a lOS peak by velocity sedimentation 
in a 5-ml 5-20% sucrose gradient. 

Experiments were also carried out 
where ^H. ^^C, ^^N-labeled amino acids 
were substituted for ^H, ^^C, ^^N amino 
acids in the Trowell medium. In these 
experiments, if the receptors that appear 
on the muscle surface are indeed the re- 
sult of de novo synthesis, they will be 
composed of the 2H, i^C, i5;N-labeled 
components. Therefore, the new receptors 
will exhibit a density shift that can be 
detected by velocity sedimentation. The 
protocol in these experiments was similar 
to the former incorporation measure- 
ments. The muscles were put into three 
experimental groups. The first group was 
used to study the incorporation of new 
receptors. Existing receptors were blocked 
with unlabeled a-bungarotoxin, and the 
emergence of newly synthesized ''heavy" 
receptors was measured. In the second 
group, the existing receptors were blocked 
with unlabeled a-bungarotoxin and the 
incorporation of new ''heavy" receptors 



was determined during electrical stimula- 
tion of the muscle at 100 Hz for 1 second 
every 80 seconds. IMuscles of these two 
experimental groups were placed in me- 
dium containing -H, ^^"^C, ^^N amino acids 
while the surface acetylcholine receptors 
were blocked by unlabeled a-bungaro- 
toxin, so that any precursor receptor 
molecules would be made from the 
"heavy" amino acids. Then after the un- 
bound a-bungarotoxin was rinsed away, 
the muscles were again placed in the ^H, 
^^C, ^^N-labeled medium for various 
lengths of time. The third group was used 
to determine the total number of recep- 
tors on muscles not treated with un- 
labeled a-bungarotoxin. Muscles of this 
group were cultured in medium contain- 
ing ^H, ^^C, ^"^N amino acids, and the 
number of receptors was determined at 
the end of the incubation period. The 
third group of muscles is very important, 
since all incorporation data are expressed 
as percent of total number of receptors. 
The number of receptors on muscles of 
all groups was determined by saturating 
them with a-[^^^I]bungarotoxin at the 
end of the experiment. Toxin-receptor 
complexes were isolated as previously de- 
scribed. The amount of toxin-receptor 
complexes was determined from the 
amount of radioactive material in the 
toxin-receptor peak after velocity sedi- 
mentation in sucrose-deuterium oxide 
gradients. 

In order to provide a standard of nor- 
mal toxin, ^H, ^^C, ^*N-labeled receptor 
complexes in each centrifuge tube, toxin- 
receptor complexes were prepared from a 
fourth group of denervated muscles, 
freshly dissected and then saturated with 
a- [^"^^I] bungarotoxin in medium contain- 
ing ^H, ^^C, ^^N-labeled amino acids. 
After the toxin-receptor complexes were 
extracted, a portion of the a-[^^^I]- 
bungarotoxin-receptor complexes was 
added to each sucrose gradient tube, in 
addition to a portion of extract from an 
experimental muscle. Using the a- [^^^I] - 
bungarotoxin ^H, ^^C, ^*N-receptor com- 
plex peak of the sucrose gradient as a 



DEPARTMENT OF EMBRYOLOGY 



21 



template, the proportions of a-[^^^I]- 
bungarotoxin ^H, ^-"^C, ^^N-receptor com- 
plexes and a-[i2^I]bungarotoxin ^H, 
i2Q^ i4;fy^_j.g(>gp^Qj. complexes on each 

gradient were estimated (Fig. 7). Theo- 
retical superposition of ''heavy" and 
''light" toxin-receptor complex peaks of 
different proportions was carried out with 
the aid of a DEC PDP-8 computer. The 
best fit was obtained by visual inspection. 
Both techniques of measuring incorpora- 
tion rate of receptors into extra junctional 
membranes gave similar results. 

We discovered that the amount of 



3000- 



2000- 







1000- 



10 20 30 

Fraction number 



40 



Fig. 7. A typical sucrose deuterium oxide 
gradient of toxin-receptor complexes from 5- 
day denervated extensor digitorum longus 
muscle that was stimulated in vitro for 36 hr. 
Receptors were allowed to incorporate for 9^/2 
hr in ^H, ^^C, ^^N-labeled medium. Incorpora- 
tion rate was 1.1% per hour. Toxin-receptor 
complexes extracted from muscle incubated in 
'H, ""C, "N-labeled medium (treated with a- 

[^^I]bungarotoxin) are less dense ( ) than 

42% of the toxin receptor complexes incubated 
in 'B, "C, ^^N-labeled medium (a-[^^^]bunga- 

rotoxin) ( ). The proportion of a-[^T] 

bungarotoxin ^H, "C, ^^N-receptor complexes 
was estimated as described in the text. 



vigorous muscle contraction was very 
important in producing any changes in 
acetylcholine receptor metabolism. There- 
fore, during the stimulation period the 
voltage of the stimulator was adjusted 
so that it was twice that needed to elicit 
a muscle twitch. This voltage was usually 
increased during the experiment in order 
to maintain the level of muscle contrac- 
tion. Between 12 and 26 hours of stimula- 
tion at 100 Hz every 80 seconds, the 
incorporation rate of stimulated muscles 
decreased to 30% of the incorporation 
rate in unstimulated control muscles. A 
similar decrease occurred in muscles stim- 
ulated for 42 and 69 hours with the same 
pattern of 100-Hz stimuli. We are now 
investigating stimulation times between 
12 and 26 hours more closely to deter- 
mine the kinetics of decline in rate of 
receptor incorporation. 

Other incorporation data indicate that 
muscles stimulated at levels that elicit a 
visible twitch but not a maximal con- 
traction, at 100 Hz intermittently for up 
to five days in vitro incorporated acetyl- 
choline receptors into their membranes 
at a rate that was not significantly differ- 
ent from muscles stimulated only 4 hours 
(see Fig. 8). The slope of the least- 
squares fit indicates a very slow^ decrease 
in receptor incorporation rate over 120 
hours in culture. This is true for dener- 
vated rat extensor digitorum longus as 
well as denervated soleus muscles. 

The only difference between these and 
the previous incorporation experiments 
is the amount of voltage applied across 
the muscle. The muscle must be contract- 
ing vigorously in order to induce changes 
in acetylcholine receptor numbers. Thus 
it is apparent that the number of supra- 
threshold-activated muscle fibers is very 
important in the regulation of acetyl- 
choline receptors. Subthreshold activa- 
tion is not adequate to produce changes 
in receptor metabolism. 

Our results suggest that suprathreshold 
activation of denervated muscle by inter- 
mittent 100-Hz electrical stimulation 
leads to a dramatic decrease in acetyl- 



22 



CARNEGIE INSTITUTION 






0) 



3 

E 

CO 



1.8 




I 1 




I 


• 
o 


1111 

EDL muscles in 'h.'^C.'^N medium 

EDL muscles in^H.'^C.'^N medium 


14 


- 


• • 






X 


Soleus muscles in ^H.'^.'^N medium' 


1.0 


- 


• 


X 


: 




o - 




f- § 


: ° 

o 


0.6 




- 


2 




1 1 




1 


1 


1 1 1 1 



10 



20 30 40 50 60 70 

Duration of stimulation (hrs.) 



80 



90 



100 



Fig. S. Comparison of incorporation rates in stimulated and control muscles after different 
durations of stimulation (incorporation rate in stimulated muscle divided by incorporation 
rate in control muscle). Linear regression analysis reveals that even after a short time, the 
stimulated muscle has a shghtly smaller incorporation rate than the control muscle, perhaps 
because of the stress of stimulation. 



choline receptor incorporation rate be- 
tween 12 and 26 hours of stimulation. A 
closer examination of the onset of the 
stimulation-induced decrease in receptor 
synthesis will undoubtedly tell us more 
about the precise control point (s) in- 
volved in regulation of acetylcholine 
receptor metabolism. 

Degr.\datiox of Acetylcholine 
Receptors 

John M. Gardner 

Earlier measurements of ACh receptor 
turnover were based on the time-depend- 
ent degradation of mono-iodo-a-[^^^I]- 
bungarotoxin bound to ACh receptors. It 
was reasoned that the toxin-receptor in- 
teraction was so strong that the complex 
wouhl be degraded as a unit by the cells, 
anrl a variety of tests indicated that the 
binding of a-bungarotoxin did not greatly 
alter the rate of receptor turnover. How- 
ever, it still seemed desirable to obtain 
a direct measure of the rate of receptor 
turnover. This was accomplished, using 
the density shift technique described 
above anrj in previous publications (Year 
Book 74, Year Book 75). 

A variety of strategies based on the 



density shift technique were employed 
in this study. In this report we have 
assigned a short descriptive name for 
each experimental design and have illus- 
trated the designs in Fig. 9. Some addi- 
tional details of experimental procedure 
are given in the figure legend. 

The first two kinds of experiments were 
performed to determine whether cells 
grown in the presence of ^H, ^^C, ^^N 
amino acids turned over ACh receptors 
at the same rate as cells grown in normal 
medium and whether receptors labeled 
with the dense amino acids turned over 
at the same rate as those synthesized 
from normal light amino acids. The 
''density-shift^toxin-dcgradation" experi- 
ment is shown in Fig. 9A, and the '^den- 
sity-washoutr-toxin-degradation" experi- 
ment in Fig. 9B. In the former case, 
myogenic cells were plated in normal 
medium and allowed to differentiate and 
synthesize a set of normal ACh receptors. 
These receptors were labeled with «- 
[^^•''Ilbungarotoxin, and the cultures 
switched to medium containing dense 
amino acids. In the latter case myogenic 
cells were plated and grown in medium 
containing dense amino acids so that all 
their ACh receptors were density-shifted. 
These receptors were labeled with «- 



DEPARTMENT OF EMBRYOLOGY 



23 



FVe-experimental 



Experimental 



fwm 




Fig. 9. Experimental strategies employed in 
ACh receptor turnover studies. (A) Density- 
shift-toxin-degradation; (B) density-washout- 
toxin-degradation; (C) density-shift; (D) 
density-washout; (E) pulse-chase; (F) two- 
population experiment. The solid bars indicate 
the time intervals during which cells were in 
normal medium containing ^H, ^^C, ^^N amino 
acids. The cross-hatched bars indicate the 
growth of cells in "dense" medium (containing 
^H, "C, ^N amino acids). The large soHd arrows 
represent the application of [^^T]mono-iodo-a- 
bungarotoxin to all the cultures in the experi- 
ment for just enough time to saturate the 
receptors on the cells; the unbound a-bungaro- 
toxin was then rinsed away and the cultures 
returned to the incubator. The small solid ar- 
rows indicate the time points at which small 
subsets of cultures were incubated with a-[^^T] 
bungarotoxin, rinsed and then the receptors 
were extracted and analyzed by velocity sedi- 
mentation. The small open arrows indicate the 
same procedure except that a-[^^I]bungarotoxin 
was used. 



[^2^1] bungarotoxin, and the cultures 
switched back to normal culture medium. 
In both cases the loss of radioactivity 
from the cells was monitored for at least 
48 hours. In the density-shift-toxin- 
degradation experiment (Fig. 9A) a- 
bungarotoxin-receptor complexes were 
extracted from the cultures at each time- 
point and analyzed by velocity sedimen- 
tation, using a a- [^^^I] bungarotoxin- 



light-receptor marker in each gradient. 
In all cases, 100% of the a-V'^n']\>\\r\^h- 
rotoxin-receptor complexes were 10»S, 
indicating that the labeled a-bungaro- 
toxin never dissociated from the light re- 
ceptors and rebound to heavy receptors. 
Similarly, the a-[^^^I]})ungarotoxin-re- 
ceptor complexes in the density-washoutr- 
toxin-degradation experiments (Fig. 9B) 
were 100% density-shifted throughout 
the experiment. The results of the two 
types of experiments are shown in Fig. 
10. In both cases the loss of a-[^^^I]- 
bungarotoxin-receptor complexes fol- 
lowed first-order kinetics with a half-time 
of 22-24 hours. These values are in good 
agreement with the established 22-hour 
half-time of toxin receptor complexes 
under normal culture conditions. Thus 
the turnover of acetylcholine receptors 
to which a-bungarotoxin is bound takes 
place at a rate not significantly influ- 
enced either by a culture medium con- 
taining ^H, ^^C, ^^N amino acids or by a 
high degree of substitution of these amino 
acids in the polypeptide chains of the 
ACh receptors. 

To measure the turnover rate of the 
native ACh receptors without bound «- 
bungarotoxin, experimental designs C and 
D (Fig. 9) were used. These are termed 
"density-shift" and ''density-washout" 
experiments, respectively. Chick muscle 
cultures were prepared using normal 
medium or medium with dense amino 
acids. When a large population of recep- 
tors was present in the cultures, the 
medium was switched from normal to 
dense or from dense to normal, and 
cultures were maintained in the new 
medium for the course of the experiment. 
At each time point the ACh receptors in 
a small subset of the cultures were labeled 
by brief exposure to a- [^^^I] bungaro- 
toxin, and the labeled receptors were 
solubilized in non-ionic detergent and 
analyzed for normal and density-shifted 
receptors by velocity sedimentation in 
sucrose gradients. The total number of 
normal receptors remaining on the cells 
switched to dense medium and the total 



24 



CARNEGIE INSTITUTION 



C3» 

c 



o 

E 
a> 
(T 

if) 

O 

Q. 

a> 
o 

0) 

cr 

JO 

o 



o 

c 

CD 



c 

O 



o 
o 




^H,'^C, '^N - Receptors 



0.1 



10 20 30 40 

Time ( hours ) 



50 



60 



70 



Fig. 10. Degradation of a-[^"T]bungarotoxin-receptor complexes; normal and dense recep- 
tors compared. (O-O) toxin-dense receptor complexes in normal medium; (A- A) toxin- 
normal receptor complexes in dense medium. 



number of den.sity-shifted receptors re- 
maining on the cells switched to normal 
medium were plotted as a function of 
time. These curves could readily be ap- 
proximated by first-order exponentials 
with half-decay times of 15-17 hours 
(Fig. 111. The time course for the dis- 
appearance of normal and of density- 
shifted receptors was the same. This 
was confirmed for rjonsity-shifted and 
normal receptors on the same set of mus- 
cle cultures by experimental design E 



(Fig. 9) , which is a hybrid of designs 
C and D. In this experiment the half- 
times for degradation of normal and of 
density-shifted receptors were both 17 
hours. 

The final experimental design (Fig. 
9F) was termed the ''two-population" 
experiment. In this experimental design, 
degrarlation rates of receptors with and 
without bound a-bungarotoxin were meas- 
ured on the same cells. This experiment 
is thus internally controlled, so a differ- 



DEPARTMENT OF EMBRYOLOGY 



25 



o» 



o 

£ 

<n 
o 

Q. 
<D 
O 
0) 

q: 
o 



c 
■>< 

o 

o 

o 
o» 

c 

CD 



o 
o 




^H,'^C, '^N -Receptors 



10 20 30 40 

Time ( hours ) 



50 



60 



70 



Fig. 11. Degradation of normal and density-shifted receptors without bound a-bungarotoxin. 
(O-O) dense receptors ; (A-A) normal receptors. 



ence in turnover rates cannot be ascribed 
to variations between experiments. Un- 
fortunately, this experimental design is 
the most difficult. The results suggest 
that when a-bungarotoxin is bound to 
ACh receptors, their degradation rate is 
somewhat slower than that of normal 
receptors. Myogenic cells were plated in 
normal medium and differentiated to pro- 
duce normal receptors. These receptors 
were labeled with ^-[^^^Ijbungarotoxin, 
and the cultures were returned to normal 
medium for 18 hours, during which time 



a new set of unlabeled, normal ACh 
receptors was synthesized. Then the cul- 
tures were switched to medium contain- 
ing dense amino acids. The disappearance 
of the normal receptors during culture in 
the dense medium was monitored by 
saturating the free receptors in small 
subsets of cultures at different times, 
using a- [^"^^I] bungarotoxin and then ana- 
lyzing the fraction of a-[^2^I]bungaro- 
toxin-receptor complexes and a-[^^^I]- 
bungarotoxin-light-receptor complexes 
after velocity sedimentation of the deter- 



26 



CARNEGIE INSTITUTION 



gent extracted receptors. The data from 
two experiments are plotted in Fig. 12. 
In both experiments the loss of free, 
normal ACh receptors from the cultures 
followed first-order kinetics with a half- 
decay time of 17-1 7.5 hours, Thea-[^^^I]- 
bungarotoxin-normal receptor complexes 
were lost at rates of 19 and 22 hours. 
Thus receptors to which a-bungarotoxin 
is bound are degraded a little more slowly 
than free receptors. 

There are many possible explanations 



for the effect of bound a-bungarotoxin 
on receptor turnover. For example, the 
a-bungarotoxin may (1) provide a slight 
protection from proteolytic attack by 
sterically hindering the access of pro- 
teases to some portions of the receptor, 
or (2) hold the receptor in a conformation 
more metabolically stable than other con- 
formations, or (3) block the spontaneous 
denaturation of receptor molecules that 
might contribute to the overall degrada- 
tion rate, or (4) change the frequency 



1.0 
0.9 

0.8 

0.7 

0.6- 
Q5- 



c 



o 0.4 

E 



I 0.3 

o 
o 



0.2- 



0.1 



\ 1 1 1 1 1 1 




-V 


- 


X\ 




"\ 






^ 


- \^ 




\. \^ "-Jl-o-Bungarotoxin - 


- 


V\ A ^ Complexes (A,A) 




W "^ ° 


- 


\ V \ 




V \ 




\^ \ 




\^ ■- 




\\ '^ 




\^ N 




\ \ \ 




\ \ "^ 




A\ - 


■" 


/ V\ A\ 




(•,o) 'H.'^C'^N-Receptors-^ a\^\ 




(free) \ '^ 




\«\ 




\ \ 




\ \ 




1 1 1 1 1 1 





10 20 30 40 

Time ( hours ) 



50 



60 



70 



Fig. 12. Degradation of normal receptors with (A, A) and without (•, O) bound a-bungaro- 
toxin in the pre.«ence of den.se medium : the two-population experiment. Data from two experi- 
ments are graphed; the solid symbols refer to one experiment, the open symbols to the other. 



DEPARTMENT OF EMBRYOLOGY 27 

with which receptors occur in areas of 37°C. We surmised that this difference 

membrane internalized by the cell for might be related to the "hidden sites" 

transport to lysosomes. being available for slow interaction with 

Two years ago we published the results «-bungarotoxin at high temperature but 

of studies which indicated that a-bunga- not at low temperature (Year Book 74). 

rotoxin did not have much effect on the Our new data on the degradation of 

rate of receptor degradation (Devreotes receptors with and without bound «- 

and Fambrough, J. Cell Biol. 65, 335, bungarotoxin provide a less mysterious 

1975). In those experiments we blocked explanation for much of the data related 

receptor biosynthesis and monitored the to ''hidden" receptors. To measure the 

degradation of a-bungarotoxin bound to slow binding of a-bungarotoxin to recep- 

the acetylcholine receptors or, in the tors of the ''hidden" class at 37°C, the 

absence of a-bungarotoxin, the disappear- experiment must be designed to take into 

ance of the receptors. We found then that account the fact that muscle continues 

the equivalent of 847 receptors per unit to incorporate new receptors all the time, 

area of cell surface were degraded each Therefore, we set up experiments to 

hour in the absence of a-bungarotoxin, measure the binding kinetics by adding 

and 810 per hour when it was present, labeled a-bungarotoxin to sets of cultures 

This kind of experiment was technically at different times and then simultane- 

difficult, and we concluded that the dif- ously washing the unbound toxin from 

ference in rates lay within experimental all cultures at the end of the experiments 

error and thus that any perturbation of and measuring the counts bound. It was 

receptor degradation by a-bungarotoxin assumed that at the end of the experi- 

must be small. As indicated above, our ment all cultures would contain the same 

density-shift experiments show that the total number of receptors. The new data 

rate of receptor degradation is slightly on receptor degradation demonstrate that 

diminished in the presence of bound a- this assumption is not valid. Since a- 

bungarotoxin. How, then, should this bungarotoxin stabilized receptors slightly 

measured effect of a-bungarotoxin mani- against degradation, the cultures treated 

fest itself in the indirect test? The answer for long times in media containing a- 

is that if the unperturbed degradation of bungarotoxin actually have extra recep- 

receptors destroyed 847 receptors per tors — those spared from degradation by 

unit area of cell surface per hour, then the bound toxin. This sparing of recep- 

the degradation of receptors with a- tors will have an effect on the total 

bungarotoxin bound to them should occur receptor number, which can be quantita- 

at a rate of 808 receptors per unit area tively predicted if one knows the rates of 

per hour. Thus there is no conflict be- receptor production and degradation dur- 

tween the density-shift data and the less ing the binding experiment. For example, 

precise older data with regard to the if the cultures have a steady-state level 

effect of a-bungarotoxin on receptor of receptors in the absence of a-bungaro- 

degradation. toxin, then adding a-bungarotoxin will 

Several different kinds of experiments result in an increase of about 15% in 

have suggested that some acetylcholine total receptor number over 24 hours. We 

receptors besides the newly synthesized have recently done several complicated 

ones are also not readily available for experiments to evaluate this point. These 

interaction with a-bungarotoxin in the experiments, which cannot be presented 

culture medium. We have termed such in detail here, confirm that a-bungaro- 

sites "hidden receptors." One interesting toxin stabilization of receptors against 

aspect of the interaction of a-bungaro- degradation can approximately account 

toxin with cultured muscle cells is that for the slowly saturable "hidden" sites 

fewer sites are labeled at 4°C than at we postulated earlier. There remains 



28 



CARNEGIE INSTITUTION 



another set of "hidden" receptors: those 
which cannot be hibeled by extracelhilar 
a-biingarotoxin and yet are not recently 
synthesized. This popuhition frequently 
represents about 10-1 5 <^r of the receptors 
in cultured chick skeletal muscle cells. 



Positional Stability of Acetylcholine 

Receptors at the Neuromuscular 

Junction 

D. M. Fambrough and R. E. Pagano 

A few years ago it was discovered that 
some membrane proteins are not fixed in 
their positions but can move about in the 
plane of the membrane, partly by means 
of Brownian motion. Lipid molecules 
have likewise been found to move. In- 
deed, the biological membranes are now 
considered to resemble liquid films more 
than rigid two-dimensional lattices. How- 
ever, certain functional molecules in the 
membrane remain confined to a limited 
area. The acetylcholine receptors at the 
neuromuscular junction seem to be among 
the molecules with limited '^translational 
mobility." During the past year we have 
begun to investigate the restriction placed 
by the muscle upon the mobility of ACh 
receptors at the neuromuscular junction, 
and the underlying mechanism of this 
restriction. We can report that the re- 
striction upon receptor movement is ex- 
treme. ACh receptors do not change their 
positions significantly in the plasma 
membrane over an 18-hour period at 
37 °C in the living tissue. 

The design of our experiments is simi- 
lar to that first used by Poo and Cone 
(Xature 247, 438, 1974) in studies of the 
mobility of rhodopsin in visual cell mem- 
branes and now being exploited in several 
laboratories, including that of Webb at 
Cornell. We prepared a fluorescent deriv- 
ative of a-bungarotoxin (the tetramethyl- 
rhodamine derivative in this case) and 
exposed a rat diaphragm muscle in organ 
culture to the toxin for 2 hours. Then the 
unbound toxin was rinsed away, and the 
muscle was mounted for observation with 



epi-illumination in the fluorescence mi- 
croscope. For illumination we used the 
568.1-nm line of a krypton-argon laser; 
the beam passed through the objective 
lens, a 40X water immersion lens, and 
down onto the specimen. With this illumi- 
nation, diminished 1000-fold by neutral 
density filters, we could locate the neuro- 
muscular junctions, which fluoresced 
brightly because of the fluorescent «- 
bungarotoxin bound to the acetylcholine 
receptors there. Neuromuscular junctions 
in the surface layer of muscle fibers were 
chosen for study and photographed. A 
pinhole was placed in the path of the 
laser beam so that only an area about 6 
^m in diameter was illuminated. The 
neutral density filters were removed from 
the light path for 3 minutes and the high 
intensity laser light allowed to photo- 
bleach the illuminated area. Then the 
neutral density filters were reinserted in 
the light path, the pinhole removed, and 
the junction rephotographed. The muscle 
was returned to the 37 °C incubator and 
maintained in culture for 18 hours. Finally 
the muscle was positioned on the micro- 
scope again, and the partially bleached 
neuromuscular junctions located and 
photographed (Fig. 13). If ACh receptors 
were free to move about in the junctional 
membrane, then during the 18-hour cul- 
ture period after partial bleaching the 
receptors should have become reposi- 
tioned and the fluorescence deficit created 
by the bleaching microbeam should have 
become distributed over the fluorescent 
area. This did not occur. The boundary 
of the bleached area remained as sharp 
as it had been initially, indicating lack 
of movement of receptors across this 
boundary. 

It is certain that the forces restricting 
receptor mobility do not include covalent 
bonds to receptor molecules, because the 
receptors can be solubilizcd from the 
junction })y non-ionic detergents. Some 
weaker bonding forces must be involved. 
There are agents that specifically affect 
certain types of weak molecular inter- 
actions, and there are agents that disrupt 



DEPARTMENT OF EMBRYOLOGY 



29 




Fig. 13. Fluorescence micrograph showing the postsynaptic membrane of a rat diaphragm 
neuromuscular junction after incubation of the muscle with tetra-methyl-rhodamine-a- 
bungarotoxin. Fluorescence is from labeled a-bungarotoxin boimd to ACh receptors. Small 
black and white squares ring a dark, disc-shaped area in which the fluorescence has been 
bleached by an intense laser beam. The bleaching was done 18 hr before this photograph was 
taken. In the interim the diaphragm was cultured in Trowell medium at 37 °C in a humidified 
incubator with 95% 02/5% CO2. Magnification bar represents 10 /u,m. 



particular cellular structures. We are 
using such agents to probe the nature of 
the forces restricting receptor movement. 

Studies on Chick Muscle 
Acetylcholinesterase 

R.Rotundo 

Acetylcholinesterase is the enzyme that 
catalyzses the hydrolysis of acetylcholine 
released at the neuromuscular junction 
and at other cholinergic synapses in the 
nervous system. Several forms of this 
enzyme have been described for each 
species examined (including the house 
fly, electric eel, rat, mouse, chicken, and 
ox) . These forms can be distinguished by 
their mobility during polyacrylamide gel 
electrophoresis and velocity sedimenta- 
tion in sucrose gradients. Studies on puri- 
fied acetylcholinesterase isolated from 
the electric organs of the eel (Electro- 
phorus) by Rieger and co-workers, indi- 
cate that the various molecular-weight 
forms of the enzyme are multimers with 
a common subunit structure. However, 



several forms of this glycolipoprotein 
have also been shown to be attached to a 
three-stranded collagen-like ^'tail." 

In both the rat and the chick, three 
molecular forms can be distinguished ac- 
cording to their sedimentation coefficients. 
These will be referred to as the high, 
intermediate, and low molecular weight 
forms of the enzyme. The high molecular 
weight form appears to be localized pri- 
marily at the neuromuscular junction, 
whereas the intermediate and low mo- 
lecular weight forms appear in all neural 
tissues (Hall, J. Neurobiology 4, 343, 
1973; Vignay et al, FEES Letters 69, 
277, 1976). Some evidence suggests that 
the intermediate form is localized in or 
on the external cell membrane. Another 
aspect of acetylcholinesterase in muscle 
is its apparent trans-synaptic regulation 
by the incoming nerve. The high molecu- 
lar weight form disappears following 
denervation, which makes this enzyme 
useful as a tool to study mechanisms of 
neuron-target cell interactions. 

What we now have is an enzyme mole- 
cule that is easily quantified by sensitive 



30 



CARNEGIE INSTITUTION 



radiometric assays and is associated, at 
least in part, with the muscle cell mem- 
brane. It exist:? in several easily distin- 
guishable forms which could be corre- 
lated with subcellular localization and 
which appear to be under neuronal regu- 
lation. We are investigating the proper- 
ties and behavior of acetylcholinesterase, 
both in vitro and in vivo, to gain a better 
understanding of neuronal regulation of 
protein synthesis and gene expression in 
target cells. Furthermore, the study of 
the biosynthesis, release, and degradation 
of acetylcholinesterase will yield infor- 
mation about the metabolism of a second 
membrane protein, and that information 
can be compared with data on the me- 
tabolism of the acetylcholine receptor. 

Properties of Chick Muscle 
Acetylcholinesterase 

Acetylcholinesterase extracts were pre- 
pared by homogenizing and then cen- 



trifuging 19-day-old chick embryo leg 
muscle in a phosphate buffer containing 
Triton X-100, NaCl 0.15 M and EDTA. 
A fraction of the supernatant was lay- 
ered on a 5-20% sucrose gradient and 
centrifuged for 17 hours at 38,000 rpm, 
using an SW41 rotor. The results of this 
procedure are illustrated in Fig. 14. The 
fractions labeled I, II, and III comprise 
the heavy, intermediate, and light forms 
of the enzyme, respectively. The frac- 
tions labeled IV do not appear to be 
acetylcholinesterase. That each of these 
peaks is a distinct form of the enzyme 
rather than an artifact of the preparatory 
procedure can be demonstrated by dia- 
lyzing each of the pools and running 
them on separate 5-20% sucrose gradi- 
ents. Figure 15 illustrates the results of 
such an experiment using the molecular 
forms of the enzyme which had been 
frozen for 25 days following initial sepa- 
ration by velocity sedimentation. The 
forms of the esterase obtained by this 




20 30 40 

Fraction number 



50 



60 



Fig. 14. Molecular forms of chick muscle acetylcholinesterase. An extract of 19-day-old 
rhick embrv'o leg muscle was prepared as described in text. A 500-^1 aliquot was layered on 
a 5-207^ sucro.se gradient and centrifuged for 17 hr at 38,000 rpm in an SW41 rotor. Fraction 
I is at the bottom of the gradient. 



DEPARTMENT OF EMBRYOLOGY 



31 



< 

LjJ 



< 




20 30 10 

Fraction number 



30 



Fig. 15. Molecular forms of chick muscle after 
AChE isolation. The peak fractions illustrated 
in Fig. 14 were pooled and stored frozen for 1 
month. The fractions were then dialyzed against 
homogenization buffer with Triton X-100 and 
200-/u,l aliquots centrifuged on 5-20% sucrose 
gradients. During storage and preparation all 
four forms retain their sedimentation charac- 
teristics. 



method have been partially characterized 
and the results summarized in Table 1. 
Although all four forms exhibit the same 
apparent Km for acetylcholine, only the 
first three appear to be true cholinesterase 
or acetylcholinesterase, which is distin- 
guished from butyrylcholinesterase by 



its ability to be inhibited by BW284c51, 
a specific AChE inhibitor, at 10— "^ M. 
Additional studies have indicated that 
form I, the high molecular weight form, 
is preferentially solubilized from tissue 
by high salt concentrations (1 M NaClj. 
Forms II and III, the intermediate and 
low molecular weight forms, are prefer- 
entially extracted with solutions contain- 
ing Triton X-100, although large amounts 
can be obtained by homogenizing in buf- 
fer alone. Studies using concanavalin A, 
a plant agglutinin binding specifically to 
a-mannoside residues, indicate that both 
the intermediate and low molecular 
weight forms are glycoproteins. Prelimi- 
nary evidence suggests that the high 
molecular weight form is also a glyco- 
protein, but a conclusive study is lacking 
because of the instability of this form 
under the conditions used to precipitate 
AChE with concanavalin A. 

In cultures of chick embryo muscle 
cells, the high molecular weight form of 
AChE is lacking, for there are no neurons 
(and thus no neuromuscular connections) 
in this preparation (Fig. 16). During 
early development in culture only the in- 
termediate and low molecular weight 
forms are present; but with increasing 
time in culture, small amounts of form 
IV become apparent. Since it is important 
for us to understand precisely the rela- 
tionships between the various forms of 
the enzyme in order to study their bio- 
synthesis and degradation, we are ex- 
ploring several methods of affinity chro- 
matography that will enable us to obtain 



TABLE 1. Properties of Acetylcholinesterase Molecular Forms 



AChE Form 



Km (mM) 



% Inhibition 
by 10-' M BW284c51 



Con-A Precipitable 



I 

n 
III 

IV 



0.61 
0.60 
0.52 
0.64 



53 
51 
52 
13 



N/A 

Yes 

Yea 

N/A 



The AChE forms are numbered according to their order of appearance in Fig. 1 : form I 
exhibits the highest sedimentation coefficient. The partially purified forms of AChE illustrated 
in Fig. 2 were used for the kinetic studies, and the Km values were calculated by regression 
analysis of the Lineweaver-Burke plots. 



32 



CARNEGIE INSTITUTION 



rO 








1 


14 


- 




g 








X 


12 


- 




E 






A 


o 


10 


- 


M 


>% 






/ 1 


♦- 


B 


- 


i 1 


> 






[ 1 


.,_ 






1 T 


u 


e; 


- 


/ 1 


< 






1 \ 


UJ 


/) 




1 \ 


x: 






• 1 


U 






/ T 


< 




» 


_ / \ 




■^ 




I [^■^•••i*^ I 



20 30 

Fraction number 



40 



Fig. 16. Velocity sedimentation of AChE 
from chick embryo muscle cultures. Eleven-day 
embryo leg muscle cells were cultured for 3 
days and then washed and extracted as de- 
scribed for whole muscle. Aliquots of 200 lA 
were centrifuged on 5-209f sucrose gradients as 
in Fig. 14. The molecular forms of AChE illus- 
trated here have sedimentation coefficients 
identical to the forms labeled II and III in 
Fig. 15. Note the absence of forms I and IV in 
this preparation. 



the enzyme in pure form for further 
characterization. 



Cell Surface versus Internal AChE 

We are attempting to elucidate the 
subcellular distribution of acetylcho- 
linesterase molecules in cultured chick 
embryo muscle cells and to examine both 



the relationships between the various 
molecular forms of the enzyme and their 
metabolic fates. A simple assay system 
was devised to test for the presence of 
AChE on the external plasma membranes 
of cultured muscle cells and to determine 
the ratio of extracellular to intracellular 
AChE. i^C-acetylcholine in a buffered 
salt solution is added to muscle cultures 
that have been washed to remove all 
traces of medium esterases. The distribu- 
tion of ^*C-acetylcholine in the assay sys- 
tem (Table 2) indicates that the labeled 
substrate does not penetrate the cells. 
Thus any hydrolysis of ^'^C-acetylcholine 
to ^^C-acetate must occur by AChE out- 
side the cells. The distribution of ^^C- 
acetate shows that most of the labeled 
product also remains in the medium. By 
removing and counting the ^^C-acetate 
produced by the hydrolysis of ^*C-acetyl- 
choline in the medium over a given time 
interval, a measure of AChE activity is 
obtained. After an initial incubation 
period to measure AChE on the cell sur- 
face, enough Triton X-100 can be added 
to make a 1% -detergent medium. This 
procedure solubilizes the cell membranes 
and renders the labeled substrate accessi- 
ble to all the AChE in the cell. After 
Triton X-100 treatment, a second meas- 
urement of AChE activity gives the total 
enzyme content of the cells. Using this 
double incubation procedure, we have 
been able to measure AChE activity both 
on the cell surface and within the muscle 



TABLE 2. Distribution of "C-Acetylcholine and "C-Acetate on Cultured Muscle Cells 



"C-ACh 



^*C-Acetate 





CPM 


% Total 


CPM 


% Total 


Total CPM 


Assay medium 
Cultured cells 

Total 


663360 
30 

663390 


100 



99150 
2800 

101950 


97.3 
2.7 


762510 
2830 

765340 


Total CPM recovered 


765340 


= 99.7% 









Total CPM added 767760 

Cultures were as.sayed for surface AChE as described in the text. After incubation the 
medium was removed and the cells extracted in Triton X-100 buffer solution. The "C-acetyl- 
choline was separated from the ^*C-acetate by sodium tetraphenylboron (Kalignost) in 3- 
heptanone. Each value is the mean of three determinations. 



DEPARTMENT OF EMBRYOLOGY 



33 



a> 

O 
> 



> 
o 

< 

UJ 

JZ 

o 

< 



200 


- 


. 




160 


- 


/ 






- 


i ^^ 


- "^ 


120 


- 


I ^^^ D -- 






J^-^ 




80 


- 


y 




40 


Cy^ 








/^ 1 


i+TX-lOO or removal 

of medium 
1 1 1 1 


1 



20 



40 60 80 100 

Time ( minutes ) 



120 



Fig. 17. Cell surface AChE assay. All values have been normalized to "C-ACh CPM hydro- 
lyzed per hour. (O-O) Cultures were incubated for 1 hr at 37 °C, at which time the medium 
was made 1% with respect to Triton X-100 and incubated for another 15 minutes. (A-- A) 
Cultures were incubated for 1 hr at 37 °C and then removed from the medium, which was 
then incubated for an additional 45 min in the absence of cells to demonstrate the presence 

of AChE released into solution during the assay. (D D) Cultures were incubated at 5°C 

for 1 hr and then removed from the medium, as described for the preceding experiment. Post- 
incubation of the medium at 5°C shows that no AChE was released into the medium under 
these conditions. Each point is the mean of three cultures. 



cells. An example of this kind of experi- 
ment is illustrated in Fig. 17. Such 
studies indicate that approximately 20% 
of the AChE is localized on the external 
cell membrane. As will be discussed in a 
subsequent section, however, AChE is 
also released into the medium when mus- 
cle cells are incubated at 37°C. To cir- 
cumvent this difficulty, we assayed for 
cell-surface AChE activity by incubat- 
ing at 5°C and then removing the medium 
from contact with the cells and con- 
tinuing the incubation. Figure 17 illus- 
trates one such experiment, which shows 
that at this temperature there is no 
release of AChE from the cells. When 
muscle cells are incubated for 1 hour at 
20°C, they release approximately 10% 
as much AChE as is found on the mem- 
brane. 

Table 3 illustrates the effects of tem- 
perature and specific inhibitors on the 
rate of acetylcholine hydrolysis by cell- 



surface AChE. At 37°C both cell-surface 
AChE and newly released AChE contrib- 
ute to the measured rate of acetylcholine 
hydrolysis, whereas at 20°C the contribu- 
tion of the new AChE is 90% that of the 
cell-surface enzyme. The lack of inhibi- 

TABLE 3. Effects of Temperature and Specific 
Inhibitors on Cell Surface AChE Activitv 



Treatment Temp. °C 



AChE activitv 

(% 37° Control) 



None 


37 


100 


None 


20 


50 


10-* M IsoOMPA 


37 


98 


10"" M BW284c51 


37 


20 



Chick embryo muscle cultures were incubated 
for 2 hours as described in text. BW284c51 at 
lO"'' M is a specific inhibitor for acetylcholin- 
esterase; IsoOMPA at 10"* M is an inhibitor 
specific for butyrylcholinesterase. At 37 °C the 
AChE activity measured includes both the 
molecular form on the outer cell membrane and 
those released into the medium. 



34 



CARNEGIE INSTITUTION 



tion by 10-^ M IsoOMPA. a butyryl- 
cholinest erase inhibitor, and the 75% 
inhibition by 10"^' .1/ BW284c51. an 
acetylcholinesterase inhibitor, at 37°C 
indicates that both the cell-surface and 
the newly released forms of the enzyme 
are true acetylcholinesterases. We are 
using: this assay system along with sev- 
eral specific reversible and irreversible 
inhibitors of AChE to study the kinetics 
oi turnover of the intracellular and ex- 
tracellular enzyme pools and their rela- 
tion to the release of AChE into the 
medium. Preliminary experiments sug- 
gest that the rate of turnover of cell- 
surface AChE molecules and the release 
oi AChE into the medium are separate 
but metabolically coupled processes. 

Release of AChE by Chick Muscle 
Cells in Culture 

Besides being found both inside the 
muscle cells and on the external mem- 
brane, substantial quantities of acetyl- 
cholinesterase are also released into the 
culture medium (Wilson et al., Develop. 
Biol. 33, 285. 1973). To study the re- 
lease of AChE molecules, however, we 
needed a culture medium devoid of 
esterase activity. This was accomplished 
by treating our regular Eagle's medium 
containing 2% chick embryo extract and 
10% horse serum with, diisopropylfluoro- 
phosphate (DFP) , an irreversible esterase 
inhibitor, at a concentration of 2 X 10"''' 
M. The excess DFP in solution then 
becomes hydrolyzed over the next several 
days, and the medium thus treated does 
not exhibit cholinesterase activity for at 
least two weeks. 

To determine how much AChE is re- 
leased by cultured muscle cells, the 
cultures are first washed in Hank's 
buffered salt solution to remove untreated 
medium and AChE previously released 
into that medium. The cultures arc then 
covered with 1-2 ml of DFP-treatcd 
medium and returned to an incubator. 
At the designated time intervals, 10-//1 
aliquots of medium arc sampled from 



each culture and stored at 5°C. After 
the last sample is obtained the tubes are 
assayed for AChE activity. Pharmaco- 
logical agents, when they are used, are 
added directly to the medium or diluted 
and added in a volume of 10 ^1/ml 
medium. All manipulations are performed 
at 37°C. 

Figure 18 illustrates the effect of the 
inhibition of protein synthesis on the 
rate of AChE release into the medium. 
Both puromycin (10 ^g/ml) and cyclo- 
heximide (100 /^g/ml) inhibit the release 
within approximately 3 hours. This indi- 
cates that the release of previously syn- 
thesized AChE requires the synthesis of 
specific proteins, or that the AChE re- 
leased into the medium is newly synthe- 
sized and the cells contain a pool of 
AChE molecules equivalent to that re- 
leased over 2-3 hours. Evidence obtained 
from the density shifting technique, to 
be described subsequently, favors the 
second hypothesis. The release of AChE 
is also temperature-dependent and re- 



UJ 



< 



500 


- 






400 


- 


O/^ 


-^ 


300 


- 


yo 




200 


- 


q/ ^--a--^~- 
/,r-'^'--D---tr--c>-- 




100 
< 


aV 


1 1 I 1 


• 

-* 

1 



2 4 6 

Time ( hours 



10 



Fig. 18. Effects of metabolic inhibitors on the 
relea.se of AChE into the medium. All values 
have been normalized to the amount of AChE 
released by control cultures during the first 
hour. (O-O) untreated controls; (A- -A) 10 
/xg/ml puromycin; (n--n) 100 /^g/ml cyclo- 
heximide; (A-A) 10"^' M carbonyl(;yanide-m- 
chloroj)henylhydrazone; (•-•) lO"""' M dinitro- 
phenol. Each ])oint is the mean of three cul- 
tures. 



DEPARTMENT OF EMBRYOLOGY 



35 



quires energy in the form of ATP, as 
shown in Fig. 18. Here the release of 
enzyme is completely blocked after a 1- 
hour exposure to 10~"^ M dinitrophenol 
or 10~^ M carbonylcyanide-m-chloro- 
phenylhydrazone. These effects of ATP 
and protein-synthesis inhibitors on the 
release of AChE as well as the time- 
course of effect correspond well to those 
observed for the synthesis and incorpora- 
tion into membranes of the acetylcholine 
receptor and suggest that a common 
mechanism might be involved. 

To test this hypothesis further we 
treated chick embryo muscle cultures 
with 10-4 j^ J3FP for 15 minutes. This 
procedure resulted in essentially complete 
and irreversible inhibition of both intra- 
cellular and extracellular AChE activity. 
The cultures were then returned to the 
incubator and the rate of reappearance 
of AChE activity in the medium moni- 
tored as previously described. Fig. 19 
illustrates the results of such an experi- 
ment. The time from AChE biosynthesis 
to release is approximately 2% hours, 
which is close to the time for ACh re- 
ceptor incorporation into the muscle cell 
membrane. The nature of the release 
mechanism for AChE and its relation to 



acetylcholine receptor biosynthesis are 
current topics of investigation. 

The enzyme released into th(; medium 
is inhibited by lO"-* M BW284c51 but 
not by 10-^ M IsoOMPA, a specific 
inhibitor of butyrylcholinesterase. This 
leads us to a preliminary characteriza- 
tion of the enzyme as a true cholines- 
tcrase. Like the AChE forms found in 
the cells, the released AChE is pre- 
cipitable by concanavalin A, and this 
indicates that it is a glycoprotein as well. 
However, during velocity sedimentation 
experiments in 5-20% sucrose gradients, 
the released form of the enzyme migrates 
as a broad band with an S value midway 
between those of the two cellular forms. 
These data suggest that it exists as a 
distinct form, possibly a modification of 
one of the other two. These differences 
between the cellular and released forms 
are illustrated in Fig. 20. 



I 

o 



£ 

Q. 
O 

>% 
"> 

U 

< 

LlI 

.c 
O 
< 




O 

£ 
o. 
o 



< 

LiJ 
< 



E 
-a 



2 4 6 8 

Hours post -treatment 

Fig. 19. Effects of DFP on the release of 
AChE in chick embryo muscle culture. (O-O) 
untreated controls; (A- -A) cultures treated 
with 10-* M DFP. Each point is the mean of 
three cultures. 




Fraction number 

Fig. 20. Velocity sedimentation of medium 
and cell AChE from chick embryo muscle cul- 
tures. (•-•) cell AChE; (0--0) medium 
AChE. In this experiment 300-/ttl aliquots of cell 
extract or medium were layered on 5-209<r 
sucrose gradients and centrifuged in an SW50.1 
rotor at 48,000 rpm for 13 hr. The result of two 
separate gradients are plotted on the same 
graph. 



36 



CARNEGIE INSTITUTION 



ro 
I 

O 



E 

o. 

o 

> 

< 

LU 
SI 
O 
< 



30 




A 




25 




M • \ 




20 


- 


Ui 




15 


- 


i 1 ' 1^ 




10 


- 






5 


»«f 







10 15 20 

Fraction number 



25 



Fig. 21. Isopychnic centrifugation of medium AChE in CsCl. ( ) medium from cultures 

exposed to heavy amino acids for 48 hr; ( ) medium AChE after 7-hr exposure of 

cells to hght amino acids; ( ) medium AChE after 19-hr exposure of cells to light 

amino acids. 



Density Shifting of Acetylcholinesterase 

We have employed the technique of 
density shifting described by Devreotes 
and Fambrough (Year Book 75) to 
demonstrate the synthesis of new AChE 
molecules in cultured chick muscle cells 
and the release of newly synthesized 
AChE into the medium. In one such 
experiment chick muscle cultures that 
had been incubated with medium con- 
taining D, ^-"^C, ^•''N amino acids for 48 
hours were switched to medium contain- 
ing "light" amino acids for 7 or 19 hours. 
Controls remained in dense medium. 
One-milliliter portions of medium were 
mixed with 2.37 g CsCl in 4 ml 100 mM 
PO4 buffer j)Y\ 7.0 and centrifuged for 
89 hours at 40,000 rpm in an SW65 



rotor. The results of this experiment are 
shown in Fig. 21. Both light and dense 
AChE molecules are found in the dense 
medium because of the presence of light 
esterase derived from the horse serum 
and embryo extract. The dense AChE is 
that which has been synthesized by the 
cells during their exposure to the heavy 
amino acid-containing medium. After 
the transfer to light amino acid-contain- 
ing medium, all of the AChE released 
is of the light form, indicating that the 
newly released AChE molecules have 
been recently synthesized. 

Figure 22 shows a similar type of ex- 
periment designed to investigate the turn- 
over of AChE molecules in cultured 
muscle cells. Chick muscle cells were 
grown in medium containing the normal 



DEPARTMENT OF EMBRYOLOGY 



37 



I 
O 



e 

Q. 
U 

> 

< 

UJ 
jC 
U 
< 




10 20 30 

Fraction number 

Fig. 22. Isopychnic centrifugation of cell ex- 
tract AChE in CsCl. ( ) light amino acid 

controls; ( ) cell AChE after 17-hr ex- 
posure of cultures to heavy amino acids ; ( ) 

cell AChE after 48-hr exposure of cultures to 
heavy amino acids. 



light amino acids and then shifted to 
heavy amino acids. After the appropriate 
incubation time, the plates were washed 
to remove medium AChE, and the enzyme 
associated with the cells was extracted 
with 100 mM phosphate buffer pH 7.0 
with Triton X-100, 0.15 M NaCl and 
0.25 mM EDTA. 

The resulting extracts were then sub- 
jected to isopycnic centrifugation in 
CsCl, as described above, for 96 hours. 
In contrast to the density shift of AChE 
in the medium, which was essentially 
complete following the change to light 
medium, the enzyme associated with the 
cells contained both light and dense 
AChE molecules even after 48 hours in 
dense medium. Taken together, these 
studies suggest the presence of at least 
two subcellular compartments of AChE: 
The first is a pool with rapid turnover 
of newly synthesized AChE molecules 
which are released into the medium; the 
second is a compartment whose molecular 
contents are more slowly turning over 
and do not appear to leave the cell. 

These experiments illustrate the use- 
fulness of the density-shift technique in 



studying the distribution of newly syn- 
thesized AChE molecules in muscle cell 
cultures. We can now use this technique 
to trace the metabolic fate of the several 
forms of acetylcholinesterase found in 
muscle cell cultures, and to answer ques- 
tions about the possible interconversion 
of molecular forms of the enzyme. 



Acetylcholine Receptors and 

a-BuNGAROTOXIN BINDING SiTES 

ON Neurons 
S. Carbonetto and K. Midler 

a-Bungarotoxin binds specifically to 
the acetylcholine (ACh) receptor in 
skeletal muscle and has been used very 
successfully to study the metabolism of 
this membrane protein. The specificity 
of a-bungarotoxin for the ACh receptor 
has been established by: (1) the localiza- 
tion of a-bungarotoxin binding to cells 
and regions of cells that respond physio- 
logically to ACh, (2) the saturable bind- 
ing of a-bungarotoxin to muscle and its 
competition by agonists and antagonists 
of ACh, and (3) inhibition of the physio- 
logical response of muscle to ACh by 
a-bungarotoxin. 

a-Bungarotoxin binds specifically to 
primary cultures of chick sympathetic 
neurons as well as the ACh receptor in 
muscle. In Year Book 75 we reported 
that a study using light autoradiography 
had shown that a- [^^^I] bungarotoxin 
binding is localized to sympathetic neu- 
rons in culture and that this binding is 
completely blocked by curare (10~^ M) . 
Since then we have confirmed that the 
localized application of ACh onto neurons 
by microionophoresis results in a de- 
polarization of the membrane potential 
measured with intracellular microelec- 
trodes (Fig. 23). This ACh response is 
regarded as unequivocal evidence for the 
presence of an ACh receptor in the 
plasma membranes of these cells. The 
ACh response is quickly blocked by 
curare (10—* M) but can still be evoked 
in the presence of a-bungarotoxin (1 



38 



CARNEGIE INSTITUTION 



Control 



aBuTX 





Control 



ocBuTX 



B 





J 



dTC 



y 



Fig. 23. Effect of curare and a-bungarotoxin on the ACh response in neurons. (A) Responses 
of two neurons to short pulses of iontophoretically apphed ACh in the absence (control) and 
presence of 1 fj.g/m\ of a-bungarotoxin (aBuTX). Upper trace: 200 nA, 10 msec. Lower trace: 
10 mV, 10 msec. (B) Response of two neurons to release of the ACh holding current in the 
ab.sence (control) and presence of 1 /j.g/m\ of a-bungarotoxin (aBuTX). Upper trace: onset 
and off.set of release of the holding current. Lower trace: 10 mV, 5 sec. (C) Response of the 
same neuron to short pulses of ACh applied before the addition of 10~* M curare and 35 min 
afterwards (dTC) . Upper trace 200 nA, 2 msec. Lower trace : 10 mV, 2 msec. 



/zg/ml). Furthermore, preincubation of 
neuron.s with a-bungarotoxin does not 
affect curare's block of the ACh response. 
a-Bungarotoxin also binds specifically 
to chick sympathetic ganglia, so the effect 
of a-bungarotoxin was tested on an in 
vitro preparation of the lumbrosacral 
sympathotic chain. Stimulation of the 
interganglionic connective of the chain 



produced a response, recorded extracellu- 
larly from the ganglionic root, that was 
blocked reversibly by low concentrations 
of curare flO~^ M) and could not be 
evoked by antidromic stimulation (Fig. 
24). These two results suggest that the 
extracellularly recorded '^ganglionic po- 
tential" was mediated by cholinergic 
synapses, yet a-bungarotoxin in concen- 



DEPARTMENT OF EMBRYOLOGY 



39 



die 




\f0^ i\j^^*'m>«km0t*t 



a BuTX 





Fig. 24. Effect of curare and a-bungarotoxin on ganglionic response of chick sympathetic 
ganglia. (A) Ganglionic response before and 5 min after application of 10"* M curare. (B) 
Ganglionic response before and 1 hr after application of 10 Mg/ml of a-bungarotoxin. 40 ixV, 
40 msec. 



trations up to 60 /xg/ml had no effect on 
the amplitude of the potential. Thus a- 
bungarotoxin satisfies two important cri- 
teria that would establish it as a ligand 
for the neuronal ACh receptor: It binds 
to cells known to have ACh receptors, 
and it is competed by antagonists of 
ACh. Nevertheless, the failure of a- 
bungarotoxin to block the physiological 
response to ACh makes us unable to 
certify it as a ligand for the neuronal 
ACh receptor. 

There are several possibilities that 
could explain the inability of a-bungaro- 
toxin to block the ACh response and still 
have it bind to the neuronal ACh recep- 
tor. There may be multiple antagonist 
binding sites with a-bungarotoxin bind- 
ing poorly to its site so that it is incapable 
of either inducing an allosteric change 
or sterically hindering ACh and curare 
from gaining access to their sites, a- 
Bungarotoxin binding to neurons is re- 
versible and dissociates with a half-time 
of 2.5 hours at 23°C, whereas a-bungaro- 
toxin binding to muscle is almost irre- 



versible. There may be a small popula- 
tion of ACh receptors that are blocked by 
a-bungarotoxin, but their effect on the 
ACh response would be too small to be 
resolved by the physiological methods 
used. 

The molecular weight of the ACh re- 
ceptor from skeletal muscle is approxi- 
mately 250,000 daltons, and the receptor 
sediments at 9.5 S to 11 S in sucrose 
gradient centrifugation. As mentioned 
previously, the binding of a-bungarotoxin 
to sympathetic ganglia is saturable; and 
a detergent extract of membranes from 
ganglia, when assayed by sucrose gradient 
centrifugation, has a distinct a-bungaro- 
toxin binding peak that sediments very 
similarly to the muscle ACh receptor and 
is completely competed by curare (Fig. 
25) . This suggests again that the a-bunga- 
rotoxin binding molecule in neurons is the 
ACh receptor and, furthermore, that 
there is a detergent-soluble a-bungaro- 
toxin "receptor" that can be used to 
study membrane turnover in neurons. 



40 



CARNEGIE INSTITUTION 



CL 
O 



3 
GO 



600 


- 








r\ 


500 


- 








/ \ \ 


400 










^ ' /'"^ \ 


300 


- 








/ 1 / • ' \ 


200 










I My •■ \ \ 


100 


- 








^ k / \ \ 




•- 

-A. 




iJ: 







10 20 

FRACTION NUMBER 



30 



Fie. 25. Velocity sedimentation of neuronal a-biingarotoxin receptors. Six lumbosacral 
ganglionic chains were dissected from 19-day chick embryos and homogenized to 10 mM 
Tris, 1 m.V PMSF-EDTA (5 ml). The homogenate was centrifuged at 27,000sf for 60 min and 
the resulting membrane pellet extracted in 700 ti\ 1% Triton X-100 1 niM PMSF-EDTA. 
This was centrifuged again at 27,0009^ for 60 min, and the supernate was divided into 200-/ul 
aliquots. Each aliquot was preincubated with 10"*M curare or an equal volume of water for 
20 min at 23^C and then incubated with 0.01 /xg/ml of a-r^''T]bungarotoxin for 45 min at 
37 "C. Free a-bungarotoxin was removed by chromatography on a Biogel P-60 column (5 
ml), and the excluded peak (approximately 250 lA) was layered in a thin band over a 5-20% 
linear sucrose gradient (5 ml) containing 1% Triton X-lOO, 1 niM PMSF-EDTA. 15 ^1 of 
muscle ACh receptors labeled with a-[^"T]bungarotoxin was also layered on each gradient 
as a marker. Centrifugation was caiTied out in a Beckman SW50.1 rotor at 48,000 rpm for 
6 hr at 8°C. Gangha (•-•); ganglia +dTC (• •) ; marker (A--A). 



Binding of a-bungarotoxin to sympa- 
thetic neurons, however, is rapidly re- 
ver.«ible. and this presents an o!)stacle 
for turnover studies that would rely on 
long periods of ultracentrifugation to 
assay the receptor. Fortunately, we have 
found that glutaraldehyde in concentra- 
tions as low as 0.01% can he used to 
covalently cross-link a-})ungarotoxin to 
its receptor and decrease its dissoci- 
ation from 50% in 3.5 liours to less than 
10% after 24 hours at 23°C. Cross-linked 
bungarotoxin-receptor complexes sedi- 
ment with an »S value similar to that of 



muscle ACh receptors (Fig. 26). The free 
neuronal a-bungarotoxin-binding mole- 
cules also sediment as approximately IOaS 
molecules, and their position in sucrose 
gradients can be determined by a-bunga- 
rotoxin binding. 

We are embarking upon experiments 
to study the metabolism of the a-bunga- 
rotoxin binding molecule in neurons by 
means of the density-shift technique. 
These experiments may make an im- 
))ortant contribution to our knowledge of 
the tui'nov(>r of neuronal membranes and 
neuronal growth. 



DEPARTMENT OF EMBRYOLOGY 



41 



200 - 



CL 
O 



3 

GO 
a 



100 - 




20 
FRACTION 



30 
NUMBER 



Fig. 26. Velocity sedimentation of cross-linked a-bungarotoxin receptors. Ten lumbo- 
sacral ganglionic chains were dissected from 13-day embryos and pinned out in a Sylgard 
(Dow) lined plastic culture dish. These were incubated with 0.03 /Wg/ml of ^T-labeled a- 
bungarotoxin for 60 min at 37 °C and washed thoroughly. The ganglia were then homogenized 
in 450 ^A of 1% Triton X-100, 1 mM PMSF-EDTA in a ground glass homogenizer and 
spun for 45 min at 27,000gr. 200X aliquots of the supernate were treated with V/c gluteraldehyde 
for 20 min at 23 °C and were layered in a thin band over a 5-20% linear .sucrose gradient (5 
ml) containing 1% Triton X-100, 1 mM PMSF-EDTA. 40 /^l of muscle ACh receptors labeled 
with ^^^I-a-bungarotoxin was also layered on each gradient as a marker. Centrifugation was 
carried out in a Beckman SW50.1 rotor at 48,000 rpm for 5 hr at 5°C. Ganglia (•-•) ; 
marker (A- -A). 



ORGANIZATION AND INTERACTIONS OF MEMBRANE 
LIPIDS IN MAMMALIAN CELLS 

R. E. Pagano, A. Sandra, L. Huang, K. Ozato, and M. Takeichi 
with the assistance of E. Asch, W. Duncan, B. Smith, and J. Wiser 



Studies in this laboratory continue to 
focus on the dynamic role which mem- 
brane lipids and cholesterol play in cell 
membrane structure and function. The 
generally accepted concept of the cell 
plasma membrane is the fluid mosaic 
model of membranes in which the matrix 
of the membrane is a lipid bilayer and 
in which proteins are embedded to vary- 
ing degrees and are free to undergo 
lateral diffusion. It is thought that under 



certain physiological conditions portions 
or domains of this lipid matrix can 
change their physical state and thus alter 
the functional properties of the mem- 
brane. There is also a growing body of 
evidence, derived from studies of bac- 
terial and erythrocyte membrane sys- 
tems, that the various phospholipid spe- 
cies in membranes may be asymmetrically 
dispersed across the transverse dimension 
of the bilayer. In this report we examine 



42 CARNEGIE INSTITUTION 

the transbilayer distribution of the major preparations of plasma membranes which 

cellular phospholipids in the }")lasma are pure, sealed, and of uniform sided- 

membrane of cultured mouse L^I cells ness. In our studies we have used isolated 

and extend the notion of membrane lijnd latex phagosomes. These phagosomes 

asymmetry to this complex eukaryotic have a phospholipid composition similar 

cell type. to that of isolated plasma membranes, 

In other studies we are examining the and from the topography of the phago- 

interactions of artificial lij^d vesicles cytotic process, we assume that an inside- 

with mammalian cells. Our approach to out membrane sidedness is preserved, 

understanding the physical and biochem- L]\I cells were grown in tissue culture 

ical properties of natural membranes has in medium supplemented with '"^H-choline, 

been to study synthetic lipid vesicles of "^H-palmitate, -"^H-acetate, or ^''^P-ortho- 

known composition and structure. In i)hosphate. The cells were washed, sus- 

principle, it should be i^ossible to isolate i)ended in medium, and incubated from 

electrostatic, structural, and dynamic 15 to 60 minutes with 3000 polystyrene 

contriinitions to the interaction process latex beads (0.5 /x-2.02 /x diam.) per cell, 

by controlled and systematic variation The ingested beads were harvested by 

of the chemical and physical properties homogenization of the cells and isolated 

of the synthetic membrane surface. This by centrifugation on buoyant density 

year we report on the role of the cell- sucrose gradients. Figure 27 shows the 

surface proteins and vesicle lipid com- distribution of radioactivity using ^H- 

position in the adhesion of lipid mem- choline labeled cells. It is seen that the 

branes to the cell surface. ^H-cpm comigrates with the position of 

Details of our studies on each of these the isolated latex beads. No peak of 

topics are presented in separate sections radioactivity was observed at this posi- 

below. tion in labeled cells homogenized in the 

absence of beads. More than 99% of the 

^ _ _ radioactivity was chloroform-methanol 

STUDIES OF Traxsbilayer DISTRIBUTION ^xtractablc and more than 90% of the 

OF Phospholipids in ^Iammalian Cells radioactivity was in PC and SM. Iso- 

A. Sandra and R.E.Pagano ^^ted latex phagosomes were found to 

be enriched for the plasma membrane 
We examined the distribution of the marker 5' nucleotidase and devoid of 
major phospholipid classes (PC, phos- LDH activity, lending further support 
phatidyl choline; PE, phosphatidyl etha- for the plasma membrane origin of the 
nolamine; PS, phosphatidyl serine; PI, phagosome membranes, 
phosphatidyl inositol; and SM, sphingo- 
myelin) across the transverse dimension Asymmetry of the Major Phospholipid 
of the plasma membrane lipid bilayer of Species (PC andPE) 
cultured mouse LM cells. That is, what Phosphatidyl choline phospholipid ex- 
traction of each of these species faces change protein (PC-PLEP) from beef 
the cytoplasm of the cell versus the liver was isolated by DEAE-52, CM-52, 
external bathing medium? Because the and Sephadex G-50 column chromatog- 
acyl chain distribution in each of these ^aphy. This protein specifically catalyzes 
lipid classes is heterogeneous, we also the 1:1 exchange of PC from donor to 
.set out to determine the fatty acid com- acceptor membranes. From studies of 
position on each half of the bilayer. ^q^j^I bilayer membranes, it has been 

„T ^r I r^ .I- showu that PLEP acts only on the ex- 

rlasyna Memtjrane Derivatives , , •, , j. rxi i-i 

ternal, or accessible, aspect of the bilayer. 

To assess the transbilayer distrilmtion We have used this protein to deter- 

of phospholipids, it is necessary to obtain mine the proportion of PC in the accessi- 



DEPARTMENT OF EMBRYOLOGY 



43 




*i**t««i*** 



■ I ■ ■ -* 



BOTTOM 



TOP 



FRACTION 



Fig. 27. Isolation of latex beads from ^H choline-labeled LM cells. (A) Buoyant density 
sucrose gradient of bead-containing cell homogenate. Arrows represent position of latex beads; 
(B) isolated latex beads rerun under identical conditions; (C) ^H choline-labeled LM cell 
homogenate without latex beads run as (A). 



ble pool of ^H-choline-labeled latex 
phagosomes derived from uniformly la- 
beled LM cells. The phagosomes were 
incubated with and without PLEP in 
the presence of excess DOL (dioleoyl 
lecithin) unilamellar vesicles. After the 
reaction is terminated, the vesicles and 
beads are separated by centrifugation 
and their lipids analyzed by thin-layer 
chromatography and liquid scintillation 
spectrometry. Figure 28 shows the time- 
course of the exchange. About half 
(^55%) of the PC is readily available 
for exchange and is assigned as the cyto- 



plasmic component of PC in the LM cell 
plasma membrane. The remaining 45% 
of PC, which is not available for ex- 
change, presumably occupies the inner 
portion of the phagosome membrane, i.e., 
the outer portion of the cell plasma 
membrane. 

To determine the PE asymmetry in 
membranes, a nonpenetrating probe that 
reacts covalently with primary amino 
groups of lipids and proteins, TNBS 
(trinitrobenzene sulfonic acid) was used. 
Isolated ^^P-labeled latex phagosomes 
were reacted with TNBS by incubating 



44 



CARNEGIE INSTITUTION 




6 9 12 

TIME (HRS) 



18 



Fig. 28. Kinetics of ^H PC exchange between 
unilammelar dioleoyl-phosphatidyl choline vesi- 
cles and ■''H choline-labeled latex phagosomes. 
Beads and vesicles were incubated at 37° with 
20 U/ml of PC exchange enzj^me. The ex- 
changed phospholipids were determined by ex- 
traction. TLC separation, and radioactivity 
measurement with and without the exchange 
protein. 



the beads at either 4° or 37°C in Hanks' 
balanced salt solution, buffered with 
l.S^/c NaHCOa, pU 8.5. The reaction was 
stopped by the addition of 0.5 A' HCl or 
complete LM medium. Beads were cen- 
trifuged and washed with the same solu- 
tion. The lipids from the TNBS-labeled 
phagosomes were extracted and subjected 
to thin-layer chromotography. The Tnp- 
PE derivative was readily separable 
from authentic PE, and by radioactive 
counting procedures the fraction of modi- 
fied PE could be readily determined. 

The TXBS-labeling experiments were 
also performed on intact LM cells, which 
were subsequently allowed to ingest latex 
beads, -^^p-iabeled LM cells were labeled 
with TXBS (5 mM) by suspending the 
washed cells in Hanks' BSS containing 
1.8% NaHCO, at pH 8.5. The reaction 
was stopped by the addition of LM me- 
dium. The cells were washed, resuspended 



in LM medium, and incubated at 37 °C 
with 0.945 /t latex beads for 30 minutes. 
The beads were isolated from the cells as 
previously described and then analyzed 
for PE and Tnp-PE. Thus we were able 
to obtain latex phagosomes labeled by 
TXBS from either aspect of the plasma 
membrane. 

TX^BS labeling of isolated latex beads 
was found to be temperature dependent. 
At 4° about 70% of the PE of the iso- 
lated phagosomes was converted to the 
Tnp derivative. Labeling at 37 °C in- 
creased this value to more than 98% 
(Fig. 29). When cells were first labeled 
by TX^BS, the ingested latex beads had 
only about 24 7r of the PE converted to 
Tnp-PE. By raising the temperature of 
TX^BS labeling to 37°C, this amount was 
increased to 757^ over 120 minutes. 

These experiments indicate that PE 
is asymmetrically distributed in the 
phagosome membrane, with about 70% 
occupying the cytoplasmic pool and 
about 24% on the outer half of the bilayer. 

PE and PC are the major phospholipids 
found in the LM cell phagosome. To- 
gether they account for about 75% of 
the total phospholipid. By knowing the 
relative abundance of the phospholipid 
species and assuming that total phospho- 
lipid is distributed equally on both halves 
of the membrane, we deduce the asym- 




60 
TIME (MIN ) 



120 



Fig. 29. Kinetics of TNBS-labeling of intact 
LM cells (•-•) and isolated latex phagosomes 
(O-O) as a function of temperature. 



DEPARTMENT OF EMBRYOLOGY 



45 



PC 

I 



SM 

I 



PS, PI 

I 



finiifinni fiiififffiiiiii! tmm "-"" 



iiiiiiiuiiiiiiu m mmmmm 



PE 



CYTOPLASMIC 
FACE 



Fig. 30A. Transbilayer distribution of the phospholipid species of LM cell lafex phagosomes. 



metric distribution of the major lipid 
species to be as shown in Fig. 30 A. PE 
preferentially occupies the inner leaflet 
of the bilayer, while the distribution of 
PC is more nearly symmetrical. The re- 
maining membrane phospholipids, sphin- 
gomyelin, phosphatidyl serine, and phos- 
phatidyl inositol, preferentially reside on 
the outer face of the plasma membrane. 

Acyl Chain Asymmetry 

The fatty acid portions of the phago- 
some phospholipids in each half of the 
bilayer were analyzed by first isolating 
the exchangeable and nonexchangeable 
pools of PE and PC as described previ- 
ously. The cellular phospholipids in these 
experiments were radiolabeled in the 
fatty acid portion by '^H acetate. 

The individual phospholipids were hy- 
drolyzed, trans-esterified, and subjected 
to gas-liquid chromatography. Fractions 
of the effluent were then analyzed for 
radioactivity. The four major fatty acids 
(16:0, 16:1, 18:0, 18:1) which make up 
more than 959^: of phagosome acyl chains 
were expressed in terms of their relative 
abundance. No major differences w^ere 
observed in the transbilayer distribution 
of acyl chains in PE and PC. The total 
acyl chain distribution in SM, PS, and 
PE was also determined. In our study of 
phospholipid polar headgroup asym- 
metry, 22% of the outer face phospho- 
lipid and 4% of the cytoplasmic face 
material is left over to be assigned to 
these species. Because SM is the major 
phospholipid to be fitted into the scheme, 
we tentatively assign it to the outer face, 



CO 

< 

I 
o 

_J 
> 

< 

Q 

a. 

_i 
o 

I 

Q. 
CO 
O 

X 



30 



20 



10 



< 

O 20 



30 



16=0 I6:| 18:0 I8:| 



B 






OUTER 
FACE 



CYTOPLASMIC 
FACE 



Fig. SOB. Transbilayer distribution of the 
phospholipid acyl chains in LM cell phagosomes. 



and PS and PE to the remaining cyto- 
plasmic and outer portions. Thus we 
are able to construct an acyl chain distri- 
bution based on phospholipid asymmetry 
and the relative abundance of the acyl 
chain distribution within each phospho- 
lipid species. These data are summarized 
in Fig. 30 B. The cytoplasmic portion of 
the plasma membrane is enriched in un- 
saturated fatty acids (16:1 and 18:1) 
compared to the outer portion. Because 
the physical state of phospholipids is 
partly determined by the polar head 
group and the acyl chain composition, 
these results suggest that each half of 
the plasma membrane lipid bilayer may 
respond differentially under certain phys- 
iological conditions. Experiments are in 
progress to test such a hypothesis. 



46 



CARNEGIE INSTITUTION 



Adhesion of Phospholipid ^Membranes 

TO Chinese Hamster Fibroblasts: 

Role of Cell-Surface Proteins 

R . E. Pagano and M . Takcichi 

In previous reports we have docu- 
mented the ability of lipid vesicles 250- 
500 A in diameter to fuse and undergo 
lipid exchange reactions with the plasma 
membranes of Chinese hamster V79 
fibroblasts. Here, we show that unilamel- 
lar lipid vesicles generated from dimyri- 
stoyl lecithin (D^H.) or dipalmitoyl 
lecithin (DPL) are taken up at tempera- 
tures below their T,.* by V79 cells in 
suspension primarily through stable 
adsorption or adhesion of vesicles to the 
cell surface. It is further demonstrated 
that this vesicle-to-cell adhesion requires 
the presence of several cell-surface pro- 
teins that have a high affinity for ''rigid" 
vesicle lipids. 

Chinese hamster V79 cells were grown 
as monolayer cultures and dissociated 
into single cells, using EDTA. Washed 
cells were incubated for various periods 

* To. gel-liquid crvstallinc phase transition 
temperature: T.. ^20.9'C for DML and 36.4°C 
for DPL. 



of time in a serum- and lipid-free medium 
with ^^H DAIL or -^H DPL vesicles. 
Typical results are summarized in Table 
4 for a 1-hour incubation. The absolute 
amounts of DPL uptake at 2°C are 
2-2.5 times greater than that at 37°C. 
DPL uptake was always greater than 
when DjNHj was used. Preincubation of 
cells (30 min, 37°C) with 5 mil/ NaNs 
and 50 mM deoxyglucose has no effect 
on DPL uptake but reduces DML up- 
take at 37°C to about 80% of control 
values. The presence of 1 mil/ Ca-+ and 
1 mM ]\Ig-+ during the vesicle-cell in- 
cubation results in a slight (^5%) en- 
hancement of vesicle uptake. 

The exogenous phospholipid that be- 
comes cell-associated upon incubation 
with DlNHv or DPL vesicles can be re- 
leased by treatment with trypsin. Cells 
were incubated for 1 hour with DPL or 
DAHj vesicles and subsequently washed 
free of excess vesicles. Samples of the 
cells were then subjected to a 10-minute 
incubation with a 0.01% solution of crys- 
talline trypsin at 22 °C. The reaction was 
stopped by addition of a tenfold excess 
of trypsin inhibitor and by centrifuga- 
tion of the cells. Analysis of the cell pellet 



TABLE 4. Comparison of DPL and DML Uptake by EDTA-Dissociated (E) and Trypsinized 

(T) V79 Fibroblasts in Sus}iension 









Lecithin 


Uptakcf 










/xg/4 X 10" 


' cells/hour 










With M( 


?tabolic 










Inhibitors! 






Control 


(% of Control) 




Vesicle-Cell 




















Cell Type* 


Incubation (°C) 


DML 


DPL 


DML 


DPL 


£ 


2 


18.0 


50.0 


96 


110 


E 


37 


6.5 


20.1 


80 


110 


T 


2 


7.5 


19.3 


105 


109 


T 


37 


7.0 


12.1 


100 


99 



* E-cells were prepared from 8ubconfluent monolayers by dissociation with EDTA, T-cells by 
combined use of EDTA and try])sin. 

t All experiments were farrie*! oul in du))licale or liii)li('alo. Variation was within ±5%. 

t Cells were preincubated with 5 mA/ NaN.i and 50 mM 2-deoxyglucose for 30 min at 37°C 
before incubation with vesicles. Ti)e metal)olic inhil)itors w(>r(> also pr(>sent during vesicle-cell 
incubation.s. 



DEPARTMENT OF EMBRYOLOGY 



47 



TABLE 5. Rcloaso of Coll-Asso(;ial,o(l DPL and 
DML Vesicles from Colls by Trypsinization* 

Tern I). % of Vesicl(> 

Vesicle of Vesicle Radioa(;tivify 

Typo Incubation (°C) Released from ('ells 



DML 


2 


40-50 


DML 


15 


29-42 


DML 


32 


5-12 


DML 


37 


1- 2 


DPL 


2 


55-62 


DPL 


20 


49-57 


DPL 


37 


3- 9 



* E-cells were incubated with unilamellar 
lipid vesicles for 1 hr at indicated temperature, 
then washed and treated with 0.01% trypsin for 
10 min at 22°C. Measurements represent the 
range of values found in four experiments. 



and supernatant revealed that varying 
amounts (^0-60%) of the cell-associ- 
ated DPL or DML can be released into 
the medium by trypsin, depending on the 
temperature at which the initial vesicle- 
cell incubation is carried out (Table 5). 
Prolonged incubation with trypsin (up 
to 30 min) does not further reduce the 
amounts of cell-associated DML or DPL. 
All of the radioactivity released by 
trypsin is chloroform-methanol extract- 
able and chromatographs as lecithin. 
Spontaneous release of ^"^H-DPL or DML 
from cells in the absence of trypsin is 
negligible. The release of DPL or DML 
cannot be induced with heat-inactivated 
trypsin or with trypsin inhibitor alone. 
Incubation of cells with DML or DPL 
vesicles has a significant effect on the 
susceptibility of certain cell-surface pro- 
teins to lactoperoxidase-catalyzed iodi- 
nation. Figure 31 A-C presents auto- 
radiograms of the SDS-polyacrylamide 
(7.5%) gel electrophoresis patterns ob- 
tained for the proteins from ^^^I-labeled 
control cells (Fig. 31 A), and for cells 
preincubated 1 hour at 2°C with DPL 
(Fig. 31 B) or DML (Fig. 31 C) vesicles. 
While many of the radiolabeled bands 
are unaffected by vesicle treatments, the 
extent of ^^^I-labeling in several regions 
(I-V; Fig. 31) of the gel was obviously 



different for control than for DI^L or 
DML vesicle treatments. A prominent 
difference is in region III of the gels, in 
which it is seen that two bands, cor- 
responding to a molecular weight of 
about 60,000 daltons, are heavily labeled 
in control cells, and apparently unlabeled 
in the vesicle-treated cases. In contra.st, 
the labeling in regions I, II, IV, and V 
of the gels aj)i)ears to be enhanced for 
DPL and DML treatments, compared to 
the control. Coomassie l)lue staining pat- 
terns of the gels corresponding to Fig. 31 
A-C were virtually identical. 

EDTA-dissociated cells were also in- 
cubated with '"^H-DML vesicles 1 hour at 
2°C, and the cellular proteins from 
washed cells were solubilized with SDS 
and subjected to poly aery lamide gel 
electrophoresis. Figure 31 E,G shows the 
fluorographic patterns obtained in this 
experiment using 7.5% and 15% poly- 
acrylamide gels. While most of the -^H 
radioactivity migrates at the front of 
the gel, presumably as SDS-DML mi- 
celles, a number of radioactive bands 
also appear throughout the gel. It is note- 
worthy that two bands (Fig. 31 E,G, 
arrows) are heavily labeled with tritium, 
and that the position of these bands cor- 
responds to the position of the two pro- 
tein bands whose ^^'""I labeling was in- 
hibited by vesicle treatments (Fig. 31 
B,C). All of the '"^H-cpm in these bands 
is chloroform-methanol extractable. More 
than 75% of the radioactivity chromato- 
graphs as lecithin, the rest as lysolecithin 
and free fatty acid. 

Fig. 32 A-D shows a typical scanning 
electron micrograph of an EDTA-dis- 
sociated cell in the absence of vesicle 
treatment. Numerous projections and 
attachments to the glass substrate are 
visible (Fig. 32 A, arrows) 5 minutes 
after plating of the cells. Microvilli also 
appear to be extended away from the 
cell body. At high magnification the re- 
gions of the cell surface between projec- 
tions appear smooth (Fig. 32 B). In 
contrast, cells treated with DPL vesicles 
for 1 hour at 2°C differ from untreated 



48 



CARNEGIE INSTITUTION 



moi wt 
X 10"^ 



moi wt 
X 10"^ 



130 



68 



57.5 



43.5 



V 



I ' 
1' 

in 




68 

57.5 
43.5 

27 




3.4 







A B C D 



F 



G 



H 



Fig. 31. SDS-polyacrylamide gel electrophoresis patterns obtained from control and vesicle- 
treated cells. Autoradiograms are for the ^^I-labeled proteins from (A) EDTA-dissociated 
(E-celLs), (B) DPL-treated E-cells, (C) DML-treated E-cells, and (D) trypsin-treated 
(T-cells). Fluorograms are for (E, G) E-cells and (F, H) T-cells treated with 'H DML vesicles. 
All vesicle treatments were 1 hr at 2°C. (A-F) 7.5% gels; (G, H) 15% gels. The positions of 
the molecular weight markers, /3-galactosidase (130,000); BSA (68,000); catalase (57,000); 
ovalbumin (43,500); ConA (27,000); and cytochrome C (13,400) are shown. 



cells in several respects. Few microvilli 
extend outward from the cell surface into 
the bathing medium (Fig. 32 C) ; instead 
they appear to be held lengthwise on the 
cell body. Furthermore, no cellular pro- 
jections extending onto the glass cover- 
slip are seen. At higher magnification 
(Fig. 32 D) the cell surface has a rough 
or bumpy appearance compared to con- 
trols (Fig. 32 B). 

In separate studies, cells were incu- 
batf'd with DPL vesicles containing a 
trapped, water-soluble fluorescent dye, 6- 
carboxyfluorescein (6-CF), and subse- 
quently examined by fluorescence mi- 
croscopy. When such incubations were 



carried out at low temperatures, the 
vesicle-treated cells were seen to be sur- 
rounded by a bright ring of fluorescence 
(Fig. 33 A), while incubations carried 
out at 37°C resulted in an even distribu- 
tion of dye throughout the cell (Fig. 
33 B). Very little fluorescence is seen in 
control populations of cells treated with 
DPL vesicles containing no 6-CF or with 
cells incubated with a solution of vesicles 
and untrapped dye (not shown). 

The interactions of DML and DPL 
vesicles with trypsinized (10' at 37°C) 
cells were also studied. Depending on the 
temperature of vesicle-cell incubation, 
these cells incorporate about L5-2.5 



DEPARTMENT OF EMBRYOLOGY 



49 




Fig, 32. Scanning electron micrographs of EDTA-dissociated cells. (A, B) untreated controls; 
(C, D) DPL-treated (1 hr at 2°C). Arrows in A indicate typical attachment sites to glass 
substratum. (E) Trypsin-treated cell incubated (1 hr at 2°C) with DPL vesicles. Several 
spherical structures (/->-' 300- 1000 A diam.) resulting from vesicle treatment are shown at arrows 
in E. Low magnification, 7000 X ; high magnification, 28,000 X- 



times less DML or DPL than nontryp- treatments. Furthermore, the two protein 

sinized cells (Table 4). The iodination bands (Fig, 31 E,G) which are heavily 

pattern in trypsin-treated cells (Fig. 31 labeled with ^H DML in EDTA-disso- 

D) is not significantly affected by vesicle ciated cells, are only lightly labeled (Fig. 



50 



CARNEGIE INSTITUTION 




Fig. 33. Fluorescence micrographs of E-cells treated with DPL vesicles containing 6-carboxy- 
fluorescein for 30 min. (A) E-cells, 2X; (B) E-cells, 37°C. 



31 F. H) in trypsin-treated cells. Scan- 
ning electron micrographs of trypsin- 
treated cells were qualitatively similar to 
those obtained with EDTA-dissociated 
cells except that the number of particles 
adsorbed to the cell surface was obviously 
less fFig. 31 E vs. 31 D). 

Temperature Dependence of 
Vesicle Uptake 

The temperature dependence of DML 
and DPL vesicle uptake by EDTA- 
dissociated and trypsin-treated cells is 
shown in Fig. 34. Cells were incubated 
for 1 hour at the indicated temperature, 
washed, and then assayed for the uptake 
of exogenous lecithin. For EDTA-disso- 
ciated cells, DML uptake is nearly con- 
stant between 20 and 40°C but increases 
markedly below about 19-20°C. For 
DPL. vesicle uptake increases with de- 
creasing temperatures over the entire 
range of temperatures examined. The 
rate of increase is greater, however, be- 
tween 40 and 30 °C than between 30 and 
0°C. Treatment of cells with trypsin (10 
min, ST'^C) prior to incubation with vesi- 
cles .significantly alters the temperature 
dependence of vesicle uptake. For DML, 
the uptake between 0"^ and 39 ^C becomes 
nearly temperature independent. For 
DPL, trypsinization markedly reduces 



vesicle uptake at low temperatures, re- 
sulting in an uptake profile with little 
temperature dependence. Prolonged tryp- 
sinization of cells (up to 30 min) does 
not further modify vesicle uptake. 

Influence of Tc on Exogenous Lipid 
Incorporation by Cells in Suspension 

Although this report deals primarily 
with the adhesion pathway for vesicle 
uptake found at temperatures below the 
Tr of DML or DPL, it should be noted 
that above this temperature, there is a 
different mechanism of uptake. Thus, 
significant amounts of cell-associated 
DML or DPL can be released by trypsin 
when vesicle-cell incubations are carried 
out below the vesicle T,., but only negli- 
gible amounts are released after incuba- 
tions above this temperature (Table 5). 
Based on our previous studies with V79 
cells in which we used ''fluid" EYL or 
DDL vesicles, it seems likely that the 
mechanism of DML and DPL uptake 
above their T,. involves vesicle fusion 
with the cell surface. The finding of a 
uniform fluorescence in cells treated at 
37°C with DPL vesicles containing 6-CF 
(Fig. 33) is also consistent with a fusion 
mechanism above the vesicle Tr. 

The uptake of DML or DPL vesicles 
is not the result of a significant contri- 



DEPARTMENT OF EMBRYOLOGY 
30 



51 



UJ 

< 



EDTA DISSOCIATED 




10 



20 

TEMP rc ) 



30 



40 



EDTA DISSOCIATED 




10 



20 
TEMP (*»C ) 



30 



40 



Fig. 34. Temperature dependence of vesicle uptake by EDTA-dissociated and trvpsin-treated 
cells. (A) DML and (B) DPL. 



bution of an endocytotic pathway, since 
saturation levels of uptake were reached 
after only 5-10 minutes of incubation at 
37°C (data not shown). If vesicle uptake 
involves an active process, then incuba- 
tion for times greater than 5 minutes 
should increase the uptake. Furthermore, 
involvement of an active cellular process 



requires a significant increase in uptake 
with increasing temperature. However, 
in every case, DML or DPL uptake was 
either greater at lower temperatures or 
showed no significant temperature effect 
(Fig. 34) . Finally, treatment of cells with 
combined inhibitors of respiration and 
glycolysis (Table 4) has virtually no 



52 



CARNEGIE INSTITUTION 



effect on DPL uptake and results in only 
a small inhibition i-2CK(0 of DML up- 
take at 37'C. 

The findings reported here support a 
vesicle-to-cell adsorption process at low 
temperature in both EDTA-dissociated 
and trypsin-treated cells. Scanning elec- 
tron micrographs of V79 cells (Fig. 32 
D and E) reveal a characteristic bumpy 
surface following vesicle treatment. The 
size oi such "bumps" ranges from about 
300 to lOOOA, and is consistent with the 
adsorption of DPL or DML vesicles to 
the cell surface. DPL treatments of cells 
seem to hold microvilli to the cell body 
along their extended length, which pre- 
vent;? their full extension into the bathing 
medium and inhibits spreading of the 
cells onto a glass substrate. This could 
be explained if the adsorbed vesicles act 
as a bridge, binding different regions of 
the cell surface together. EM auto- 
radiosrams (Year Book 75) showed an 
accumulation (^90% of ^H DML or ^^H 
DPL at the cell periphery after a low- 
temperature incubation, suggesting that 
the adsorbed particles seen in Fig. 32 
represent applied vesicles. Finally, fluo- 
rescence microscopy of cells treated with 
vesicles containing the water soluble 
fluorescent dye 6-CF show an intense 
rinfi of fluorescence at their ]:)eriphery 
(Fig. 33 A). Such a pattern of fluores- 
cence is additional evidence that vesicle- 
to-cell adsorption is the dominant path- 
way of uptake at temperatures below the 
vesicle Tr. 

Mode of Veside-to-Cell Adhesion 

Our data suggest the importance of 
cell surface proteins in the vesicle-to-ccll 
adsorption phenomenon discussed above. 
The finding that uptake of vesicles by 
EDTA-dissociated cells is always greater 
than that by its trypsinized counterpart 
suggests that a trypsin-sensitive material 
is required for the greater })inding of 
vesicles to the cell surface. The release 
of a significant amount of DPTv or DML 
from the cell surface by trypsin (Table 



5) is also consistent with the involve- 
ment of a cell-surface protein moiety in 
vesicle binding. Scanning electron micro- 
graphs of cells (Fig. 32 D and E) show 
that the number of vesicles bound to 
the non-microvilli regions of EDTA- 
dissociated cell surfaces is much greater 
than in trypsinized cells. This suggests 
that the lower uptake of vesicles in 
trypsin-treated cells is not simply due 
to a reduction in the cell-surface area 
available for vesicle-to-cell adhesion, 
which could arise from subtle differences 
in the diameter and number of microvilli 
in the two cell types. 

DML or DPL vesicle pretreatments of 
EDTA-dissociated cells significantly 
modified the lactoperoxidase-catalyzed 
iodination of some of the cell-surface 
proteins. The modifications in gel pat- 
terns shown in Fig. 31 could result from 
(1) altered mobility of proteins in the 
gel due to the presence of tightly bound 
exogenously supj^lied DML or DPL 
lipids that were not completely removed 
from the cellular proteins by SDS solu- 
bilization and/or (2) modified accesi- 
bility of some of the cell-surface proteins 
to ^-^I-labeling by lactoperoxidase. While 
we cannot completely exclude the first 
possibility at this time, the absence of 
heavily labeled ^H DML bands in re- 
gions I, II, IV, and V of the fluorogram 
shown in Fig. 31 E suggests that the en- 
hanced iodinated bands seen in those 
regions following vesicle treatment (Fig. 
31A, B, C) are not due to an anomalous 
migration of proteins in gels resulting 
from their incomplete delipidation. Our 
finding of an apparent inhibition of ^^^I 
labeling of the approximately 60,000 
MW cell-surface proteins in the presence 
of adherent vesicles (Fig. 31 A vs. 31 
B, C) is consistent with explanation (2). 
Thus, gel electrophoresis and fluoro- 
graphy showed that the '"^H DML, al- 
though associated with a num})er of 
protein bands, was strongly associated 
with the two proteins whose iodination 
is inhi})ite(l })y vesicle pretreatments of 
cells (arrows, Fig. 31 E, O) . Furthermore, 



DEPARTMENT OF EMBRYOLOGY 



53 



this association was considerably weak- 
cned or nearly absent (Fi^. 31 F, H) in 
trypsin-treated cells, which also exhibit 
a greatly reduced DML or DPT^ vesicle- 
to-cell adhesion (Table 4; Fig. 32 D, E). 
Thus, we conclude that vesicle })inding 
to the surface of EDTA-dissociated cells 
involves a number of cell surface pro- 
teins, several of which have a high affin- 
ity for vesicle lipid and are protected 
from iodination as a result of vesicle 
binding. 

The adsorption of DML and DPL 
vesicles to cells may also involve a 
trypsin-insensitive protein, or a non- 
protein component of the cell surface. 
We suggest that vesicle adhesion to 
trypsin-treated cells may be primarily 
to such nonprotein regions of the cell 
surface, while adhesion to EDTA-dissoci- 
ated cells involves both protein and non- 
protein elements. In agreement with this 
idea is our finding that DML or DPL 
vesicle treatments of cells affects the 
iodination pattern in EDTA-dissociated 
but not trypsinized cells. Since the bind- 
ing of DML or DPL vesicles to EDTA- 
dissociated cells at low temperatures is 
much greater than to trypsin-treated 
cells, adsorption to surface proteins prob- 
ably dominates the uptake process at this 
temperature. With increasing tempera- 
tures, the level of vesicle uptake by the 
two cell types approached one another 
(Fig. 34), suggesting that adsorption to 
the nonprotein part prevails. We specu- 
late that this nonprotein part of the cell 
surface involved in vesicle uptake may 
represent accessible regions of plasma 
membrane lipids. 

In the present study we showed that 
below their T,, DML and DPL lipid 
vesicles adhere mostly to a trypsin- 
sensitive material on the surface of 
EDTA-dissociated cells. Our findings 
suggest a possible pathway for inter- 
cellular adhesion involving both protein 
and lipid. According to such a scheme, 
trypsin-sensitive materials on one cell 
surface, which have the ability to com- 
bine with some of the exposed lipids from 



the plasmalemma of another cell, result 
in th(! adhesion of the two surfaces. By 
analogy to our finrling that only '^^;olid" 
vesick.'s such as DML or DPL below 
tlunr Tr, form stable adhr^sions to cells, 
it is suggested that the lipids in those 
regions of plasma membrane involved in 
cell-to-cell adhesions are highly spe- 
cialized, pro})ably containing high pro- 
portions of "rigid" or saturated acyl 
chains compared to the plasma mem- 
brane as a whole. This model differs from 
current ideas on the molecular basis for 
intercellular adhesion of cells, which 
emphasize either specific interactions be- 
tween cell-surface proteins and/or carbo- 
hydrates of contacting cells, or inter- 
actions between the plasma membrane 
lipid bilayers of adjacent cells. While the 
proposed model is not intended to explain 
specific interactions between cells, the 
present findings do suggest that lipid and 
protein interactions between contacting 
cells may be important in stabilizing 
specific membrane contacts, once formed. 

Binding and Capping of Fluorescent 

Dye Containing Lipid Vesicles 

TO Lymphocytes 

K. Ozato, L. Huang, and R. Pagano 

In Year Book 75 we demonstrated that 
phospholipid vesicles are taken up by 
murine lymphocytes predominantly by 
vesicle-cell fusion or vesicle-cell adsorp- 
tion mechanisms, depending on the mo- 
lecular composition of the exogenously 
supplied lipids. Here we further examine 
the uptake of DPL and DOL (dioleoyl 
lecithin) vesicles by lymphocytes using 
fluorescence microscopy. With this 
method living cells can be examined im- 
mediately after vesicle treatment. 

Freshly isolated mouse thymocytes 
from CBA males 6-8 weeks old were 
used in all experiments. DOL and DPL 
vesicles were prepared by sonication in 
the presence of a w^ater soluble fluorescent 
dye, 6-carboxyfluorescein (6-CF). The 
sonicated vesicles containing trapped dye 



54 



CARNEGIE INSTITUTION 



were then separated from free dye by 
chromatography on Sephadex G-25 and 
immediately used. Thymocytes were in- 
cubated at 2'"" or 37 ''C for 1 hour (1 mg 
vesicle lipid ml; 4 X 10^' cells ^ml) with 
6-CF containing vesicles washed three 
times in balanced salt solution and ex- 
amined in a Zeiss fluorescence micro- 
scope utilizing epi-illumination. 

Typical fluorescence micrographs are 
shown in Fig. 35. Cells treated at 37°C 
with DOL vesicles containing 6-CF 
showed a relatively uniform and diffuse 
distribution of dye throughout the entire 
cell volume (Fig. 35 A), while cells in- 
cubated with DOL vesicles at 2°C 
showed very little dye uptake and could 
not be photographed. Using other types 
of fluid vesicles (such as egg yolk leci- 
thin) containing trapped 6-CF, we ob- 
tained results quantitatively similar to 
those obtained with DOL. On the other 
hand, cells treated at 2°C with DPL 
vesicles containing 6-CF showed an ac- 
cumulation of fluorescence at the periph- 
er>' of cells and very little fluorescence 
in the interior. The fluorescent vesicles 
also appeared to form patches and caps 
at the cell surface (arrows, Fig. 35 B). 
When the incubation with 6-CF con- 
taining DPL vesicles was carried out at 
37°C (Fig. 35 C), greater fluorescence 
intensity was observed at the cell bound- 
ary, with some fluorescence inside the 
cells. The ring of fluorescence was heavy 
and extended from the cell surface in a 
characteristically spiky fashion. No de- 
tectable fluorescence was seen in cells 
treated with vesicles containing no 6-CF, 
or with vesicles plus untrapped dye. 

The accumulation at the cell periphery 
of 6-CF entrapped in DPL vesicles after 
ve.^icle-cell incubation confirms the stable 
ad.'^orption of this vesicle type to the 
lymphocyte cell surface, which we re- 
ported earlier. Peripheral localization of 
the entrapped dye was accentuated when 
ihf incubation was carried out at 37°C 
(Fig. 35 C), suggesting a possible mul- 
tiple adsorption of DPL vesicles. When 
cells were incubated with dye containing 




Fig. 35. Fluorescence micrographs of mouse 
thymocytes treated with lecithin vesicles con- 
taining 6-carboxyfluorescein (6-CF). Treat- 
ments are (A) DOL vesicles (1 hr at 37°C) ; 
(B) DPL vesicles (1 hr at 2°C) ; prominent 
capping and patching of fluorescent vesicles at 
the cell periphery indicated by arrows; and (C) 
DPL vesicles (1 hr at 37°C) ; fluorescent ring 
was often non-uniform and extended away from 
cells (as shown by arrows). (B) and (C) are 
composite photographs from two different fields. 
Bar is 5 Ai. 

DPL vesicles at 2°C, patching and cap- 
ping of the adsorbed vesicles at the cell 
surface was evident (Fig. 35 B). This 
phenomenon might be due to the subse- 



DEPARTMENT OF EMBRYOLOGY 55 

quent warming of samples on the micro- We are investigating the possibility 

scope stage during observation, even that this reorganization of intact, adher- 

though it was observed immediately upon ent vesicles on the lymphocyte surface 

examining the cells in the fluorescence represents a reorganization of cell-surface 

microscope. lipids or proteins, or both. 



REGENERATION IN THE NERVOUS SYSTEM: 

FORMATION OF SPECIFIC SYNAPSES IN THE LEECH 

K. J. Muller and S. T. Carbonetto 
with the technical assistance of B. Thomas 

A central problem in neurobiology is: devised a microscopic histochemical tech- 
How do growing neurons select the nique for marking single leech neurons 
targets with which they synapse? During through recording microelectrodes. As 
development, when the nervous system was described in Year Book 74 and Year 
is being wired together, a single neuron Book 75, we inject a tissue sample with 
might synapse with just a few cells from the enzyme horseradish peroxidase 
a pool of perhaps thousands or tens of (HRP) under pressure through a micro- 
thousands. Regenerating neurons in the pipette and stain the sample to detect the 
central nervous system of adult verte- enzyme. In the leech both types of 
brates can also establish specific con- neuronal synapses — chemical and elec- 
nections. However, to show that precisely trical — are readily detected physiologi- 
the same neurons are reconnecting — that cally with microelectrodes. Ordinarily 
is, to study regeneration at the level of synapses can be identified morphologi- 
single cells — it has been necessary to cally only in the electron microscope, but 
turn to simpler systems. The nervous we reported that with the HRP technique 
system of the leech has been especially the synapses of specific sensory and 
useful for this, since it has only a few motor cells could be localized in regions 
hundred neurons in each segmental gan- of the cell that are distinctive in the 
glion and the functions of many of the light microscope. Another feature of the 
cells have been identified. The synaptic HRP technique — that the enzyme does 
interactions between these neurons have not pass between electrically coupled 
been found to be surprisingly consistent neurons— was used to demonstrate the 
and are, in that sense, predictable from precise location of the single electrical 
one ganglion or animal to the next. Con- synapse between pairs of identified inter- 
sequently, it has been possible to show neurons (the Rohde, or S neurons) . :\Iuch 
with electrophysiological techniques that ?^ our work durmg the past year has 
1 • J.' • 1- '1 ^ focused on regeneration of this particular 
during regeneration individual sensory ^-rr i , i • i ^ -i 
1 , ,1 . 1 , synapse. We have traced m some detail 
neurons can select their normal post- J . ,1 i xi x- 

^ , , 1 1 1 the steps taken by the regenerating 

synaptic contacts from among hundreds ,-, \ i^i- u ^-l ■ ^ 4. ■ 

, ,i ,. , , , .1 .1 neurons as they reestablish their electri- 

of other candidates, and re-form chemical ^^j connections ; and we have studied the 

synaptic connections. Still, we have very ^^^^ ^^ ^^^ ^^^^^^ -^ re-forming synapses 

little information on the structure of ^^^ ^q^, ^^^ n^,,. synapses compare in 

regenerated neurons and their synapses structure and distribution to the old. 

or on how they go about finding their ^g fi^^^ two functionally equivalent but 

postsynaptic targets. structurally distinct mechanisms for the 

With the aim first of detailing the regeneration process, and there is e^d- 

structure and distribution of synapses in dence that each has its counterpart in 

physiologically well-studied neurons, we other nervous systems. 



56 



CARNEGIE INSTITUTION 



Regexeratiox of ax Electrical Synapse of these structures that are typical of 

gap junctions. 
A'. J. MJlcr, S. T. Carbonetto. and B. Thorrias 



The Electrical Synapse between S-cells 

To study experimentally the formation 
of synapses between specific neurons, it 
is necessary to recognize the elements 
involved and, for comparison, to have 
an accurate picture of normal synaptic 
connections. The electrical synapse be- 
tween S-cells in the leech is particularly 
useful for this. Other investigators have 
shown that these neurons, thought to be 
syncytial (hence ''S-cell"). could reestab- 
lish electrical continuity after surgical 
disruption of a connecting axon (Frank 
et al, J. Comp. Xeurol. 159, 1, 1975). 
Last year we reported that such electri- 
cally connected S-cell interneurons, one 
in each of the 21 segmental ganglia of 
the animal, are linked at the ends of 
their axons by electrical synapses. Except 
near the extreme ends of the ventral 
nerve cord, the axons of S-cells meet at 
about the midpoint along the connectives 
between ganglia. This single region of 
contact between neighboring S-cells is 
the site of the electrical synapse that 
mediates passage of nerve impulses in 
either direction as they travel the entire 
length of the intact nerve cord. 

In thin sections viewed in the electron 
microscope, the presumed electrical con- 
tacts or gap junctions between S-cells 
resemble those of other invertebrates. 
The synaptic membranes at the electrical 
junction are separated uniformly by 6 
or 7 nm and can have linear dimensions 
of a micron. The synapsing axons con- 
tact each other at the ends of several fine 
processes rather than along an extensive 
septum, perhaps to allow for modulation 
of synaptic transmission, as discussed 
in Year Book 75. To define better the 
structure of the junction, we infused 
fixed preparations with La + + + salts, 
which fill extracellular spaces and thereby 
negatively stain the gap junctions. We 
found, rather than a regular matrix of 
20-nm hexagonal units, a scattered array 



Eegeneration of the S-cell Axon 

During development the S-cell axons 
travel halfway to the next ganglion down 
the connective and synapse with the 
neighboring S-cell. We crushed the nerve 
cord close to one ganglion (8, 9, 10, or 
11) so that the electrical synapse itself 
was not directly affected by the lesion, 
and observed the course of regeneration 
of this highly specific and localized con- 
tact. This procedure severs all axons in 
the bundle of nearly 100 (Faivre's nerve) 
in which the S-cell axon travels. Days or 
weeks after the lesion was made, the 
nerve cord was removed to a recording 
chamber, electrodes were placed into S- 
cells on both sides of the crush, and the 
degree of electrical coupling — if any — 
was measured. Both cells were then in- 
jected with HRP and processed for light 
or electron microscopy. 

It commonly takes 3 weeks for elec- 
trical coupling to resume between S-cells. 
However, anatomical studies show that 
within a week after the lesion a spray of 
sprouts emerges from the end of the 
severed axon. At the crush the sprouts 
are not restricted to Faivre's nerve, but 
beyond the crush one finds only one or a 
few fine branches that course along the 
route of the old axon, as if sprouts that 
find the former pathway are stimulated 
to continue growing. By contrast, the 
intact S-cell axon at the other end of the 
connective (the ''target" S-cell), its prin- 
cipal input removed, does not sprout but 
instead awaits reinnervation by the in- 
jured neuron (Fig. 36 A). 

Sections through the connective con- 
firm that the regenerating neuron closely 
follows its severed distal stump after 
crossing the lesion (Fig, 36 B). The 
severed distal axon, which looks almost 
normal, is longitudinally indented with 
grooves in which the fine regenerating 
sprouts are nestled. A glial sheet wraps 
both the old and the new axons and 



DEPARTMENT OF EMBRYOLOGY 



57 




l8d 




crush 



I 



0.2 mm 



B 





Fig. 36. S-cell axons regenerate toward synapse with target S-neuron. Both cells were injected 
with HRP 18 days after the connective was crushed. (A) Ventral view of connective linking 
ganglia. Regenerating axons (top) grow across crush and down middle of connective toward 
thicker and darker target S-cell axon. (B) Portion of connective cross section at upper arrow 
in A, after osmication and embedding in Epon. Densely stained growing tips of regenerating 
neuron course along the severed distal stump, which has as usual a large and light-staining 
profile. 



separates them everywhere except near 
the growing axon tips and in small re- 
gions along their length. Throughout the 
3- or 4-week period before electrical 
coupling is restored, while the two S-cells 
have not yet met, the severed distal 
stump persists as a healthy-looking and 
(as will be shown below) functional 
axon. 

Reformation of the Synapse 

Typically the next stage — restoration 
of electrical coupling — occurs within 4 
weeks, followed rapidly by transmission 
between adjacent S-cells. A consistent 
and remarkable finding, however, is that 



in the earliest stages impulses are con- 
ducted only from the target S-cell into 
the regenerating neuron, not in the re- 
verse direction (Fig. 37). Such one-way 
transmission between S-cells might in 
principle be due to a rectifying electrical 
junction such as occurs between certain 
sensory and motor neurons in the leech, 
but current passed into both cells demon- 
strates that they are reciprocally coupled. 
Moreover, it is sometimes possible to 
overcome the unidirectional block of 
transmission by depolarizing one S-cell 
with a suitably timed current pulse. 
Taken together with the small caliber 
of the regenerated process at one month, 
the unidirectional transmission of im- 



58 



CARNEGIE INSTITUTION 



30 d 




20msec 



0.1 sec 



Fig. 37. Impulse transmission across newly formed synapse between S-cells is at first one-way. 
Connective was cruslied near ganglion 8. 30 days before. S-cells were impaled with micro- 
electrodes, and a suction electrode applied to the posterior (/)) connective. Impulses generated 
in ganglion 9 or more posteriorly will invade the regenerating S-cell in ganglion 8, but not vice 
versa. Because currents pass well in both directions across the synapse, the junction is non- 
rectifying. Both cells were later injected with HRP and stained. 



pulses is consistent with an inability of 
the regenerating neuron to deliver enough 
current to the target S-cell to excite it. 

When the coupling of neighboring S- 
cells can first be recorded, HRP injec- 
tions show that the cells' axons are con- 
tiguous. Where the target S-cell and the 
distal stump overlap and contact each 
other, the regenerating neuron interposes 
itself between them and branches out to 
associate with the finer processes of the 
target S-cell (Fig. 38). The regenerating 
neuron forms electrical synapses here 
and docs not grow beyond the normal 
region of synapse. During the next month 
the caliber of the regenerated axon in- 
creases; full coupling and transmission 
are restored and the distal stump rapidly 
degenerates. 

It seems likely that the formation of 
the new synapse, which may involve a 
displacement of the old, triggers the dis- 
appearance of the distal stump. If re- 
generation fails (20 to 30% of total) 
the distal stump persists for 5 or more 
months and slowly degenerates. This de- 
generation is marked by glial hyper- 
trophy and a shrinking and darkening of 
the S-ceH axon, which is still recognizable 
by its distinctive position in the nerve. 



Once impulse conduction is established 
and the functional axons begin to in- 
crease in caliber, thereby increasing the 
speed and reliability of transmission, the 
extra sprouts at the crush disappear. 
This chain of events is typical of re- 
generating nerves and confirms the suit- 
ability of the S-cell as a model for 
synapse formation. 

The sequence of regeneration can be 
considered in steps. The initial growth is 
not well directed, but once contact is 
made with the old pathway, highly 
directed growth proceeds. When synapses 
have formed with the target, growth 
stops, and the distal stump begins to 
degenerate. We do not yet know the 
nature of the intercellular triggers for 
the progression of these stages, but the 
system for the assay is now in hand. 

''Fusion'' 

The six cases of most rapid restora- 
tion of coupling between S-cell pairs 
(from 10 days to 3 weeks) provided the 
evidence for another mechanism by which 
S-c(»l]s can reconnect. The regenerating 
S-cell had not reached the target S-cell, 
as shown })y HRP injection, so coupling 



DEPARTMENT OF EMBRYOLOGY 



59 







V 











,^,/ } 



. ^ 



-'i l'"'/''" 






31 d 



y 



^^u\ 



Fig. 38. Regenerating neuron (*) interposed between target S-cell (stained axon profile on 
left) and severed distal stump (right). Same degree of regeneration as in cell in Figure (37). 
Branches of the regenerating cell (*) have followed the stump's branches to contact the target. 



was through an intermediate element 
which we now know is the distal stump. 
The regenerating axon did not course as 
one or two fine fibers along the distal 
stump, but instead formed around the 
severed axon a distinctive basket of 



broader processes which could be unam- 
biguously identified in either the light 
or the electron microscope by its large 
size, dorsal position in Faivre's nerve, and 
lightly staining cytoplasm containing 
scattered mitochondria (Fig. 39). Sheets 



60 



CARNEGIE INSTITUTION 




jCXUS 



Fig. 39. When the S-cell forms an electrical synapse on its own severed distal stump, the 
regenerating processes surround the stump. (A) The axon proximal to the crush (below) 
branches as it crosses the crush in the center of the connective and remains branched as it 
forms a basket of proce.sses along the site of the distal stump. The marked cell ends abruptly 
several hundred micrometers before reaching the next S-cell (not shown), which had also been 
stained. (B) The growing tip. In this plane of focus, the marked processes are seen to surround 
portions (indicated at three locations by arrows) of the distal stump (18 days). (C) Schematic 
diagrams from peroxidase-injected preparations indicating the normal and experimentally 
induced connection (anterior at top). (D) Electron micrograph of connective cross section 
showing the two stained processes of the regenerating neuron (i^i and R2) near the distal stump 
(5), identified by its large size, dorsal portion in Faivre's nerve, and hght cytoplasm. Inset: 
where the regenerating axon (R^) apposes the segment are points at which the membranes are 
separated by no more than 4-5 nm (arrowheads), the presumed gap junctions (34 days). 



of glia separated much of the area be- 
tween the regenerating neuron and its 
severed axon segment, but direct contact 
was made near the growing axon tip and 
in some other regions. These small areas 
of close apposition appear to be gap 
junctions and are the presumed sites of 
electrical coupling. Tilting the thin sec- 
tions in the electron microscope confirms 
that the membranes are separated only 
by some 4 to 6 nm. 

For there to be electrical coupling and 
transmission through the severed axon 
stump, the axon stump must survive 
physiologically and continue to excite 
and be excited by the uninjured target 
S-cell across the old electrical synapse 
during the month after the connective is 
crushed. We demonstrated this by stim- 
ulating and recording from the distal 



stump in a preparation that had not 
regenerated (Fig. 40). 

Coupling and subsequent transmission, 
first in only one direction, occurs in the 
same sequence through the distal stump 
as when S-cells contact each other di- 
rectly (Fig. 41 A and B). It seems likely 
that the mechanisms for one-way trans- 
mission are the same. 

The electrical synapse formed by the 
regenerating neuron on its own distal 
stump is functionally indistinguishable 
from a direct fusion with the stump, ex- 
cept that large molecules such as HRP 
(40,000 daltons) are unable to cross the 
junction. This raises the possibility that 
for the many other systems in which 
fusion has been suggested as the expla- 
nation for rapid and complete regenera- 
tion, an electrical synapse has also 



DEPARTMENT OF EMBRYOLOGY 



61 




stim. p 

r 



stim. S 



10 



stim. a 





f 



0.5 mV I 




0.5mv| 




10 msec 

Fig. 40. The distal axon stump (here of S-cell in ganglion 11) remains functionally connected 
to the adjacent target S-cell (in ganglion 10) after crushing close to ganglion 11 (19 days previ- 
ously). Suction electrodes record anteriorly (a) and posteriorly (p) to ganglion 10, in which 
the target S-cell (Sw) has been penetrated with a recording microelectrode. Prior recording and 
stimulation posterior to the crush (=) demonstrated that the S-cell connection from ganglion 
11 had not regenerated. The recordings here illustrate respectively that (stim. p) threshold 
stimulation at p excites Sw, whose impulse is also recorded at a; (stim. >Sio) direct activation of 
Sio with a depolarizing pulse of current through the recording microelectrode activates not 
only its own axon recorded at (a), but also the axon of the distal stump recorded at p; and 
(stim. a) anterior connective stimulation at threshold directly activates Sw and subsequently 
the distal stump at p. In the diagram on the left, the thickened line in the connectives repre- 
sents the peroxidase-stained axon of >Sio, which terminated more than one millimeter from 
point p. At this distance the suction electrode {p) would not have directly activated or 
recorded from Sw. 



formed. It is not yet clear what factors 
determine whether the stump receives a 
synapse from the regenerating neuron. 

Our studies indicate that coupling 
through the distal stump is an inter- 
mediate step in a sequence leading to 
direct contact between the regenerating 
S-cell and its target S-cell at the site of 
the old synapse. When coupling through 
the distal stump is seen as late as a 
month after the lesion, the distance be- 
tween S-cells is as little as 100 /xm. At 
later times no coupled, adjacent S-cells 
have been seen that are not in direct 
contact with each other. The distal stump 
seems to be an imperfect target for the 
regenerating neuron, since the neuron 
continues growing to form its final 
synapse. 



Survival of the Distal Stump 

From the data presented so far one 
might conclude that the persistence of 
the distal stump is crucial to the entire 
regeneration process. The stump serves 
as a guide that is recognized by the 
growing axon, and the stump's continued 
contact with the target S-cell may pre- 
vent that cell from sprouting or retract- 
ing. We have initiated a series of experi- 
ments to determine by what means the 
distal stump survives without a cell body 
for weeks or months and whether the 
target S-cell will sprout when the stump 
degenerates. 

One hypothesis is that the stump is 
sustained by the surrounding glia or 
through the electrical synapse. A single 



62 



CARNEGIE INSTITUTION 



12d. 




t='-4mw 




0.1 sec 



20d 






20 msec 




0.1 sec 



Fig. 41. Stages of coupling through distal stump. (A) Earliest sign of coupling: Coupling is 
too weak to sustain impulse transmission 12 days after crush near ganglion 8. Impulses in distal 
stump, first generated in Si, are seen electrotonically in Ss. Junction is nonrectifying. (B) Before 
the regenerating S-cell reaches its target S-cell, there is already two-way transmission through 
the distal stump. The connective between ganglia 8 and 9 was crushed 20 days before. S-cells 
(Ss and iSt.) that, on subsequent marking with peroxidase, were found not to have regenerated 
a direct contact nevertheless show normal functioning. Upper: impulses generated in Ss with 
the recording microelectrode are propogated into ^9 and vice versa. Lower: hyperpolarizing 
currents injected into S^ or >Sb spread into the adjacent S-cell, indicating good coupling through 
the uninjected process. 



glial cell ensheathes one entire connective ably i)laced crush. We have examined a 

and Faivre's nerve. Its nucleus lies mid- series of animals in which the S-cell axon 

way between ganglia and can be sepa- was crushed in several places. Our pre- 

rated from the distal segment by a suit- liminary results indicate that distal axon 



DEPARTMENT OF EMBRYOLOGY 



63 



segments survive, though less well than 
the entire stump, when just a portion of 
axon is isolated. Moreover, S-cell re- 
generation is not impeded along the iso- 
lated segment. In other experiments, 
crushing the connective at both ends 
isolates both axons but does not initiate 
degeneration. 

Several months after regeneration has 
been experimentally prevented, we have 
observed a reorganization of S-cell mor- 
phology. In one instance, after 6 months 
without its normal connection the target 
S-cell entirely withdrew the "unused" 
axon from the connective. 

Using culture techniques described last 
year, we hope to achieve regeneration of 
the S-cell axon and synapse in vitro. 
This would permit considerable manipu- 
lation of the system. Thus far, functional 
restoration of transmission has been only 
through polysynaptic pathways. 



The DisTRinuTioN of Synapses of 
Identifip:d Sensory Neurons 

K. J. Muller and B. Thomas 

We are continuing the investigation of 
the formation and distribution of chemi- 
cal synapses by mechanosensory neurons. 
A study of branching patterns and 
synaptic enlargements of homologous 
neurons in successive ganglia of single 
animals has provided an index of the 
degree of variability in genetically, de- 
velopmentally, and functionally identical 
neurons. Our findings will be useful in a 
study under way with Dr. Eduardo 
Macagno at Columbia University, in 
which a computer graphic display of 
injected neurons is being used to pinpoint 
intercellular contacts. These contacts can 
later be identified as synapses with the 
electron microscope. Such methods should 
provide for a straightforward analysis of 
regeneration of specific connections. 



STRUCTURAL AND FUNCTIONAL STUDIES 
OF THE FIBROIN GENE 

Y. Suzuki, Y. Ohshima, P. Geshelin, Y. Tsujimoto, and P. E. Giza 



Our long-range goal is to understand 
fibroin gene control by reconstituting its 
function in vitro with the purified gene 
and necessary components. Last year we 
concentrated our efforts on the cloning 
of the fibroin gene, with its presumed 
regulatory sequences. We obtained 20 
clones of fibroin gene plasmids. Each 
plasmid was amplified in E. coli, and the 
fibroin gene is now available in mg 
quantity. One plasmid, pFbl9, carries 
about 6000 bases (6 kb) of the 5' end 
coding sequence and 12 kb of a flanking 
sequence adjacent to the 5' end of the 
gene. Another, pFblO, contains 6 kb of 
the 3' end coding sequence and L3 kb 
of a flanking sequence adjacent to the 
3' end of the gene. More recently we 
have obtained a plasmid, pFb29, which 
carries the entire coding sequence (17 
kb) with the flanking sequences adjacent 



to the 5' end (4.6 kb) and the 3' end 
(less than 0.5 kb). Using these plasmids, 
we have prepared restriction maps of the 
gene. The site of a presumed primary 
transcription of the gene has been mapped 
at or near the site where the 5' end of 
mature mRNi^ was mapped. We are now 
studying the sequencing of the putative 
regulatory regions as well as the spacer 
sequences surrounding the gene. 

Cloning of Fibroin Gene Plasmids 

Y. Ohshima and Y. Suzuki 
with technical assistance by P. E. Giza 

In Year Book 75 (p. 37) we reported 
our success in enriching the fibroin gene 
about 40- fold. However, the average 
molecular weight of this preparation was 
found to be 10-12 X 10^ daltons, and it 
was seriously nicked. We intended to 



64 



CARNEGIE INSTITUTION 



clone the entire fibroin gene (11.4 X 10^ 
daltons^i with its flanking sequences by 
the dA dT joining method, but since 
nicked DNA is not satisfactory for the 
tailing reaction by the terminal trans- 
ferase, we abandoned this enriched 
preparation. 

Better DNA preparations were ob- 
tained by isolating posterior silk gland 
nuclei and extracting DXA from them 
(Suzuki and Giza. 1976'i. When ex- 
tracted, this DNA had a double-strand 
molecular weight of 60 X 10*' daltons and 
a single-strand molecular weight of 30 X 
10*^^ daltons. indicating that single-strand 
nicks were practically imdetectable. The 
high molecular weight DNA was mildly 
sheared in the presence of high salt down 
to 25 X 10*^ daltons (double stranded) 
and subjected to actinomycin D/CsCl 
density gradient centrifugation (Fig. 42). 
To our surprise, fibroin gene showed a 
bimodal distribution in the gradient (Fig, 
42 D ; one peak rej^resents intact genes 
characteristic of the size class of the 
bulk of DNA, and the other results from 
gene fragments smaller than 10 X 10^ 
daltons. The bimodal distribution was 
not due to the mild shearing because 
even unsheared high molecular weight 
DNA displayed the same proportion of 
intact to fragmented genes as that shown 
in Fig, 42 I. This observation might 
mean that active genes in specific tissues 
are more susceptible to nuclease attack 
than inactive genes (Weintraub and 
Groundine, Science 193, 848, 1976). Sepa- 
rate experiments showed that the intact 
size class of fibroin genes kept the same 
single-strand molecular weight through- 
out at least one cycle of actinomycin 
D/CsCI centrifugation and DNA re- 
covery from the gradient. Each size class 
of the gene fshown in brackets in Fig. 
42 1 1 was pooled separately and sub- 
jected to the second cycle of actinomycin 
D/CsCI centrifugation. The fragmented 
gcno fraction (Fig. 42 TI })) was enriched 
about 1000-fold, giving a gene concen- 
tration of about 4%. The intact gene 
fraction (Fig. 42 II aj was then sub- 



jected to a third cycle of actinomycin 
D/CsCl centrifugation (Fig. 42 III a) 
and enriched about 15- fold overall (gene 
concentration 0.06%). 

Poly (dT) tails were added to the 1000- 
fold enriched fraction, and the DNA was 
annealed with poly (dA) -tailed pMB9 
DNA, Although the efficiency of trans- 
formation was very low (Table 6, column 
2) in contrast to that by pMB9-dA/ 
p]\IB9-dT annealing mixtures (Table 6, 
column 1 ) , we obtained about 230 tetra- 
cycline-resistant transformants. From 
these we found 12 fibroin gene clones by 
^-^T-mRNA hybridization, at least 6 of 
which were fotmd to be independent of 
each other. The maximum insertion size 
among these 6 clones was 4 X 10^ dal- 
tons, and the average size about 2 X 10^ 
daltons. The largest one (pFblO) carried 
6 kb of the mRNA coding sequence and 
1,3 kb of a flanking sequence adjacent 
to the 3' end of the gene, as described in 
the next section. 

We then tried to anneal the dT-tailed 
high molecular weight gene fraction with 
the dA-tailed p]\IB9 DNA, but the an- 
nealing mixture did not contain any large 
circles (below 1%). When a sheared bulk 
DNA preparation from B. niori originally 
without single-strand nicks was used as 
test material for the tail addition, anneal- 
ing, and transformation, the fraction of 
circles and the efficiency of transforma- 
tion were very low (Table 6, column 3) . 
One reason for inefficient circle formation 
and poor transformation was presumed 
to be the occurrence of nicks in the DNA 
which were newly introduced by a con- 
taminating nuclease in the terminal 
transferase and subsequent internal tail 
addition during the terminal transferase 
reaction. A preparation of terminal trans- 
ferase obtained from W. Salser's labora- 
tory gave a higher efficiency of trans- 
formation (Tal)le 6, column 4), but the 
fraction of circles in the annealing mix- 
ture was still low. Other reasons for the 
low efficiency of circularization and 
transformation could be a low percentage 
of tailed 3' ends among the total ends of 



DEPARTMENT OF EMBRYOLOGY 



65 




< 



5 10 15 

Fract ion number 



Fig. 42. Partial purification of fibroin gene by actinomycin D/CsCl gradient centrifugation. 
The first cycle of actinomycin D/CsCI centrifugation (I) using 15 mg of Bombyx mori DXA 
in 12 X 20 ml gradients. The gene-enriched fractions shown by the brackets (fractions no. 
10-14 for Ila and no. 15-19 for lib) were subjected to the second cycle. Fractions no. 16-19 of 
lib were used for cloning. Fractions no. 9-13 of Ila were subjected to the third cycle (Ilia). 

Fractions no. 11-15 of Ilia were used for cloning. ( ), A260. ( — • — ), cts/min. An ahquot of 

fractions was hybridized with ^^^-mRNA. 



66 



CARNEGIE INSTITUTION 



TABLE 6. Summary of liA-dT Joining of the Fibroin Gene to the Plasmid pMB9 



Experiment Xo. 



Properties of DXA used 
Purilication factor of 

fibroin gene 
No. average double strand 

mol. wt. (XlO'daltons) 
Wt. average single strand 

mol. wt. (XlO'daltons) 

Pretreatment of DXA 

Terminal transferase 
preparation used 

Percent of circles on anneahng 
with plMB9-dA 



Tetracvcline-resistant cells/^ig 
of pMB9-dADXAon 
transformation 

Fibroin gene clones/ 

tetracychne-resistant cells 

Mol. wt. of largest fibroin gene 



(PMB9- 
EcoKl) 


xiooo 


XI 


XI 


xi 


xi 


Xl5 


3.6 


7 


20 


19 


19 


19 


15 


1.5 


... 


10-11 


10-11 


10-11 


10-11 


4 


None 


X'one 


None 


None 


X-exo- 
nuclease 


APase 


APase 


Xo. 1* 


Xo. 1 


No.l 


No. 2t 


No. 2 


No. 2 


No. 2 


15% 




0-3% 


2% 
(3%)$ 




4-7% 

(12- 

21%)$ 


• • • 



1 X 10' 1200 600 5800 2300 10300 12600 

12/230 ... ... ... ... 7/16000 

4X10' ... 11X10" 

(2 X (4 X 

10«)§ 10«)§ 



* Obtained originally from R. Ratliff . 

t Obtained from W. Salser. 

t Wt. % of circular structures. 

§ Mol. wt. of average insertion. 

(...) Either not apphcable or not tested. 

the sheared B. mori DNA, or poor prim- 
ing ability of many of the DNA ends. 
We therefore tried treatment of the DNA 
with A-exonuclease or alkaline phospha- 
tase before the terminal transferase 
reaction. The alkaline phosphatase treat- 
ment increased the transformation effi- 
ciency twofold and greatly improved the 
weight fraction of the average molecular 
weight of circular structures formed on 
annealing (Table 6, column 6). The 
A-exonuclease treatment was ineffective 
(Table 6, column 5). Employing the 
alkaline phosphatase treatment and the 
better preparation of terminal trans- 
ferase, we carried out transformation 
with the dT-tailed high molecular weight 
fibroin gene fraction annealed with dA- 
tailf'd pMB9 DNA (Table 6, column 7). 
Out of 16,(XX) tetracycline-resistant trans- 
formants, we obtained 7 fibroin gene 
clones, at least 6 of which were inde- 



pendent of each other. The longest in- 
sertion was 12 X 10^ daltons, and the 
average insertion size was about 4 X 10^ 
daltons. The average size is much smaller 
than the average size of the DNA used 
(number average mol. wt. : 15 X 10^). 
This result may be due to higher effi- 
ciency of smaller DNA molecules in 
forming circles or to nicks generated 
during the purification procedure for this 
specific preparation (Table 6, column 7). 
The largest one (pFbl9) carries about 
6 kb of the mRNA coding sequence and 
12 kb of a flanking sequence adjacent to 
the 5' end of the gene. 

In summary, the dA/dT joining method 
for cloning works well for cloning small 
genes of less than 5 X 10^' daltons (7.5 
kb). However, if the method is used to 
clone a gene larger than 10 X 10^ daltons 
and of low purity, one should use a nick- 
free DNA and a nuclease-free terminal 



DEPARTMENT OF EMBRYOLOGY 



67 



transferase. Restriction enzyme frag- 
ments seem to be better for the terminal 
transferase reaction, and when sheared 
DNA is used the pretreatment with alka- 
line phosphatase before tail addition may 
improve the efficiency of cloning. 

Recently a restriction map of fibroin 
gene in bulk DNA of Bombyx mori has 
been constructed by Manning and Gage 
(Fed. Proc. 36, Abs., p. 878, 1977) and 
by us. We now know that the restriction 
enzyme EcoHl generates a DNA frag- 
ment of 14 X 10^ daltons; it covers the 
entire fibroin gene (messenger coding 
sequence), about 4 kb of a flanking se- 
quence outside the 5' end of the gene, 
and possibly a trace (less than 0.5 kb) 
of a flanking sequence outside the 3' end. 
High molecular DNA (30-40 X 10^ dal- 
tons) was extracted from the posterior silk 
glands without fragmentation of fibroin 
genes and digested with EcoRl, and the 
fragment containing the gene was puri- 
fied 60- fold by banding in an actinomycin 
D/CsCl gradient and a sucrose gradient 



sedimentation. From this DNA prepara- 
tion we recently o})tained a clone carrying 
the EcoKi fragment of 14 X 10'' daltons 
which includes the whole gene ('pFb29j. 

Characterization of Fibroin 
Gene Plasmids 

Y. Suzuki, Y. Ohshima, and P.E. Giza 

Definite Identification of Fibroin Gene 
in the Cloned Plasmids 

Although the ^^^I-mRNA used for hy- 
bridization has been judged to be more 
than 95% pure, we could have cloned 
DNA sequences other than those coding 
for fibroin. Therefore, we wanted to iden- 
tify the gene unequivocally in the plas- 
mids. First, we worked out the hybridiza- 
tion requirements for ^^^I-mRNA with 
the gene plasmid pFblO at a variety of 
mRNA concentrations (Fig. 43). As 
much as 40% of the input mRNA hy- 
bridized with the pFblO DNA (Fig. 43), 
indicating that pFblO carries DNA cod- 



I 
O 

X 

c 

E 
\ 



I - 







® 


- 


I / ® 






x/ 




V 




/ ^ 
/ \ 

f ^^- 

' ^X~ - 

1 1 1 ~~l~~-~-l--^ 1 





- 40 



Z3 
Q. 

C 



20 o 







200 400 600 800 1000 

ng /ml 



1200 



Fig. 43. Saturation hybridization of '^'I-mRNA to pFblO. About 300 ng of pFblO, which 
includes 75 ng of mRNA coding sequence, were used for each point. Up to 200 ng niRNA/ml 
undiluted ^^'I-mRNA was used. For the points at 200, 400, and 1100 ng/ml (— O— ) the labeled 
mRNA was diluted with cold mRNA, and taking the 200 ng/ml point as the standard, correc- 
tions were made and plotted. ( — • — ), cts/min; (--x--), percent of input mRNA taken up 
by the gene. 



68 



CARNEGIE INSTITUTION 



CM 

I 

g 

X 

6 

in 
U 




20 40 

Fraction number 

Fig. 44. The oligonucleotide profiles of RNase 
Ti digests of '^'I-fibroin mRNA, and RNAs 
hybridized with pFblO and pFbl9. (a) "^'I- 
fibroin mRXA was digested by RNase Ti, and 
the resulting oligonucleotides were fractionated 
by a DEAE-Sephadex A25 column, (b) "^'I- 
mRXA was hybridized with pFblO, and the 
hybridized RNA was hberated by heating and 
digested with RNase Ti. (c) The same as (b) 
except that pFbl9 was used for the experiment. 



ing for the major component (fibroin 
mRNA) of the assay probe. Second, the 
RNA that hybridized under saturation 
conditions was recovered and digested 
with RNase Ti, and the digest was frac- 
tionated on a DEAE-Sephadex column. 
The oligonucleotide patterns obtained 
from pFblO and pFbl9 were indistin- 
guishable from that of the input mRNA 



(Fig. 44). This is the strongest evidence 
that these plasmids contain the fibroin 
gene. Third, a thermal denaturation pro- 
file of pFblO was carried out (Fig. 45). 
About 50% of the hyperchromicity 
showed a sharp thermal transition at 
high temperature, indicating that about 
6 kb of the 12-kb plasmid represents a 
high-GC sequence, as expected from the 
known composition of the fibroin gene. 
This evidence eliminates any ambiguity 
about the nature of the cloned gene. 



Screening and Restriction Mapping of 

the Fibroin Gene Plasmids Carrying 

Both mRNA Coding Sequence and 

Flanking Sequence (s) 

Manning and Gage {Fed. Froc. 36, 
Abs., 1977) and the authors, working 
independently, have prepared a restric- 
tion map of the fibroin gene, using total 
DNA from Bombyx mori. It was found 
that the endonuclease Hindlll cleaves at 
(or near) both ends of the gene, and that 
EcoRl cleaves the DNA at one end of 
the gene and at a site some distance from 
the other end in a flanking sequence. The 
fragments made by BamUl resemble 
those formed by EcoHl, but the sites are 
reversed. The vector pMB9 has one re- 
striction site for EcoKl, for Hindlll, 
and for BamUl, but the EcoRl site had 
been destroyed by the poly (dA) -tail ad- 
dition (except in the case of pFb29). 
Using this information, we screened the 
fibroin gene plasmids, first by testing 
whether they had additional restriction 
sites for these enzymes and then by 
checking whether there were any restric- 
tion fragments that did not hybridize 
with i25i_jnj^;N'A. This screening method 
identified the plasmids carrying both the 
mRNA coding and flanking sequences. 

Of the 20 plasmids tested, most turned 
out to be intragenic fragments of 0.6 to 
11 kb. However, pFblO, pFbl9, and 
pFb29 revealed multiple restriction sites 
for several endonucleases. As shown in 
Fig. 46a the pFblO has three Hindlll 



DEPARTMENT OF EMBRYOLOGY 



69 



100 - 



E 
o 

a 

X 




Temp °C 

Fig. 45. The thermal denaturation profiles of pFblO, pMB9, and E. coli DNA. About 5 /ug of 
pFblO, pMB9 and E. coli DNA were subjected to the thermal denaturation in 0.1 X SSC. 
pFblO and pMB9 DNA were made linear by Hindlll digestion before the denaturation. 
— •— , pFblO DNA ; — O— pMB9 DNA ; ,E. coli DNA. 



sites, yielding three fragments: A (11.6 
kb), B (0.8 kb), and C (0.3 kb). Only 
fragment A hybridizes with ^^^I-mRNA 
(Fig. 46b). 32p.pMB9 DNA hybridizes 
strongly with A and faintly with B. 
Therefore, we conclude that all of C and 
part of B contain flanking sequences. 
The ^2P-pMB9 hybridization experi- 
ments also assign the location of the 
flanking sequence next to the poly (dA)/ 
(dT) joining region near the pMB9 
Hindlll site. There are no BamUl sites 
in pFblO except the one from pMB9 
itself (Fig. 47). However, pFblO has 
three EcoHl sites in the flanking se- 
quence, giving three fragments: A (11.6 
kb), B (0.9 kb), and C (0.3 kb) (Fig. 
47). Both i25i_j^j^NA and 32p_pMB9 
DNA hybridize only with the A frag- 
ment. Therefore, the length of the flank- 
ing sequence is at least 1.2 kb. From 
these cleavage patterns we constructed 
a restriction map for pFblO (Fig. 49). 
As shown in Fig. 48, the pFbl9 has 
four Hindlll sites, giving four fragments : 



A (11.8 kb), B (5.7 kb), C (3.4 kb), 
and D (3.1 kb). 32p.pMB9 DNA hy- 
bridized strongly with the A and weakly 
with the C fragments (Fig. 48b). There 
was an additional faint hybridization 
band between the two fragments. How- 
ever, it did not match with B, the ap- 
pearance was not reproducible, and the 
band was not detectable at lower con- 
centrations of 22p.pMB9 DNA. It could 
be due to either microheterogeneity of 
the pFbl9 or the presence of a contami- 
nant. Therefore we located C next to A 
in the orientation shown in Fig. 49. ^^^I- 
mRNA at 10-20 ng/ml generally hybrid- 
izes strongly only with fragment A. When 
the mRNA concentration was increased 
to 40-50 ng/ml, faint hybridization was 
detected in three additional bands (Fig. 
48c) ; none of them corresponds to any 
major restriction fragment; the one 
named B in Fig. 48c was close to the 
restriction fragment B (Fig. 42a) but 
not identical to it. Furthermore, these 
faint bands were not detectable in a 



70 



CARNEGIE INSTITUTION 







Fifr. 46. Tlip agaroso pjol oloctropliorosis and hybridization witli ^~"'I-mRNA of Hindlll frag- 
ments of pFblO. (a) Elect rophorosis of (from left, to right) "C-\ DNA fliiidUl dig(>s(, intact, 
pFblO, and pFblO Hindlll digest, (b) DNA was transfernnl from the gel shown in (a) to a 
Millipore filter and hybridized with ^''I-mRNA. 



diffc'iT'Tit batch of ))Fbl9 (Tsujimoto and 
Suzuki, unpul)li>li(Ml). If the hybridiza- 
tion band B rorrespondod to the HindWl 
fragment, the hy})ridiz('d RNA should 
represent a rather limited region of the 5' 



end of mature mRNA (possibly less than 
1 kb out of 17 kb for the entire mRNA 
sefjuence) or a presumed precursor to 
the inatiu'e mRNA, since pFbl9 was 
identified as the plasmid carrying the 



DEPARTMENT OF EMBRYOLOGY 



71 




Fig. 47. The restriction analysis of pFblO by 
agarose gel electrophoresis. Samples shown are, 
from left to right: (1) intact, (2) HirtdlU 
digest, (3) Hindlll and Eco^l digest, (4) 
Eco^l and BamWL digest, (5) EcoRl digest, 
(6) BamUl digest, and (7) Hnclll digest, of 
pFblO. (8) pMB9 Haelll digest, and (9) and 
(10) \ DNA Hindlll digest. 



flanking sequence to the 5' end of the 
gene (as will be described in the next 
section). Therefore, the hybridized RNA 
was recovered and digested with RNase 
Ti, and the resulting oligonucleotides 
were fractionated on a DEAE-Sephadex 
column. The pattern was indistinguish- 
able from the one shown in Fig. 44c. So 
we infer that the hybridization corre- 
sponds not to any unique sequence of 
the 5' end of the fibroin gene transcript 
but rather to an internal gene hybridiza- 
tion with a smaller Hindlll A fragment 
derived possibly from minor heteroge- 
neity in the pFbl9 plasmid. The Hindlll 
B fragment (5.7 kb) was split into two 
pieces by EcoKl digestion (Fig. 48a), 



one about 4.1 kb and the other about 1.5 
kb. The 1.5-kb fragment and the D frag- 
ment (3.1 kb) were also d(.'tected in 
Hind\\l-Ec(AU digests of pFb29. By 
comparing the restriction maps of pFbl9 
and f)Fb29, and considering the distance 
between the EcoWl anrl Hindlll sites, it 
was possible to [)lace fragment D next 
to fragment A (Fig. 49). It was noted 
that the Hindlll fragments D, B, and 
most of C contain the 5' end flanking 
sequence. The restriction maps for pFbl9 
and pFb29 were constructerl accordingly 
(Fig. 49). 

In Fig. 50 we summarize the restriction 
map of the fibroin gene constructed 
mainly from the cloned plasmids and 
partly from the analysis of total genomic 
DNA. Figure 50 shows the restriction 
maps of only the fibroin gene part in- 
serted into the vector. 

Determination of Orientation of the 
Cloned Fibroin Genes 

Hindlll digestion of pFblO and pFbl9 
gives a large fragment composed of 
nearly equal ])arts mRNA coding se- 
quence and pMB9 (fragment A in Fig. 
49). It follows that upon digestion of this 
fragment with exonuclease III or A- 
exonuclease, the coding strand will either 
be digested away or be conserved and so 
become available for hybridization with 
1251-mRNA. We found that digestion of 
pFblO with exonuclease III gave a hy- 
l)ridizable coding strand without de- 
naturation of the digested DNA. There- 
fore the 5' end of the coding strand is 
conserved and single stranded. We found 
also that the coding strand of pFbl9 be- 
came hybridizable upon digestion of the 
DNA with A-exonuclease, which indicates 
that the 3' end of the coding strand is 
conserved in this plasmid. Therefore, we 
conclude that pFbl9 carries the coding 
sequence corresponding to the 5' end of 
mRNA and extra sequences adjacent to 
the 5' end of the gene. We also conclude 
that pFblO contains the sequence coding 
for the 3' end of the mRNx\ and an extra 
sequence adjacent to it. 



72 CARNEGIE INSTITUTION 

12 3456789 12 34 56789 123456789 




Fig. 48. Restriction analysis of pFbl9 by an agarose gel electrophoresis. Samples shown are 
(1) intact, (2) Hiudlll digest, (3) Hindlll and BamHI digest, (4) BamEl digest, (6) EcoUl 
and Hindlll digest, (7) EcoRl and BamRl digest, (8) EcoRl digest, (9) Sail digest, and 
(5) Sail digest of pFblQ with a size marker of \ DNA Hindlll digest, (a) Electrophoresis pat- 
tern; (b) Hybridization of the DNA with 'T-pMB9 DNA; and (c) Hybridization of DNA 
derived from a similar experiment with ^^^I-mRNA. 







fiomio 



^ffMd 



Hind III 



I EcoRl 



AjV ilA/dT(EcoRl) 
< Shearing ind 



Fig. 40. Restriction maps of the plasmids pFbl9, pFb24, pFblO, and pFb29. Numbers in the 
figure stand for kilobases. 



DEPARTMENT OF EMBRYOLOGY 



73 



Gene 



^3 







! 1 
1 I 


17 kb 

1^ 










K— 


1 • 


k 


'*' 





21 kb 



k H^ 

2.9 



H+K-* 



i >K 



4.1 1.5 3.1 




pFb19 



pFblO 






6.0 



.5.8 



pFb24 




pFb29 



21 



Fig. 50. Restriction map of fibroin gene compiled from plasmids and B. mori total DXA, 
together with restriction maps of fibroin genes in the plasmids. i Hindlll site, | EcoRl 
site, ; BamEl site, | sheared DNA ends with dA/dT. 



Identification of the Site and 

Sequence of the Primary Transcript 

OF THE Fibroin Gene 

Y. Suzuki, R. Reeder, Y . Tsujimoto, 
and Y . Ohshima 

Before we proceed to the sequence 
analysis of the presumed regulatory re- 
gion and faithful transcription studies of 
the gene in vitro we have to locate the 
site of primary transcription on the gene 
map. 

Hybridization of i^si.^j^;^^ ^^ 20 
ng/ml in l-/>tg samples of the plasmids 
pFbl9 and pFb29 occurs only with the 
largest Hindlll fragments (A). From 
the restriction mapping described above 
and from the hybridization experiments, 
we conclude that the 5' terminus of ma- 



ture fibroin mRNA is very close to the 
Hindlll site of the A fragment (within 
1 kb). Our i25i_j^j^]v^T^ preparation in- 
cludes putative precursor molecules of 
the mature mRNA because in the mRNA 
purification procedure we always pool 
whole RNA fractions greater than 40S. 
With the use of this mRNA preparation, 
other Hindlll fragments (B. C, and D) 
did not show any hybridization even 
after a prolonged incubation at an 
mRNA concentration of 50 ng/ml. How- 
ever, we cannot locate the site of the pre- 
sumed primary transcript with this ex- 
periment because we do not know the 
concentration of putative precursors in 
the mRNA preparation. 

Yang et al, in Cell 7, 339 (1976), 
reported that only 60% of fibroin mRNA 



74 



CARNEGIE INSTITUTION 



is found capped. But a group oi enzymes 
from vaccinia is known to cap RNA ends 
having diphosphate or triphosphate 
(!Moss. Biochoti. Biophijs. Res. Comm. 
74, 374. 1977). A fibroin mRXA prepa- 
ration containing putative precursors was 
capped by these enzymes and hibeled 
with S-adenosyl-(^H) methionine in vitro. 
The hibeled mRXA was hybridized to 
Hindlll fragments from three kinds of 
fibroin gene phismids: (1) pFbl9 having 
12 kb of the 5' end flanking sequence, (2) 
]iFb2o having only the intragenic por- 
tion, and (3) pFblO having 1.3 kb of the 
3' end flanking sequence. The hybrids 
were exposed to RXase Tx to eUminate 
nonhybridized mRXA. As shown in Fig. 
51. the '^H-mRXA livbridized only with 



the Hindlll A fragment of pFbl9. The 
specificity of this hybridization confirms 
that methylation occurred at the 5' end 
of niRXW (or precursors). It suggests 
also that the primary site of transcription 
is within the Hindlll A fragment and 
that any niRX^A precursor, if one exists, 
can not be longer at its 5' end than 
mature mRXA within the limit of ex- 
perimental error (less than 1 kb, which 
is about 6% of mature mRXA length). 
The RXA hybridized to the Hindlll A 
fragment was recovered and digested 
with RXase Ti, and the capped structure 
was analyzed on a DEAE-Sephadex col- 
umn. There is only one component having 
about a — 8 charge, which is quite simi- 
lar to the charge of the major capped 



200 



150 



100 



50 




50 




50 



• 1 11 

A B CD 




If* it'^0_^^te 



:ft^ 



• • ■^ 



"*■•••■'• 



-fil^ 



8 

c m 



12 



16 



Fi^. 51. Hybridization of Hindlll fragments of pFblO, pFb25, and pFblO with ^H-mRNA 
capped in vitro by the vaccinia enzymes. 10 Mg each of pFblQ, pFb25, and pFhlO were digested 
with Hindlll, elect^opho^esed, transferred to a Millipore filter, and hybridized with ^H-mRNA 
which had been capped in vitro by the vaccinia enzymes (a generous gift from B. Moss). The 
electrophoresis pattern was shown schematically above the radioactivity profile in each panel. 
C — • — ), cts/min. 



DEPARTMENT OF EMBRYOLOGY 75 

structure of the input mRNA and that of terminal portion of the fibroin DNA 

in vivo capped mRNA. because this region is likely to be in- 

In order to determine whether or not volved in the control of transcription, 

the initiation of chromatin transcription Nucleotide sequence analysis of DNA 

in vitro is faithful, we will compare the requires a pure preparation of specific 

5' end sequence of the mature mRNA DNA fragments. Fibroin DNA with 5' 

and the in vitro capped mRNA, localize flanking has provided a source for large 

the site of transcription origin, and se- amounts of pure DNA fragments that 

quence the surrounding region. are amenable to sequencing. 

A detailed restriction enzyme map 

near the 5' end of the Hindlll site of 

Sequencing of a Presumed Regulatory pp^^g ^^n ^^ constructed, and appro- 

Region of the Fibroin Gene priate restriction fragments sequenced. 

Y.Tsujimoto,Y.Ohshim.a, and Y.Suzuki ^e also plan sequencing analysis into 

the supposed spacer region as well as the 
We are interested in the nucleotide 3' end of the gene and its flanking 
sequence of the region adjacent to the 5' sequence. 



RIBOSOMAL DNA AND RELATED SEQUENCES IN 

Drosophila melanogaster 

I. B. Dawid 

In Year Book 75, pp. 30-36, we re- Studies of Cloned rDNA Repeats 
ported the isolation and characterization 

of ribosomal DNA (rDNA) from D. I.B.Daimdincollahorationwith 

I i\. W bIlcluct 

melanogaster. This DNA is composed of ^-^^ ^j^^ assistance of M. Rebhert 

repeating units that occur in two basic 

structures. One is similar to the rDNA Purified or enriched rDNA was di- 

unit of Xenopus: It has a region that gested with the restriction endonuclease 

codes for the ribosomal RNA precursor ^coRI, and the fragments were attached 

and a spacer that separates this region to the vector pMB9. The recombinant 

from the next coding segment. About DNA was introduced into E. coli, and 

two thirds of the repeats differ from the clones containing the ribosomal DNA 

first class. A DNA sequence which does were selected by techniques similar to 

not code for rDNA is inserted in the 2SS those described in Year Book 74, p. 20. 

genes of these repeats. The functional Most rDNA repeats have a single EcoRl 

implications of this insertion sequence site, and therefore most EcoHl fragments 

are not known. We have shown that in- of rDNA are full repeating units. We 

sertion sequences occur in different size obtained a number of clones containing 

classes with a predominant size of 5 full rDNA repeats. In addition, there 

kilobases (kb). In the past year, we have are repeats of rDNA that have a second 

analyzed the structure of rDNA repeat- ^coRI site within the insertion in the 

ing units in more detail, using recom- 28»S RNA gene. Consequently, some frag- 

binant DNA technology, and we have ments produced by Eco^l are '4ialf- 

studied sequences homologous to the repeats." We have isolated four recom- 

ribosomal insertion in other parts of the binant plasmid molecules that contain 
Drosophila genome. The results of these 

studies show that the ribosomal locus in ^g^^.^^^ 1^^^^^^^^^ ^^^ Experimental Cancer 

Drosophila is exceedingly complex. Research, Lausanne. 



76 



CARNEGIE INSTITUTION 



TABLE 7. Summan' of Properties of Cloned rDXA Fragments from Drosophila melanogaster 



Class 



Number oi 
Clones 



Size of rDXA 
Fragments* 



Insertion 
Size 



Restriction Sites 
in Insertion 



I 
II 

in 

IV 
V 



2 
5 
9 
4 



lo.o-l" 
II -12 
11 -12 
11 -12 
4.3- 7.4 



5 Smal{2),Bam'Rl{2) 

1.0 BamBl (2) 

0.5 Bamm (1) 

None 
Eco^l site in insertion giving 
lialf-repeats. No Sma or Bayn site. 



* All sizes are given in kilobase pairs (kb). 



approximatoly half of a repeating unit 
of rDXA (Table 7 and Fig. 52). 

To characterize these repeating units, 
we carried out some restriction mapping 
and a series of hybridization experi- 
ments with cloned rDNA's. A restriction 
map for one rDXA repeat containing a 
long insertion is shown in Fig. 53. Several 
other clones with short insertions or no 
insertions were also mapped. Table 7 
summarizes the major features of these 



other clones. Some clones lacked any 
insertion in the 28*S gene. These clones 
have no sites for the endonuclease 
/)a//?HI. They also lack those sites for 
Smal which are present in the insertion 
(Fig. 53). The sites in the other parts 
of the molecule, the transcribed regions 
and the spacer region, are at analogous 
positions in rei)eats with and without in- 
sertions. Several clones contained inser- 
tions of 0.5 kb, as determined by electron 




Fig. 52. Gel f'leftrophorosis of rlonrd Drosophila rDNA after digestion with EcoTlJ. The first 
lane in r-ach panel contains marker fragments obtained by digestion with nirullll of i)hag(^ 
X DNA. The othor lanes are recombinant elonos, racli containing the vector pMB9 (arrow) 
and a fragment of rDXA. Some recombinant clones contain sev(>ral fragments of DNA. Tlu> 
positions of the major EcoKl fragments of Drosophila rDNA are indicated at 11 and 16 kb. 



DEPARTMENT OF EMBRYOLOGY 



77 



18S 




15 KB 



Fig. 53. Map of the cloned rDNA fragment 
Dmra56. The ends of the niole(;ule coric^spond 
to EcoHl sites that were used in cloning tlK> 
fragment. Smal (arrows) and BamHl (arrow- 
heads) sites are shown below, and Ifitidlll 
(arrows) and Haclll (arrowheads) sites are 
shown above. All Smal, BamHI, and Hindlll 
sites are shown but the Haelll ma]) is incom- 
plete. There are no additional Hnelll sites be- 
tween the two Haelll sites shown so that a 
large fragment containing the spacer may be 
obtained. There are many Haelll sites else- 
where in the DNA which have not been 
mapped. The Smal D fragment extends from 
4.3 to 6.6 kb; the Hindlll B fragment is from 
4 to 9 kb. 



microscopy. These insertions also con- 
tained a single BamUl site in the in- 
sertion. For further characterization of 
the .relations of different insertions we 
used restriction fragments derived from 
the clone Dmra56 (Fig. 53) and hy- 
bridized these fragments with the other 
rDNA clones. In particular, we used the 
Sma D fragment and the BamUl frag- 
ment. Clones with 0.5-kb insertions and 
a single Bam site hybridized well with 
the BainUl fragment of Dmra56 but did 
not hybridize with the Sma D fragment, 
nor did they hybridize with the long 
insertion fragment that is derived from a 
Hindlll-Bam double digest and goes 
from 4.0 to 8.0 kb on the map of Fig. 53. 
Therefore, we conclude that clones with 
0.5-kb insertions contain insertion se- 
quences homologous to the rightmost 
500 base pairs of Dmra56. Two other 
clones contained 1.0-kb insertions. These 
clones had two BamUl sites and hy- 
bridized with the BamUl fragment of 
Dmra56 but not with the Sma D frag- 
ment. The Sma D fragment is not homol- 
ogous to the BamUl insertion fragment 
of Dmra56. In addition to Dmra56, we 
obtained two other clones with long in- 
sertions (5 kb). These clones are entirely 
homologous in structure to Dmra56. 



We did not obtain any recombinant 
clones with insertions of intermediate 
length (2-4 kb). The reason for this can 
I)robably be found in fragments which 
contain only about half of a ref)eating 
unit. Four such clones were obtained 
(Table 7). From an analysis of rDNA 
from the Y chromosome (see l)elow) we 
infer that most insertion sequence's of 
intermediate size contain an Ecolll site. 
Such insertion repeats are likely to have 
given rise to the four clones listed at the 
bottom of Ta})lc 7. The most intriguing 
aspect of the structure of these clones 
with incomplete repeats is the apparent 
absence of homology with any part of 
the insertion sequence of Dmra56. All 
four "half-repeat" rDNA clones were 
hybridized with labeled fragments de- 
rived from all parts of the insertion of 
Dmra56, and no significant hybridization 
was observed. We have not yet carried 
out this hybridization at different cri- 
teria, but it is clear that homology 
between the 5-kb insertion and the inter- 
mediate-size EcoTll restrictable insertions 
is either low or absent. In contrast the 
short insertions of 0.5 and 1 kb are ho- 
mologous to the right-hand side of the 
5-kb insertions. These experiments sug- 
gest that there are two different classes 
of insertions in Drosophila rDNA: in- 
sertions with and insertions without an 
EcoRl site. These two classes appear to 
})e nonhomologous. The class without an 
Ecolll site, and probably the other class 
as well, occurs in different lengths. 

RiBosoMAL DNA Insertions in the 

Y Chromosome Nucleolus Organizer 

OF Drosophila 

I. B. Dawid in collaboration with K. D. Tartof* 
andP.K. Wellauerf 

We reported earlier (Year Book 75, 
p. 36) that rDNA repeats with the char- 
acteristic 5-kb insertion are present in 

* Cancer Research Institute. Philadelphia. 
t Swiss Institute for Experimental Cancer Re- 
search, Lausanne. 



78 



CARNEGIE INSTITUTION 



the nucleolus organizer on the X chromo- 
some but absent or very rare on the Y 
chromosome. These observations were 
based on gel electrophoresis of DNA 
digested with EroRI. In the EcoTil prod- 
ucts derived from the Y chromosome, we 
did observe smaller bands of rDNA 
which were shorter than a single repeat- 
ing unit. In view of the presence of 
f'roRI sites in some insertions it seems 
possible that these smaller fragments 
seen in rDNA from the Y chromosome 
could be due to repeats with intermediate- 
size insertions. This is, in fact, the case. 

DXA was isolated from flies that carry 
the scute 4 scute 8 inversion on the X 
chromosome and thus derive all their 
rDXA from the Y chromosome. The 
rDXA was partially purified and then 
analyzed by electron microscopy after 
hybridization with rDXA. In this experi- 
ment. 169c of all repeating units were 
found to contain an insertion in the 28*S 
gene. This insertion was at the same 
location as the insertions in total rDNA 
from wild-type flies analyzed earlier. 
However, the size distribution of these 
insertions was different from those in 
total Drosophila DNA: Most insertions 
had an intermediate size between 2 and 
4 kb, and few 5-kb insertions were found. 
This result means that rDXA on the Y 
chromosome does carry insertions but 
that these insertions have a different size 
distribution than the insertions on the X 
chromosome. Furthermore, the absence 
of EroVvl fragments longer than the con- 
tinuous repeating unit of about 11 kb 
from Y rDXA is explained if we assume 
that all or most of the insertions on the 
Y chromosome have an extra EcoTil site. 
This assumption is in good agreement 
with the results of the cloning experiment 
reported above. In fact, two of the four 
clones with "half-repeats" were derived 
from rDN^A from the Y chromosome. 

We also studied the sequence homology 
of the spacer region in rDNA derived 
from the X or Y chromosome. A spacer 
region, distinct from the insertion, is 
present in every repeat of rDNA. Re- 



sults from both heteroduplex molecules 
analyzed by electron microscopy and 
hybridization experiments with radio- 
actively labeled spacer sequences sug- 
gest that the spacers on X and Y rDNA 
are homologous and form stable duplexes. 
The precise degree of homology has not 
yet been investigated in sufficient detail 
to allow us to say whether or not signifi- 
cant mismatching occurs. It is clear, 
however, that rDNA spacers on the two 
chromosomes are closely related. 

In the experiments described so far, 
the ribosomal locus in Drosophila is 
viewed as a highly complex set of se- 
quences. While the transcribed region 
appears to be conserved in all repeating 
units, the spacers vary in length and, 
in addition, a large fraction of the genes 
for 28*S RNA have an insertion. Inser- 
tions occur in two distinct sequence 
types: One is limited to the X chromo- 
some, while the other appears to occur 
on both the X and Y chromosome. Both 
sequence classes of insertions occur in 
different size classes. While it is possible 
that internally repetitious regions occur 
within the insertion it is clear that a 5-kb 
insertion is not composed entirely of re- 
peated sequences. The evolutionary rea- 
sons for this complexity, and its func- 
tional implications, are not clear at 
present. 



Sequences Homologous to Ribosomal 

Insertions Occur Elsewhere in the 

Drosophila Genome 

7. B. Dawid and P. Botchan 
with the assistance of M. Rebbert 

We wondered how insertion sequences 
came to be present within the ribosomal 
genes. If at some point sequences that 
were present elsewhere did become in- 
serted into the ribosomal genes, it would 
be conceivable that similar sequences 
were also inserted into other locations of 
the Drosophila genome. Therefore we 
tested for the presence of homologous 
sequences at extraribosomal sites. For 



DEPARTMENT OF EMBRYOLOGY 



79 



this purpose wc used restriction frag- 
ments composed entirely of rihosomal 
insertion sequences and derived from the 
cloned rDNA fragment Dmra56 (Fig. 
53) . The Sma D fragment and the BamHI 
fragment, which represent different non- 
homologous parts of the insertion, were 
used as probes after being labeled with 
^^P by the nick translation method. 

We found that non-rDNA insertion 
DNA does occur in the Drosophila 
genome and that this DNA could be 
separated from rDNA in several types 
of density gradients. In Fig. 54 total 
DNA from Drosophila embryos was 
banded in a cesium chloride gradient 
containing actinomycin D. Aliquots of 
each fraction were hybridized with rRNA 
to locate the rDNA, and with ^^p-labeled 
Smal D fragment or ^^F-BamUl frag- 




E 




Q. 


b 


a 


Q. 




U 






t— t 


„ 


CM 


CL 




CJ 




to 



10 20 

Fraction Number 

Fig. 54. Total DNA from Drosophila em- 
bryos was centrifuged to equilibrium in a gra- 
dient of CsCl containing actinomycin D. A 
small amount of ^T-labeled Smal D fragment 
from pDmra56 (Fig. 53) was added to the 
gradient at the outset. Its position is shown by 
closed triangles (right-hand scale), and marks 
the density of pure insertion sequences. Ultra- 
violet absorbance, marking the position of 
main-band DNA, is shown as a thin Hne. Small 
samples of each fraction were hybridized with 
^^-rRNA (•-•), ''F-Smal D fragment 
(O-O), or 'T-BamHI fragment (A-A) of 
pDmra56. Hybridization with these fragments 
locates insertion sequences in the gradient. 



ment of Dmra56 (compare Fig. 53j. The 
rDNA bands on the dense side of the 
main band and hybridizes with the Sma 
and Bam fragments. Other DNA com- 
ponents that are homologous: to insertion 
sequences band on the low density side 
of the gradient. 

In this experiment, we added at the 
outset a small amount of labeled Sw.a D 
fragment of Dmra56 to mark the position 
of pure insertion sequences in the gradi- 
ent. The pure Sma D banded at low den- 
sity, even lower than most of the non- 
rDNA components that hybridized with 
the insertion probes. The best interpre- 
tation of this result, supported by addi- 
tional data not discussed here, is that 
blocks of insertion sequences are linked 
to DNA of different base composition in 
the non-rDNA insertion DNA compon- 
ents. Pure insertion has a nucleotide 
composition quite different from that of 
the main-band DNA of Drosophila; its 
GC content is close to 55% while main- 
band DNA has 40% GC. 

Figure 55 shows a similar gradient in 
CsCl containing the dye Hoechst 33258. 
Here the rDNA is on the low density 
side of the gradient, again separated 
from DNA components that hybridize 
with the insertion probes. Pure insertion 
sequences, here marked with the Bam 
fragment of pDmra56, band at a higher 
density than most non-rDNA insertion 
DNA components from Drosophila. 

Gradients like those shown in Figs. 54 
and 55 could be used to separate non- 
rDNA insertion DNA from rDNA and 
to enrich it with respect to main band. 
Such purified DNA was analyzed with 
several restriction endonucleases. For 
this purpose, the DNA was digested, 
separated on agarose gels, and trans- 
ferred to membrane filters by Southern's 
method. Fragments were then hybridized 
with different probes. Figure 56 shows 
the results of such an experiment after 
digestion of the DNA with BainHl. 
When total embryo DNA was digested 
to locate the rDNA, we obtained the 
picture shown in lane a. Since only the 



so 



CARNEGIE INSTITUTION 



2 - 



lO 



E 

Q. 
U 



Q. 
CM 
lO 



Bam 

1 


rRNA 
MB.,, 






■ 


i fl 


c^ 


' P' 





- 8 



- 6 



- 4 



- 2 



E 
u 



CM 

ro 



10 20 30 

Fraction Number 

Fig. 55. Drosophilu embryo DNA was banded 
in CsCl containing the dye Hoechst 33258. 
Labeled BamUl fragment from pDmra56 was 
added as a density marker (closed triangles 
righthand scale). The positions of main-band 
DXA (M.B.) and of rDNA (visuahzed by 
hybridization with rRNA) are indicated by 
arrows. Aliquots of the fractions were hy- 
bridized with ^'F-Smal D fragment (open 
circles), or ^'F-BamHl fragment (open tri- 
angles) . 



insertion has a Bam site, most rDNA 
molecules are not cut into distinct frag- 
ments but give rise to a smear of high 
molecular ^veight products. Hybridiza- 
tion of the same digest with insertion 
probes (lanes b,h,i) resulted not only in 
this smear produced by the rDNA but 
also in a number of sharp fragments. 
With purified non-rDNA insertion DNA 
we obtain only distinct, sharp bands 
f lanes c-g, j-l). Many fragments are 
produced in different sizes (^20-1 kb). 
The fragments hybridize with insertion 
probes to very different degrees, which 
suggests that some occur rarely, perhaps 
only once per genome, while others occur 
manv times. 



Digestion of non-rDNA insertion DNA 
with three other restriction enzymes, 
£^coRI, Hindlll, and Stnal, and hybridi- 
zation of the resulting fragments with 
the same insertion probes led to basically 
comparable patterns. While the actual 
distribution of fragments was different 
in all cases, many different fragments 
occurred, and there was no resemblance 
to the pattern produced from rDNA by 
the same restriction endonucleases. 

The result shown in Fig. 56 and also 
obtained with the other restriction endo- 
nucleases demonstrated that very similar 
fragments were obtained from non-rDNA 
insertion DNA derived from embryos, 
pupae, or adult Drosophila. Furthermore, 
three different methods of purification 
led to the same restriction patterns. The 
patterns, as visualized by the Sma D 
or the BamUl insertion probes, were 
quite similar in the high molecular 
weight range but differed among smaller 
fragments. 

We interpret these results to mean that 
sequences closely related to the ribo- 
somal insertion appear in other regions 
of the Drosophila genome. There are 
about equal amounts of non-rDNA and 
rDNA insertion sequences in the genome. 
The amount outside the ribosomal locus 
corresponds to about 400 kb of sequence, 
or 0.2% of the genome. Several indica- 
tions suggest that non-rDNA insertion 
sequences are in blocks that may have 
sizes similar to the ribosomal insertions: 
from perhaps as little as a few hundred 
base pairs up to 5 and possibly as long 
as 10 kb. These insertion sequences are 
linked to DNA of different base composi- 
tion; its nature is unknown except that 
it is very likely that these insertion- 
linked DNA components are diverse 
types of sequences. Non-rDNA insertion 
DNA occurs in different stages of the 
Drosophila life cycle, and there is no 
major change and perhaps no change at 
all in the abundance and distribution of 
this DNA in the different stages. 



DEPARTMENT OF EMBRYOLOGY 



81 



abcdefgh ij k I 



o- 





0.9 



Fig. 56. Restriction patterns of Drosophila DNA after digestion with BamJU.. Lanes a-h 
were run on one gel slab, i-l on another; the proper line-up is indicated between lanes h and 
i. Hybridization was with ^^^I-rRNA (a), ^^P-BamHI fragment (b-g), and ^-F-Smal fragment 
(h-l). We used total DNA from embryos (a, h, i) or adults (b) ; or non-rDNA insertion DXA 
from embryos (c, d, j, k), from pupae (e, /), or from adults {g, I). Purification was done in 
gradients containing Hoechst (c, e, k), actinomycin D (/, g, I), or mercury (d, j). 



82 



CARNEGIE INSTITUTION 



BIOGENESIS OF MITOCHONDRIA 

Igor B. Dawid, E. A. Godicin. and J . L. Ramirez 
u-ith the technical assistance of M . L. Rebberl 



Our interest in this area has been 
focused on the mapping of the mitochon- 
drial genome of Xenopus laevis. The prod- 
ucts of mitochondrial DNA (mtDNA) 
in animal cells include two specific 
rRNA's and a set of tRNA's. The sites 
on the heavy (H) strand that code for 
these gene products have been mapped 
previously {Year Book 75, pp. 45-49). 
In the past year, we mapped the sites 
that code for mitochondrial 4S RNA on 
the light (L) strand of mtDNA. We 
initiated experiments to characterize 
l)oly(Ai containing mitochondrial RNA 



molecules, from ovaries of X. laevis. Such 
molecules occur in mitochondria and are 
probably messenger RNA's for mito- 
chondrially synthesized proteins. 

]\L\ppiNG OF 4<S RNA Genes in 
X. Laevis mtDNA 

./, L. Ramirez 

In Year Book 75, pp. 48 and 49, we 
described the mapping of the 4»S RNA 
genes on the H strand of X. laevis 
mtDNA. Sites on the L strand have now 
been mapped, using an EcoKi fragment 







Fig. 57. Eloctron micrograph of tlio L strand of tho largo EcoKi fragment of X . lacim 
mtDNA carrying three complexes })etween 4S RNA and ferritin. A fragment ])ro(hi('ecl from 
mtDNA by digestion with II pall was used as a marker of orientation; hybridization with this 
marker produced the duplex region at the left of the molcHuiie as indicated by a heavy line 
on the tracing. The ferritin closest to the marker is at position LI ; the other two ferritins are 
at po.sitions considered tentative (see text and Fig. 59). 



DEPARTMENT OF EMBRYOLOGY 



83 




40 
Percent of 



60 
Genome 



EcoR l 



100 



Fig. 58. Histogram of ferritin^S RNA sites on the L strand of X. laevis mtDNA. The map 
begins at the EcoHl site closest to the ribosomal gene region (see Year Book 75, p. 47). The 
six sites are indicated by large arrows; four sites considered tentative are shown by small 
arrows. The duplex formed by the Hpall fragment used as a marker is shown as an open 
region in the histogram. 



that represents 87% of the mitochondrial 
genome (see Year Book 75, p. 47). This 
DNA fragment was cloned in E. coli 
cells. Because the ribonucleotides in 
mtDNA are eliminated by the cloning 
procedure, the DNA is stable in alkali, 
and so it is possible to separate its 
strands in alkaline CsCl gradients 

The 45 RNA's from X. laevis ovarian 
mitochondria were labeled with ferritin 
as described in Year Book 75; the con- 
ditions for hybridization were also the 
same. Excess ferritin was removed by 
chromatography on a small hydroxylapa- 
tite column equilibrated in 0.15 M Na 
PO4 buffer, pH 7. Under these conditions, 
ferritin elutes in the void volume, while 
the DNA-45 RNA hybrids are retained 
and eluted later with a solution of 0.5 
M NaCl, 0.5 M NaP04, pH 7. 

Electron-microscope analysis of the 
hybrid molecules (Fig. 57) gave the 
histogram shown in Fig. 58. Six sites have 
been unambiguously defined on the basis 
of their position relative to the marker 
(Hpall fragment). Four other sites are 
indicated that probably code for 4*S RNA. 

Figure 59 summarizes the results of 
the 45 RNA mapping experiment. The 
two strands were aligned using markers 



(see Fig. 58, legend). The H strand map 
is from Year Book 75, p. 49. The total 
number of 4*S RNA sites on mtDNA is 
between 21 and 25, close to the number 




H9 H! 



Fig. 59. Map of iS RNA sites in Xenopus 
laevis mtDNA. The ribosomal genes on the H 
strand are shown as heavy bars; the antiribo- 
somal regions on the L strand are sho'WTi as 
open bars. Closed circles are positively identi- 
fied 4^ RNA sites; open circles are tentative 
sites. The H strand map is taken from Year 
Book 75, p. 49. 



S4 CARNEGIE INSTITUTION 

required for an independent set of mito- by Angerer et al. {Cell 9, 81, 1976). 
chondrial tRNA's. There are no long regions of DNA with- 
The nearly uniform distribution of 4*S out a 4S RNA site on one strand or the 
RNA sites over the mtDXA is empha- other. It remains to be seen whether the 
sized even more strongly when both other products of mtDNA (presumed 
strands are considered. This wide distri- mRNA's) can be fitted between the 4^S 
bution of 4S RNA sites is similar to the RNA genes or whether overlapping cod- 
distribution found for HeLa cell mtDNA ing regions occur in this DNA. 



RIBOSOMAL GENES AND THEIR PROTEINS 

Ronald H. Reeder, Peter Botchan, Harvey Wahn, 

Robert Hipskiiid, and Barbara Sollner-Webb 

with the assistance of Eileen Hogan 

For several years our group has fo- structure, they are clearly distinct from 
cused its attention on the genes that code each other. These studies have also shown 
for the 18S and 28S rRNA's in the frog that there is a sharp boundary close to 
Xenopus. Our immediate goal is to pro- the 5' end of the 405 sequence. Se- 
vide a complete molecular description of quences within the transcribed region are 
these genes, both of the DNA sequence strongly conserved, while sequences out- 
itself and of the proteins that interact side (in the spacer) vary even within a 
with it in vivo. Determination of the species. If it is reasonable to assume 
sequence organization of rDNA has been that promoter sequences are conserved, 
greatly aided by recent advances in DNA then this conserved-nonconserved bound- 
technology. With the methods of re- ary should help define the location of 
striction enzymology, molecular cloning, the promotor. 

and rapid nucleotide sequencing now As another approach to locating pro- 
available, it is becoming routine to estab- moter sequences, we used an enzyme 
lish the primary sequence of DNA mole- complex from Vaccinia virus which puts 
cules. It is still a major challenge, how- radioactive ''caps" on 5' diphosphate or 
ever, to determine where the various con- triphosphate termini of RNA molecules, 
trol elements are located within a DNA On the assumption that such termini are 
sequence, especially when a single gene the residue of chain initiation starts by 
plus spacer contains over 10,000 base RNA polymerase, we have capped nucleo- 
pairs, as in Xenopus rDNA. Rather than lar RNA and mapped regions in the 
blindly sequencing this large repeat, we rDNA that code for the capped termini, 
have spent considerable effort in pre- The results so far indicate that 85% of 
liminary mapping to determine where all chain initiations on rDNA begin at 
important control sequences are most or near the 5' end of the 40>S sequence, 
likely to be found. The capping procedure has also allowed 

Part of this work continues the re- us to begin sequencing the 5' end of the 

striction mapping of the nontranscribed 40*S molecule for later comparison with 

spacer that was begun last year. In cor- the underlying DNA sequence, 

roboration of earlier heteroduplex studies, A third approach, in collaboration with 

the restriction work has accurately de- Dr. Robert Benbow at Johns Hopkins, 

fined the boundaries of the two regions has been used to search for possible ori- 

of simple-sequence repetitive elements in gins of DNA replication in the rDNA 

the spacer and shown in addition that repeat. Chimeric plasmids containing 

while the two regions are related in various regions of the rDNA repeat have 



DEPARTMENT OF EMBRYOLOGY 85 

been observed to replicate in an in vitro peated sequences and thus resembles 
system developed by Dr. Benbow, but simple-sequence satellite DNA's. Super- 
it is too early to say whether replication imposed on short repeating sequences are 
is initiating at the correct site. All of levels of higher order repeating elements, 
these studies have paved the way for Restriction endonucleases that have 
sequencing selected portions of the rDNA, many sites in the spacers (such as HaeWl 
which will be done during the coming and Hpall) digest most parts of the 
year. spacer of all four clones into a similar 
Determination of the proteins that in- set of repetitive fragments. Most of these 
teract with the rDNA is as important as fragments have sizes that are multiples 
determination of the primary sequence, of about 15 bp; this leads us to believe 
It is now possible to catalogue the rDNA- that the spacer comes from an ancestral 
associated proteins, using the method 15-bp unit. 

reported last year for isolating amplified Figure 60 summarizes our present view 
oocyte nucleoli that contain rDNA but of the structure of a typical spacer. Re- 
no bulk chromosomal DNA. Efforts this striction enzymes that recognize few 
year have been directed toward improv- sites (such as BamHl and Smal) allow 
ing the isolation procedure and over- the conclusion that the spacers are sub- 
coming the effect of an endogenous pro- divided into three distinguishable regions, 
tease that contaminates nucleoli. Region A is immediately adjacent to the 
Antibodies directed against specific 28^ end of the gene near the transcrip- 
chromatin proteins promise to become tion termination site, is 500 bp long, and 
useful tools for studying the distribution is conserved among the four clones exam- 
of various proteins on ribosomal gene ined. Adjacent to it is Region B, which 
chromatin. As a step in developing these has multiple sites for Smal. Region B 
tools we have collaborated with Dr. varies in length from 1(X)0 to 1200 bp 
Michael Bustin (NIH) and Mr. Steven among the four clones. The remnant, 
McKnight (graduate student with Dr. region D, has few Stnal sites and varies 
Oscar Miller, Jr., University of Virginia) from 890 to 3800 bp in length. In long 
in comparing the immunological related- spacers, region D has a higher order re- 
ness of calf thymus and Drosophila his- peating unit (as recognized by BamUl 
tones. In the following pages, each of and Smal). Although regions B and D 
these projects is described in more detail, may have arisen from the same ancestral 

15-bp repeat, the sequences in these re- 
gions have since diverged because of an 

Structure OF THE NoNTRANSCRiBED apparent barrier at the B-D boundarv. 

Spacers between Ribosomal Genes ^e are trying to find out whether the 

Peter Botchan ribosomal spacer shares any homology 

with nonribosomal DNA. In particular. 

We have continued our study of se- we want to know whether the ribosomal 

quence organization in the nontranscribed spacer, which is itself a middle-repetitive 

spacer regions of four cloned fragments sequence, is related to some family of 

of Xenopus laevis ribosomal DNA. Each highly reiterated sequences. Or, are 

of the clones we are using contains a spacer-like sequences located anywhere 

spacer of different length, and we have at all outside of the ribosomal gene 

mapped the distribution of cleavage sites cluster. This question has some bearing 

for several restriction endonucleases in on the theories which suggest that middle- 

these spacers. Some of our findings and repetitive sequences have some role in 

techniques were reported in Year Book coordinate gene expression. To search for 

75 (p. 20). We now conclude that much such homologies, we fractionated red 

of each spacer is composed of highly re- blood cell DNA derived from single frogs 



86 



CARNEGIE INSTITUTION 



Xlrl4 



RI Hindin 



RI 



28S A B C D 


«<— Tsp + I8S — 


► 


500^^ 900 800 3380 


2530 










2120 750 660 660 660 


3400 











1000 



Conserved Region 



Fig. 60. Summan' of structural data for a cloned spacer from X. laevis rDNA. These maps 
summarize data from previous heteroduplex mapping (Year Book 73) and from BarnRl and 
Smal restriction analysis reported this year. The EM heteroduplex map has been redrawn with 
the following modifications: (1) The amount of 285 on the left has been reduced to 500 bp. The 
Hindlll site is within 50 bp of the transcription termination site (details not shown). (2) 
Region X in Xlrl4 (a region of about 350 bp just to the left of the 5' end of the gene) has 
been included in region D. All known BamHl and Smal sites are represented, except the Smal 
sites within the 1000-bp region that coincides with region B. Sites in this region are too finely 
spaced to draw accurately. Molecular weights are in bp. 



by equilibrium density centrifugation in 
CsCl. Each fraction from the gradient 
was then cleaved with EcoRl endo- 
nuclease and electrophoresed on an 
agarose gel, and the separated fragments 
were transferred to a nitrocellulose filter, 
using Southern's procedure. The filter- 
immobilized DXA was then hybridized 
with a highly radioactive probe DNA to 
locate rDXA sequences. The probe we 
used was a cloned EcoRl spacer frag- 
ment that contains all of the non- 
transcribed spacer plus some gene se- 
quences on each end. It lacks the 
sequences contained in the EcoRl frag- 
ment from the middle of the gene. This 
spacer-containing fragment was labeled 
to high specific activity (10^-5 X 10''' 
cts/min//Ag) by nick translation and is 
able to detect sequences present at 1 
copy per genome. The results of a typical 
experiment are shown in Fig. 61. Most 
of the rDNA fragments that hybridize 
with the radioactive probe are associated 
with the peak of rDNA on the high- 
density side of the gradient. We conclude 
that these fragments are components of 
the main rDNA locus. Three other frag- 



ments can be seen (A, B, and C) which 
behave as though they are linked to 
DNA of a density lower than that of 
rDNA. Fragments B and C are present 
about once per genome and band sharply 
on the heavy side of the main-band 
DNA. Fragment A is present about five 
times per genome and bands broadly 
between the rDNA and main-band DNA. 
Other experiments have shown that frag- 
ments A, B, and C do not hybridize with 
pure spacer sequences. Therefore, the 
hybridization seen in Fig. 61 is presum- 
ably due to the 18aS and 28*S gene se- 
quences on the ends of the EcoRl spacer 
fragment used as a probe. We have not 
yet found any rDNA spacer sequences 
outside the main rDNA locus. We tenta- 
tively estimate that if such DNA does 
exist, it would have to be present in 
contiguous lengths of less than 500 bp. 
This contrasts with the situation seen in 
Drosophila rDNA (see Dawid's report, 
this Year Book). Fragments of the same 
size and density as A, B, and C have 
been observed in four different frogs. In 
view of the considerable variation in 
length seen in the rest of the rDNA re- 



DEPARTMENT OF EMBRYOLOGY 



87 




2 



Fig. 61. EcoRl restriction analysis of buoyant density fractionated rDNA from X. laevis. 
Bulk DNA from erythrocytes of X. laevis was banded in a CsCl density gradient, and DXA 
from each fraction was digested with EcoHl endonuclease. Each digest was electrophoresed on 
a 1% agarose gel, and the DNA fragments were transferred to a nitrocellulose filter using 
Southern's procedure. The filter was then hybridized with a radioactive probe made by nick- 
translating a cloned EcoKL spacer containing fragment (Xlrl2, sp. act. -—'10' cts/min//ig). 
Arrows indicate the positions of rDNA and main-band DNA in the gradient, a, h, and c are 
hybridizing fragments whose buoyant density position does not correspond to that of the 
main rDNA locus. 



peats, we speculate that these conserved 
rDNA sequences may have some unique 
developmental or evolutionary role. 

In vivo Sites of RNA Chain 
Initiation on rDNA 

Ronald H. Reeder, Barbara Sollner-W ebb , 
and Harvey Wahn 

The size of the primary transcription 
product is still unknown for most eukary- 
otic genes that have been studied. Only 
in the case of the 5S RNA from ribo- 
somes has it been possible to demonstrate 
a triphosphate terminus on the 5' end 
of the RNA and therefore to pinpoint 
the site of chain initiation. In all other 
cases, the approach has been to isolate 



the largest RNA that can be detected 
after brief labeling and assume that is 
the primary transcript. Experience with 
prokaryotes has shown, however, that 
processing may occur so rapidly for 
some genes that under normal circum- 
stances the primary transcript never 
appears intact and the earliest discernible 
products may already be processed in- 
termediates. 

When cells of Xenopus laevis are 
labeled with RNA precursors, the first 
distinct transcription product that arises 
from the rDNA is a molecule of 2.7 X 
10^, the so-called 40S rRNA precursor. 
Through a series of known processing 
steps this precursor then gives rise to 
the 18S and 28iS rRNA's found in cyto- 



88 



CARNEGIE INSTITUTION 



plasmic ribosomes (see Year Book 73, 
p. 45V The assumption has been, there- 
fore, that transcription initiates close to 
the 5' end of the 40.S sequence. However, 
several experiments from other labora- 
tories have raised the possibility that 
transcription of the rDXA does not begin 
at the 5' end of the 405 sequence but 
somewhere else in the ''non-transcribed" 
spacer that separates 40-S regions. 

We have been using a new method to 
search for and characterize transcription 
initiation events on the rDNA of X. 
laevis. The method involves use of a 
complex of capping enzymes from Vac- 
cinia virus which catalyze the reaction 
pppG+S-adenosvl methionine -f (p)- 

ppXpYpZp ^ '^^GpppXp^^YpZp 

This enzyme was a generous gift from 
Dr. Bernard Moss at NIH; he and his 
co-workers have shown it has an absolute 
requirement for 5' diphosphate or tri- 
phosphate termini. It will not cap mono- 
phosphate or hydroxyl-terminated mole- 
cules. On the well-founded assumption 




Bottom 



Fig. 62. Size of RNA bearing diphosphate or 
triphosphate termini from nucleoli of X. laevis 
oocytes. Nucleoli were isolated from immature 
oocytes of X. laevis, dissolved in SD8, and their 
RXA fractionated on a sucrose gradient. Pooled 
fractions from the gradient were then tested for 
their relative ability to accept 5' terminal caps, 
using 'H S-adenosyl methionine as the label 
donor. 



that diphosphate or triphosphate termini 
mark the site of RNA chain initiation, 
this enzyme complex allows us to label 
selectively the 5' ends of primary 
transcripts. 

Figure 62 shows an experiment in 
which RNA from the nucleoli of Xenopus 
oocytes (see Year Book 75, p. 24, for 
isolation procedure) was fractionated on 



1000 



ro 



500- 



-2 



-4 -5 -6 -7 



I I I W I 



a) 




-2 -3 -4 -5 -6 -7 

Ml III 



RNase T 



c) 




10 20 30 40 50 

Fraction no. 

Fig. 63. Digestion of capped high molecular 
weight nucleolar RNA with various RNase. 
The HMW region of the gradient shown in 
Fig. 62 was pooled and capped using ^H S- 
adenosyl methionine as the label. The capped 
RNA was then digested with various RNase, 
and the resulting oligonucleotides were frac- 
tionated on columns of DEAE-Sepliadex (0.6 X 
25 cm, gradient 0.1 M-0.5 M NaCl in 7 M urea, 
0.01 M Tris-HCl, /^H 8). (a) RNase Pi, (b) 
RNase T., (c) RNase T,, (d) RNase A. The 
elution position of unlabeled marker oligonu- 
cleotides of known charge is indicated for each 
column profile. 



DEPARTMENT OF EMBRYOLOGY 89 

a sucrose gradient, and various fractions cuts after every base except when the 2' 
were tested for their ability to be capped, hydroxyl on the ribose is methylated. 
In this expei*iment about 22% of the 40aS This fact, coupled with the observation 
ends were able to be capped and there- that RNase A (cuts after C and U resi- 
fore had a 5' diphosphate or triphosphate dues) does not cut within the Tl frag- 
terminus. ment, allows us to deduce that the Y base 
Figure 63 shows several experiments is A. Therefore, the 5' end of the un- 
that were done to characterize the capped capped 40>S molecule begins fplppXp- 
40/S termini. In Fig. 63a the capped RNA ApGP. . . . More sequence data on the W 
was digested with RNase PI, a nuclease end of the 40*S should be obtained soon, 
that cleaves after every base, is not As further proof that we are capping 
blocked by 2'0 methylation, and leaves the 5' end of the 40*S molecule, radio- 
s' phosphate termini. Chromatography actively capped molecules were hy- 
on DEAE yielded a single peak with a bridized to restriction fragments that 
charge of about — 2.5. This charge and span the entire rDNA repeating unit, 
the specificity of the PI nuclease is con- Figure 64 gives a map of the rDNA 
sistent with a structure of ^^OpppX"". repeat showing the location of the re- 
Such a result is good evidence that all striction fragments we used. Figure 65a 
of the ^H methyl label is actually going shows that 85% of the labeled termini 
into cap structures and not into internal which hybridized to rDNA hybridized to 
sites along the RNA chain. Digestion the fragment II, the fragment which 
of capped 40*S RNA with RNase A and spans the W end of the 40*S sequence, 
subsequent DEAE chromatography (Fig. Furthermore, when RNA was recovered 
63d) yields one large peak of greater from the hybrid and digested with RNase 
than —7 charges and several smaller A, it yielded the two large oligonucleo- 
peaks. As we will show below, only the tides that were obtained from unhybrid- 
two peaks with greater than —7 charges ized 40*S RNA (compare Figs. 65b and 
come from 408 RNA; the two peaks with 63d). This result confirms that the large 
less than — 7 charges have not been majority of RNA initiation events on the 
studied further. Redigestion of the large rDNA occur at or near the W end of the 
RNase A fragment with RNase Tl yields 40*S sequence. It also suggests that the 
a single fragment with — 6.5 charges 5' end of the 405 may be heterogeneous. 
(Fig. 63c). The identical result is ob- The nature of this heterogeneity requires 
tained when intact 405 RNA is Tl- further study. 

digested. Since Tl cuts only after G About 15% of the hybridization seen 

residues, we can deduce that the struc- in Fig. 63a was associated with fragment 

ture of the Tl fragment is ^^GpppXp^- I, a fragment from the middle of the 

YpGp. Figure 63b shows that digestion 405 sequence. RNase A digestion of this 

of capped 405 with RNase T2 yields a hybrid yielded a single large oligonucleo- 

fragment with about — ^.^ charges. T2 tide of greater than — 7 charges (Fig. 

5' 40S 3' 

^ 

28S Spacer tsp I8S tsp 28S 

^— — ^■^— 4 



■^— IV-H II 1 I 1 



Fig. 64. Map of one repeating unit of X. laevis rDNA. This map shows the location of frag- 
ments I, II, III, and IV which were used for the hybridization experiment shown in Fig. 65. 
Fragments were derived from clones Xlrll and Xlrl2 using BamBl and EcoRl. 



90 



CARNEGIE INSTITUTION 



C 

E 

(/) 
o 

X 



800 



600- 




400- 



200- 



20 30 40 

Fraction no. 



c 
E 

(/) 

c3 

X 
ro 



100 - 







100 - 







-2 

t 



~3 -4 



-5 -6 -7 

i t I 



■2 -3 -4-5-6-7 
i + t tl + 



^^ • ^ *ir*^ >'•>»' 




10 20 30 40 

Fraction no. 



b) 




c) 



50 



60 



Fig. 65. Hybridization of capped nucleolar RNA to rDNA restriction fragment. ^H capped 
nucleolar RXA (HMW fraction from Fig. 62) was hybridized to restriction fragments im- 
mobilized on a nitrocellulo.se filter. The map location of the fragments is shown in Fig. 64. 
After the hybrid was trimmed with RNase A, the filter was cut in pieces and counted. Hybrid 
RNA was then removed from the filter pieces, digested with RNase A, and the labeled 
oligonucleotides fractionated on DEAE-Sephadex as described in Fig. 63. (a) Photograph of 
the agarose gel used to .separate the rDNA fragments; underneath is represented the amount 
of RNase-resistant radioactivity hybridizing to each fragment; (b) DEAE chromatography of 
RNa.se A oligonucleotides recovered from hybrid to fragment H; (c) oligonucleotides recov- 
ered from hybrid to fragment I. 

65c). The significance of this apparent ping enzymes will be useful for several 

initiation event in the middle of the other important purposes. One applica- 

gene is unknown. tion will be to sequence the 5' end of the 

In addition to locating the 5' end of 40*S RNA. After capping the RNA with 

the primary transcript, the Vaccinia cap- a-'^^P GTP, it is possible to partially 



DEPARTMENT OF EMBRYOLOGY 



91 



digest the RNA with base-specific RNase. 
Sizing the labeled oligonucleotides on 
acrylamide gels should allow rapid se- 
quencing of the 5' end. Another applica- 
tion will be to study RNA transcription 
in vitro. Since we now know the RNase 
A oligonucleotide at the 5' end of the 40S 
molecule, we should be able to cap RNA 
made in vitro and locate correct initi- 
ation events in the presence of consider- 
able incorrect initiation. Such an assay 
will be very useful in attempts to recon- 
stitute accurate transcription systems. 

DNA Replication Origins in 
Xenopus rDNA 

Ronald H. Reeder in collaboration with 
Robert Benboiv* 

Dr. Robert Benbow at Johns Hopkins 
recently developed a cell-free system 
from Xenopus eggs in which circular 
DNA molecules are observed to replicate. 
We are collaborating with him to use 
this cell-free system to locate the ori- 
gin (s) of DNA replication within the 
rDNA repeating unit. In preliminary 
experiments three types of circular mole- 
cules were tested in the system: pXlrll, 
which carries the EcoRl fragment from 
the middle of the gene region; pXlrl4, 
which carries one of the EcoKI spacer- 
containing fragments; and CoZEl, the 
plasmid vehicle for both EcoRl pieces. 
Table 8 shows the percentage of mole- 
cules of each type that were converted 
into either early or late replicating struc- 
tures C'Cairns" forms) after a standard 
incubation period. The data suggest that 
pXlrll may contain the origin of repli- 
cation. Figure 66 is an electron micro- 
graph of one of the apparent replicating 
structures seen in the pXIrll incubation. 
The structures formed from pXIrll 
were cleaved with EcoBJ, and the arms 
of the resultant branched molecules were 
measured. If we assume the molecules 
are replicating bidirectionally and that 

* Department of Biology, Johns Hopkins 
University, 



TABLE 8. Formation of Replicating Structures 

upon Incubation of Various Plasmids in 

Xenopus Ki£ii C!vtoph).'-rn 



Plasmid 



Percent B Stmcturos* 



pXIrll 
pXlrl4 
ColEl 



23 

2 




* Structures wore scored by electron micros- 
copy of 1000 molecules after a standard 4-hour 
incubation. Unincubated samples give no repli- 
cating structures. 



both forks travel at the same rate, the 
origin of replication maps to a point in 
the rDNA insert about 20% of the insert 
length from one of the ^coRI sites. This 
would put it either in the internal tran- 
scribed spacer or in the 2SS gene region. 
But if we assume replication is unidirec- 
tional (as is usually the case for CoZEl 
replicating in E. coli) , then the origin 
maps out in the ColEl vehicle. However, 
it does not map to the known location of 
the in vivo Coffil origin of replication. 
These preliminary results suggest that the 
origin may be within the transcribed gene 
region. 

In sum then, the system looks promis- 
ing and offers the hope that further work 
will enable us to definitely locate the 
origin of replication of these genes. 



RiBOSOMAL Gene Chromatin 

Harvey L. Wahn 

The extrachromosomal nucleoli from 
Xenopus oocytes can be isolated free of 
bulk DNA contaminants, using pro- 
cedures described in Year Book 75 (p. 
24). As we began to characterize the 
rDNA chromatin in these nucleoli, it 
became apparent that proteolysis was a 
problem and that further improvements 
were needed in the purification scheme. 
Previously, two consecutive Metrizamide 
buoyant density gradients were required 
to purify the nucleoli. Instead, we now 
layer the oocyte homogenate over a single 
preformed gradient. The interface is 



92 



CARNEGIE INSTITUTION 







Fig. 66. Electron micrograph of a replication structure formed from pXlrll. Circular 
molecules of pXIrll were incubated 4 hr in egg cytoplasm fractions under standard conditions. 
The DXA was then extracted and spread for microscopy. 



stirred to prevent sharp discontinuities in 
density. Nucleoli are then sedimented to 
their equilibrium position in the gradient, 
and soluble protein and less dense orga- 
nelles are left behind. This procedure not 
only yields nucleoli of high purity but 
rapidly removes them from soluble en- 
zymes that cause variable recovery of 
chromatin proteins. AVe also improved 
recoverj^ of protein by adding phenyl- 
methanyl-sulfonylfluoride to all prepara- 
tions and adding diisopropyl-phospho- 
fluoridate when polymerase activity was 
not being studied. After recovery from 
the gradient, nucleoli were centrifuged 



through 0.3 M NaCl to remove loosely 
bound protein. 

Oocyte nucleoli consist of a core re- 
gion containing the rDNA and associated 
proteins surrounded by a variable amount 
of cortex composed of RNP particles in 
various stages of processing. Previous 
experiments showed that intact nucleoli 
were heterogeneous both in buoyant den- 
sity and in RNA chain elongation ac- 
tivity in vitro (Year Book 75, p. 24). We 
have done experiments to see if this 
heterogeneity persists after removal of 
the RNP cortex. Isolated nucleoli were 
dissociated by suspending them in 10 



DEPARTMENT OF EMBRYOLOGY 



93 



mM Tris, pH 8, 1 mM EDTA and then discontinuities in density and then centri- 

layering them over a preformed Metriza- fuged to equilibrium. Fractions from the 

mide density gradient. The top of the gradient were then assayed for rDNA 

gradient was stirred to remove any sharp and endogenous RNA polymerase activ- 



2 3 4 5 



7 8 



10 



12 i3 14 15 




130 




68 



60 



- 43 



25.7 



3000 



~ 2000 

E 

m 

^ !000 



m 







* ■ujfe?. iT:rt0.rr...T»»rW- ' 




10 







? 

I 

< 

Q 

> 
o 

DC 



Fraction no. 



Fig. 67. Metrizamide buoyant density gradient of nucleolar cores. Intact oocyte nucleoli 
(isolated by a previous Metrizamide gradient) were dissociated by resuspension in 10 m3/ 
Tris pH8, 1 mM EDTA and spun to equilibrium in a second Metrizamide gradient. Aliquots 
from each fraction were assayed for endogenous RNA polymerase activity (•-•-•) and 
relative rDNA content (0--0--0), and their proteins were electrophoresed on a lO'yc 
acrylamide gel in SDS. The bottom (dense) end of the gradient is on the left. Molecular 
weights are in daltons ; arrows indicate putative RNA polymerase I subunits. 



94 



CARNEGIE INSTITUTION 



A B C 



I 4 
I 4 






3 

2b 
2a 



mm 4 



Fig. 68. Acid-extractable proteins from nu- 
cleolar cores. Fractions containing rDNA from 
the gradient in Fig. 67 were pooled, extracted 
with 0.4 .Y H2SO4, and run on a ISTc acrv'lamide 
gel in SDS. CA) acid-extractable proteins from 
cytoplasmic ribosomes; (B) acid-extractable 
proteins from nucleolar cores; (C) histones 
from cultured cells of X. laevis. 



ity, and protein from each fraction was 
electrophoresed on a 10% SDS-acryla- 
mide gel. The results are shown in Fig. 
67. About half the protein stayed at the 
top of the gradient, while the rest banded 
with the rDNA and polymerase activity. 



Polymerase activity and rDNA concen- 
tration follow each other and no signifi- 
cant heterogeneity is observed. Fraction 
5 contains three large smeary bands, 
indicated by arrows. These proteins do 
not follow the concentration of rDNA 
and most likely come from a small par- 
ticle (melanosome precursor?) that bands 
very tightly in fraction 5 and gives that 
fraction a grayish appearance. This is 
the first experiment in which we have 
been able to separate them partially 
from the rDNA. Arrows point to bands 
in fraction 7 which have the proper mo- 
lecular weight to be subunits of RNA 
polymerase I. These putative polymerase 
subunits appear most concentrated in the 
active fractions, except for fraction 5 
where the melanosome (?) proteins ob- 
scure the relevant region of the gel. 

Fractions from the active regions of a 
parallel gradient were pooled, and acid- 
extractable proteins were electrophoresed 
on a 15% acrylamide SDS gel to look 
for histones. Figure 68 shows that the 
active fraction contains acid-extractable 
proteins which electrophorese close to, 
but not exactly, with the four nucleosome 
histones from bulk chromatin. We are 
exploring the possibility that these his- 
tones may be modified. 

Our working hypothesis is that the 
density heterogeneity observed with in- 
tact nucleoli results from variations in 
the ratio of core to cortex, since removal 
of the cortex allows the DNA to band 
as a single peak. 



Immunological Cross Reaction 
BETWEEN Calf and Drosophila Histones 

Ronald H . Reeder in collaboration with 
Michael Bustin* and Steven L. McKnightf 

Histones extracted from calf thymus 
are well-characterized proteins whose 
primary sequence is known. Antibodies 

* National Institutes of Health, Bothesda, 
Maryland 20014. 

t Df>partmont of Biology, University of Vir- 
ginia, Charlottesville, Virginia 22902. 



DEPARTMENT OF EMBRYOLOGY 



95 



against calf histones are available, and 
it would be convenient if these antibodies 
could be used as universal reagents to 
study the arrangement of histones in 
chromatin from organisms other than the 
calf. To test the feasibility of this, we 
compared quantitatively the cross-reac- 
tivity between antibodies directed against 
calf histones and histones extracted from 
Drosophila. 

In parallel experiments different dilu- 
tions of antibodies against single calf 
histones were tested against Drosophila 
histones, using quantitative complement 
fixation techniques. From the comple- 
ment fixation results, an index of dissimi- 
larity was calculated for each histone 
type. The index of dissimilarity is de- 
fined as the ratio of antibody dilu- 
tion that gives 50% maximal comple- 
ment fixation with homologous protein 
to the dilution that gives 50% maximal 
complement fixation with heterologous 



protein. An index of 1 is obtained when 
the homologous and heterologous proteins 
are immunologically identical. Higher 
indexes indicate a greater and greater 
disparity between the two. Indexes of 
dissimilarity for calf and Drosophila 
histones are shown in Table 9. In several 
systems where homologous proteins have 
been compared by immunological tech- 
niques, a linear correlation exists between 
the logarithm of the index of dissimilarity 
and the percent amino acid difference of 
the proteins compared. Table 9 therefore 
also presents the percent amino acid 
differences as estimated by this method. 
With the exception of HI, which shows 
significant species specificity, all of the 
Drosophila histones gave very strong 
cross-reactions with the homologous calf 
thymus histones. The H4 histones in 
particular showed no detectable immuno- 
logical difference. This agrees with the 
fact that Drosophila H4 has the same 



TABLE 9. Comparison of Histones Extracted from Drosophila and Calf Thymus 









Percent Amino 


Percent Difference 


Serum 


Antigens 


Index of 


Acid Difference 


in Amino 


Anti-calf 


Compared 


Dissimilarity 


from I.D.t 


Acid Composition^ 


HI 


HI CT* 
HID 


16.0 


27 


30 J 


H2A 


H2ACT 
CTMIX 


1.35 


3 




H2A 


CTMIX 
D MIX 


2.0 


6 


5.0 


H2B 


H2B CT 
CT MIX 


2.0 


6 


... 


H2B 


CTMIX 
D MIX 


1.0 





9.0 


H3 


H3 
CTMIX 


1.7 


4 


... 


H3 


CTMIX 
D MIX 


1.6 


4 


2.2 


H4 


H4CT 
H4D 


1.0 









* Abbreviations : CT, calf thymus; D, Drosophila; CT MIX, artificial mixture of calf thj^mus 
histones H2A, H2B, H3; D MIX, mixture of Drosophila H2A, H2B, H3. I.D., Index of Dis- 
similarity. 

t The percent of amino acid difference is calculated by assuming that the published relation 
between I.D. and percent of amino acid difference for lysozyme is applicable for histones. 

X Taken from published data on amino acid composition. 



96 



CARNEGIE INSTITUTION 



amino acid composition as calf H4 and pected, HI cross-reacts the least. The 



the fact that H4 is the most highly con- 
served of the histones. 

Antisera against calf H2B were also 
unable to distinguish between calf and 
Drosophila H2B when both histones 
were in a mixture with H3 and H2A. 



degree of dissimilarity is in good agree- 
ment with the known amino acid differ- 
ence in HI derived from each of the two 
species. 

The results unambiguously show that 
(with the exception of HI) antisera 



Since by amino acid analysis Drosophila elicited by calf thymus histones cross- 
H2B shows about 9*^ difference from react very strongly with histones of 
calf H2B. this suggests either that the Drosophila. Since the compositional and 
amino acid differences are in immuno- electrophoretic differences between calf 
silent regions or that they are masked by and Drosophila histones are of the same 
association with H2A and H3. Some order as the differences between calf 
masking is possible because the H2B histones and a variety of histones ex- 
antibody is somewhat more reactive with tracted from other sources, it seems that 
calf H2B alone than it is with calf H2B antibodies elicited by calf thymus his- 
in a mixture. Slight masking of deter- tones would react strongly with histones 
minants due to histone complexing is regardless of origin. We suggest, there- 
also observed with H2A and H3. fore, that antibodies for calf thymus his- 
Anti-H2A recognizes a small difference tones H4, H3A, H2A, and H2B can be 
between calf and Drosophila H2A when used as ''universal" reagents to study the 
both are in mixtures. In this case the in situ state of chromatin-bound histones. 
immunological difference is almost ex- Histone HI is species specific; and so 
actly what would be expected from the for each species, specific antibodies to 
known amino acid differences. As ex- this histone have to be elicited. 



GENETICS BY GENE ISOLATION: 
THE DUAL 5S RNA GENE SYSTEM IN Xenopus 

D. D. Brown, J. Doering, N. Fedorojf, L. Kom, E. Jordan, and B. Murr 



For several years we have studied a 
simple gene system in Xenopus which 
is under developmental control. Frogs 
synthesize at least two kinds of 5S ribo- 
somal RNA. The control mechanism 
seems to be that growing oocytes express 
all types of 58 RNA genes in the genome, 
while somatic cells synthesize a single 
kind of 5.S RNA. The goal of our labora- 
tory has been to purify and fully char- 
acterize the various kinds of 5*S RNA 
genes in the genome of more than one 
species of Xenopus. We then want to 
reconstruct their transcription in vitro 
and identify the regulatory molecules 
that account for the genes' faithful tran- 
scription and developmental control. We 
used Xenopus laevis and Xenopus borealis 
(misnamed X. mulleri in our earlier 



studies) and purified two kinds of 5S 
RNA genes from each species. 

The major 5S DNA component in each 
species synthesizes 5S RNA in oocytes 
only (oocyte-type 5S DNA). We have 
searched for the somatic-type 5S RNA 
genes for some time. A minor 55 DNA 
component was detected in the genomic 
DNA of each species. The one from X. 
laevis was found to code for a 5S RNA 
different from both the principal ooctye- 
type 5*S RNA and the somatic dS RNA. 
We now believe that this is a minor 
oocyte-specific 5*S DNA which encodes 
10 to 20% of the total 5S RNA accumu- 
lated })y oocytes. During the past year 
the minor 5S DNA from X. borealis was 
identified as the somatic-type 5S DNA. 
We now have available for comparison 



D.D. Brown and J . B. Gurdon* 



DEPARTMENT OF EMBRYOLOGY 97 

two 5S DNA's under separate control has shown evidence of transcripts of this 

from the same frog. 5*S DNA in oocytes but not in somatic 

We present the primary sequence of a cells. We conclude that this is a minor 

repeating unit of X. laevis oocyte-type oocyte 5*S DNA controlled in the same 

5S DNA. This is the first complete fine- way as the principle oocyte o,S DNA. 

structure analysis of a gene and its Additional sequencing, especially of the 

spacer that has been determined for an spacer region, will be undertaken soon, 
eukaryotic gene. Sequencing is well under 
way for the two kinds of X. borealis 5S 

DNA. Various homologies have been The Oocyte Injection System 

described in control regions of prokary- 
otic genes. These are usually detected by 
eye. Experience shows how difficult it is Several years ago we began a collabo- 

to find even striking regularities in nu- rati ve project to determine whether puri- 

cleotide sequences. We expect to search fied genes could be transcribed correctly 

for regularities in 5S RNA gene sequences if injected into living Xenopus eggs and 

and to compare similar regions in genes oocytes. In the first experiments we in- 

from two species or between somatic and jected purified ribosomal DNA (rDNA) 

oocyte-type 5S DNA from the same spe- and 5S DNA from Xenopus and mouse 

cies. A computer program has been writ- satellite DNA into unfertilized eggs of 

ten for this purpose and some of its fea- Xenopus laevis. We detected transcripts 

tures are reported here. of the rDNA and 5S DNA but none 

A new technique may make it possible whatsoever of mouse satellite DNA. Very 

for us to reconstruct proper control of low levels of RNA were transcribed from 

5S DNA in vitro. When the purified rDNA and 5*S DNA but were not ana- 

DNA is injected into living Xenopus lyzed further at that time. In the spring 

oocytes, the oocytes transcribe 5S RNA of 1976 we continued these experiments, 

of the correct size from the injected concentrating upon 5S DNA injection 

DNA. This permits us to test the faith- into the nuclei (germinal vesicles) of 

fulness of transcription of any 5S RNA oocytes. Our renewed optimism was 

gene or any fragment or mutant of such based upon experiments of Mertz and 

a gene. In addition we hope to begin Gurdon {Proc. Nat. Acad. Sci. U.S.A. 74, 

isolation of macromolecules that are re- 1502, 1977) which showed substantial 

sponsible for accurate transcription of transcription of SV40 DNA when it was 

5S DNA. injected into oocyte nuclei. 

All four kinds of purified 5*S DNA 

(two each from X. laevis and X. borealis) 

Xlt 5*S DNA are transcribed into 5>S RNA of the cor- 

^ ^ ^ , ^ , , rect size and sequence by oocyte nuclei 

D . D . Brown and E . J ordan ^-r~^^ ^^ ■, _^n m-u t^ivt a j. u 

(Figs. 69 and 70). The DNA must be 

In Year Book 74 we described some injected into the nucleus of the oocyte; 

characteristics of a minor 5*S DNA puri- DNA injected into the cytoplasm is not 

fied from the genome of X. laevis (Xlt transcribed. Transcription is judged to 
5*S DNA) . This tandemly repeating DNA be mostly faithful because (1) RNA of 
contains genes for 5S ribosomal RNA the correct size (Fig. 69) and sequence 
which differ in several nucleotides from (Fig. 70) is synthesized; (2) little if any 
both the principle oocyte and somatic 5S RNA is transcribed from the anticoding 
RNA's. Additional sequencing work has strand of the DNA; and (3) hybridiza- 
localized many of these nucleotide sub- 
stitutions. Examination of 5S RNA syn- * MRC Unit of Molecular Biologj^ Cam- 
thesized by various tissues of X. laevis bridge, England. 



98 



CARNEGIE INSTITUTION 



Ji = 



0» = 



» = 



• =^ 





-5.8S 
— 5S 





4S 



^ =i 



Fig. 69. The synthesis of 5S RNA after injection of purified X. laevis oocyte 5S DNA into 
the nuclei of Xenopus oocytes. The DNA was injected for 24 hr followed by [^H]-GTP for an 
additional 24 hr. The RNA was extracted and electrophoresed on an acrylamide gel. The 
stained gell (right) shows the location of various low molecular weight RNA's present in the 
oocyte. Radioactive RNA was detected by fluorography (left). Slots 1 and 3, DNA injection; 
slots 2 and 4, buffer injected without DNA. 



tion analyses showed that spacer tran- 
scripts are much rarer than gene tran- 
scripts. The fact that the injected DNA 
was the template for transcription was 
confirmed bv fingerprinting the [-"^^P] 5S 
RXA. In afl cases the labeled 5*S RNA 
had the fingerprint expected from the 
known sequence of the 5»S DNA used for 
injection. 

High molecular weight 5>S DNA iso- 
lated from the frog as well as cloned 
repeating units have been used for these 
experiments. The high molecular weight 



55 DNA from the frog was found to 
support dS DNA transcription for as long 
as several days after injection. There is 
a lag of 30 to 60 minutes after the DNA 
is injected and before 5S RNA is syn- 
thesized. If the DNA is injected before 
the isotope, then substantial 5S RNA 
synthesis can be detected in the shortest 
labeling time that we have tried — 10 
minutes. This experiment is important 
because it confirms previous studies 
which showed that there is no precursor 
of 5*S RNA. 



DEPARTMENT OF EMBRYOLOGY 



99 




19 • 
17' 






10 • 



0^ 



8 



6 



22 8 




6 



7 



4 5 



21 



Fig. 70. A fingerprint of radioactive 5S RNA synthesized by Xenopus oocytes after the 
injection of X. borealis somatic 5S DNA. The X. borealis 5S DNA purified from genomic DNA 
of the frog was injected into X. laevis oocyte nuclei along with a-[''T]-GTP. The radioactive 
5>S RNA was purified on a gel like the one shown in Fig. 1 and was digested with RNase Ti. 
The two-dimensional fingerprint of this digest (right) is compared with [^^P]-5/S RNA purified 
from somatic cells of X. borealis (left). The identity of the two fingerprints proves that the 
DNA component contains the genes for somatic 5S RNA. 



A variety of cloned 5*S DNA repeats 
support 5aS RNA synthesis after their 
injection into the germinal vesicle. Single 
repeating units of 5*S DNA are tran- 
scribed into 5»S RNA molecules of the 
correct size. This finding demonstrates 
that one repeating unit contains the con- 
trol sequences required for faithful tran- 
scription. In addition we conclude that 
methylation of 5S DNA as it is isolated 
from the frog is probably not required 
for faithful transcription. These cloned 
repeating units have been grown in bac- 



teria for many generations, and this has 
not altered their ability to support 5S 
RNA synthesis in the oocyte system. 

The frog oocyte system makes it possi- 
ble to test a repeating unit for its ability 
to support correct transcription of 5S 
DNA. We now have an assay system for 
detecting mutations affecting control re- 
gions in 5*S DNA. The oocyte nucleus 
clearly contains excess molecules capable 
of regulating transcription of added 5S 
DNA. We hope to be able to isolate these 
molecules. 



100 



CARNEGIE INSTITUTION 



Sequencing Studies on the 5S DNA of 
Xenopus laevis 

N. Fe dor off 

Using direct DNA sequencing tech- 
niques, we have assembled a general pic- 
ture of Xenopus laevis oocyte 5*S DNA 
at the nucleotide sequence level. We have 
sequenced end-labeled restriction enzyme 
fragments derived both from total frog 
bS DNA and from single repeating units 
cloned in bacterial plasmids (see Year 
Book 75, pp. 12-21 ; and Maxam and 
Gilbert. Proe. Xat. Aead. Sci. 74, 560, 
1977). The organization of the repeating 
unit is shown in Fig. 71, top. The re- 
peating unit, which averages 700 nucleo- 
tides in length, can be divided roughly 
into an AT-rich half (region A) and a 
GC-rich half (region B). The AT-rich 
spacer differs in the length of repeating 
units, most commonly by multiples of 
15 nucleotides. The GC-rich region, 
which is the same length in different 
repeating units, includes the gene and a 
related sequence termed the pseudogene 
fJacq, Miller, and Brownlee, 1977; in 
press). 

Figure 71 shows a composite sequence 
for the noncoding strand of the repeating 
unit in oS DNA. It represents the domi- 
nant sequence and some of its variants 
in the oS DNA population. Most of the 
sequence is almost identical in a majority 
of repeating units. The principal way in 
which repeating units differ from each 
other is in the redundancy of the oligo- 
nucleotide CAAACTTTGAGTTTT at a 
single site commencing 41 nucleotides 
from the left end of the AT-rich spacer. 
Among the six cloned fragments ana- 
lyzed, the number of copies of this oligo- 
nucleotide varied from 2 to 12. The 
modal value for its redundancy in the 
total population of repeating units is 5. 
We have designated the region contain- 
ing this oligonucleotide region A2. It is 
indicatf^d by a single copy of the redun- 
dant oligonucleotide enclosed in square 
brackets; its variable redundancy is 
designated by the subscript n. Apart 



from region A2, the AT-rich spacer se- 
quence is the same in a sufficiently large 
fraction of the repeating units in the 
population so that a unique sequence 
can be determined in total 5*S DNA from 
either end of the spacer. Analyses of 
cloned single repeating units of 5S DNA 
reveal in the relatively constant portions 
of the spacer (regions Ai and yla) at 
least two types of heterogeneity: base 
changes and short deletions. Of the six 
fragments examined, no two are exactly 
alike throughout the spacer. In addition 
to differences in the variable region {A2) 
most fragments differ by one or a few 
single bases elsewhere in the AT-rich 
portion of the spacer {Ai and ^3). Two 
cloned fragments lack the oligonucleo- 
tides underlined in Fig. 71; one lacks 
two short oligonucleotides near the ends 
of region A^ (broken line), and the other 
lacks a single long oligonucleotide in 
region ^3 (solid line over sequence). 

The GC-rich portion of the repeating 
unit contains the gene and a related se- 
quence, the pseudogene. The pseudogene 
was first identified, mapped, and se- 
quenced by Jacq et at. It commences at 
a distance of about 73 nucleotides from 
the right of the gene and strongly re- 
sembles the first 100 nucleotides of the 
gene. These sequences are aligned ver- 
tically in Fig. 71. The nucleotides that 
differ between gene and pseudogene are 
underlined. Beyond nucleotide 100 of the 
pseudogene, the sequence resembles the 
AT-rich spacer. We have designated nu- 
cleotide 106 the 3' terminus of the 
pseudogene. Our studies on this sequence 
in total frog DNA substantiate those of 
Jacq et al., with the exception of pseudo- 
gene nucleotide 15. Here we find a T 
residue in the noncoding strand, while 
they find a C residue. The sequence of 
slightly more than 70 nucleotides sepa- 
rating the gene and pseudogene (region 
B2) resembles a region of equivalent 
length immediately on the 5' side of the 
gene. These regions are aligned in Fig. 
71 to emphasize their similarity. Al- 
though the sequence of region B2 is not 



DEPARTMENT OF EMBRYOLOGY 



101 



Hind m 



-M- 



Haein HaelH 

_J_J_ 



Hindnr 
Hoe HI 



/ \ AT-rich spocer i ,5S gene i ipseudogene 






Region A 



Region B 



Spacer 



5S gene 



Pseudogene 



Hindu 



CAAAGCTTCATTTTTTCAAGGTTTGATTTTTTAAAGTTTT[cAAAGTTTGAGTTTT]^CAAAgTTTICAAAGTTTAATTTTTCAAAGTTTTCAACGTTTTCAAA^TTTGATTTTTCAAAG 
TTTTCAAAGTTTAAATTTTTTCAAAGTTTTCAAAGTTTGATTTTTTCAACGTTTTCAAGGTTTGATTTTTCAACGTTTTCAAAGTTTCATTTTTttAACGTTTTCAACGTTTTCAAGGTT 



-lOOg -80g 

TGATTTTTCAACGTTTTCAAAGTTTCATTTTTCAGTTTTCAGTTTCATTT 



Region A 



-60Q -40g -209 

TTCAAAGTTTTCATTTTCATTTTTCCACAGTGCCGCTGACAAGTCAAGAAGCCGAAAAGTGCCGCTGTTCATC 



Region B 



Haem 

19 I 



Haem 

60g I 



20g 40g 60g 1 80g lOOg I20g 

GCCTACGGCCACACCACCCTGAAAGTGCCTGATCTCGTCTGATCTCAGAAGCGATACAGGGTCGGGCCTGGTTAGTACCTGGATGGGAGACCGCCTGGGAATACCAGGTGTCGTAGGCTT 



-60P -40p -20p 

I I I 

TTCAAAGTTTTCAACTTTATTTTGCCACAGCATCGCCGACAAGTCATGGAGCCAAAAG6TGCTGCTGTTCATC 



20p 



40 p 



Haem 
60p X 



80p 



lOOp 



GCCTATAGCCACACTACCCTGAAAGTGCCTGCTCTCGTCTGATCTGTGAAGTGATACAGGGGCAGGCCTGGTTAGTACCTGGATGGGAGACCGCCTGAGAAGTTTJCAAAGCTT) 



] t 



Hindm 



Fig. 71. A composite sequence of the repeating unit in Xenopus laevis 5S DNA represent- 
ing the dominant sequence variants. The noncoding strand is shown. The total sequence is 
subdivided into regions as shown on the diagram. Sequences are numbered with respect to the 
first nucleotide of the gene (e.g., lOg is the tenth nucleotide of the gene, while — lOg is the 
tenth nucleotide preceding the gene on the 5' side in the sense of transcription), the pseudogene 
(similarly, lOp or — lOp), and the left end of the AT-rich spacer (e.g. 10a). The T residue 
enclosed in brackets designates a T cluster of uncertain length, while the position at which two 
residues appear indicates high levels of heterogeneity at that nucleotide. In the sequence ex- 
tending from the left end of region A3 to nucleotide — 120g, the A and T cluster lengths were 
assigned from published RNase Ti oligonucleotide data derived from spacer transcripts (Bro"v\Ti- 
lee et ah, J. Mol. Biol. 89, 703, 1974) and are therefore somewhat tentative. The underlined 
oligonucleotides in region A3 were missing from one of the six cloned 5S DNA fragments 
analyzed, while the overlined oligonucleotide was missing from another. Region A2 is repre- 
sented by a single copy of the most common variant of the redundant 15-nucleotide sequence 
enclosed in square brackets. Its variable redundancy is indicated by the subscript n; n varied 
from 2 to 12 in the six cloned repeating units analyzed, and its modal value in the total popula- 
tion is about 5. The variants CAAAGTTCGAGTTTT, CAAAGTTCGAGTATT and 
CGAAGTTCGAGTTTT have been observed both in cloned fragments and in the total popu- 
lation of 55 DNA spacers. Region Bi and the adjacent portion of region A3 are aligned ver- 
tically with region B2 two lines below it to emphasize homology. Nucleotides in region B2 which 
differ from the corresponding ones at the right end of A3 and in Bi are underlined. The 
bracketed regions containing an X designate uncertain portions of B2; the subscripts indicate 
that the uncertain portions are 6-7 nucleotides long. The gene is similarly aligned with the 
pseudogene two lines below it. Again, nucleotides in the pseudogene that dififer from their 
counterparts in the gene are underlined. 



complete, the resemblance is already the entire sequence extending from nu- 
striking. Thus the GC-rich portion of cleotide —73 on the 5' side of the gene 
the repeating unit appears to duplicate through nucleotide 100 of the gene. 



102 



CARNEGIE INSTITUTION 



We have determined the sequence for 
the GC-rich portion of the repeating unit 
primarily in total frog DXA. As does 
most of the AT-rich spacer, frog DNA 
gives a unique sequence, which is there- 
fore the dominant sequence in the popu- 
lation. For the gene, the dominant DNA 
sequence corresponds to the most abun- 
dant 58 RXA sequence. The sequence 
was originally described by Wegnez, 
Monier, and Denis [Febs. Lett. 25, 13, 
1972). Some portions of the GC-rich re- 
gion have been examined in cloned frag- 
ments. Where this has been done, the 
sequence obtained is identical to the 
dominant sequence in total frog DNA. 
Oocyte 5S RNA is itself heterogeneous; 
two alternative bases have been detected 
at seven positions (Wegnez et al., 1972). 
Judging from base changes that affect 
restriction enzyme sites, we believe that 
similar levels of heterogeneity exist in 
the DNA. 

A striking feature of the primary se- 
quence in dS DNA is its hierarchical 
redundancy. The AT-rich portion of each 
repeating unit consists of the basic short 
repeating units CAAAGTTT(T) and 

G 

CAT5-6. These are arranged in longer 

A 

internally repetitive patterns, which are 
repeated within the spacer. The GC-rich 
portion of the spacer, though more com- 
plex, is also internally redundant. Finally, 
the family of repeating units consists of 
a fairly constant arrangement of the 
repetitive elements repeated many thou- 
sands of times. The variation in length 
observed from repeating unit to repeating 
unit is related to the internal redundancy 
of the repeating unit. That is, the most 
variable region of the repetitive unit is 
an almost perfectly redundant portion of 
the AT-rich spacer (region A2). This 
variable region contains, on the average, 
five tandem copies of the oligonucleotide 
CAAAGTTTGAGTTTT. Next in fre- 
quency are short deletions elsewhere in 
the AT-rich portion of the spacer (region 
^4.3). Except for those in the variable re- 
gion, we cannot be absolutely sure that 



the observed changes in cloned spacer 
fragments correspond to spacers occur- 
ring in the frog 5»S DNA population, 
especially in view of the instability to 
cloning of some satellite DNA's (Brutlag 
et ai, Cell, 3, 509, 1977). However, it is 
likely that there are such spacers in the 
frog 5S DNA because many of the re- 
peating units fall outside the regular in- 
cremental classes associated with changes 
only in the length of the variable region 
An. Finally, the GC-rich portion (region 
B) shows the lowest redundancy level 
within the repeating unit and the great- 
est length constancy in the population. 
There is a striking discontinuity in the 
spacer sequence 50 nucleotides preceding 
the gene on its 5' side in the sense of 
transcription. To the left of this point, 
the spacer is highly repetitive and rich 
in A and T clusters. The 49-nucleotide 
sequence adjacent to the gene (region 
5i) has a much higher GC content and 
lacks the obviously repetitive character 
of the rest of the spacer (Fig. 72). It 
contains several more or less perfectly 
repeated oligonucleotides of no longer 
than 10 residues. All of them are quite 
different from the repetitive units in the 
AT-rich portion of the spacer. This 
anomalous region also contains several 
palindromes, symmetry elements not 
found elsewhere in the spacer, but no self- 
complementary sequences. Since the 5*S 
gene is itself the transcription unit, we 
believe it likely that the region adjacent 
to the gene on the 5' side contains se- 
quences required for correct initiation 
of transcription. 



The Structure of X. horealis 
Oocyte and Somatic 5S DNA's 

Jeffrey Doering 

In Year Book 75 (p. 14) we reported 
the preliminary restriction enzyme map 
of one cloned Hindlll fragment of X. 
horealis oocyte 5*S DNA (Xbo3). This 
map and one for another fragment 
(Xbol) have been completed (Fig. 73) 



DEPARTMENT OF EMBRYOLOGY 



103 



10 20 30 kO 

4' i + 4- 

CCACAGT6CCGCTGACAAGTCAAGAAGCCGAAAAGTGCCGCTGTTCATC 



The repeated sequences are: 



The symmetrical regions are 



5 


AGTGCCGCTG 


14 


3 


ACAGT GC 


9 


34 


AGTGCCGCTG 


43 


17 


ACAGTCGC 


10 


1.000 






0.875 






2E-05 






2E-03 






11 


GCTGACAAGT 


20 


22 


AAGAAGC 


28 


27 


GCCGAAAAGT 


36 


34 


AA AAGC 


29 


0.800 






0.857 






3E-03 






6E-03 






25 


AAG CCG 


31 


27 


GCC GAA 


32 


33 


AAGTGCCG 


40 


40 


GCCGTGAA 


33 


0.750 






0.750 






7E-03 






7E-03 







Fig. 72. The nucleotide sequence preceding the X. laevis oocyte 5S rRNA gene is shown. The 
homologous regions, their positions, percent matches, and probabilities are listed as they would 
be in a typical computer print-out. No regions of dyad symmetries were found. The numbers 
before and after each short sequence refer to its position in the total sequence. The number 
below the two sequences is the fraction of nucleotides that match perfectly, and the last num- 
ber is the probability that this homology would occur by chance (2E — 05 = 2 X 10"^) . 

XbO 3 



Hind 

nr 



780 



200 



190 




Hind 

m. 



730 

41 — imw — ii m i iu 



190 



140 1 I40II 190 1 100 



-I--V 



/- ^ ^ - M 



XbO 1 





^ 


r 


H 







1 = 

I = 
I = 



Hpa II 

Hae HI 
Hha I 

= GENE 



Fig. 73. Restriction maps of two cloned fragments of X. horealis oocyte 5/S DXA. Xbo3 is 
2700 base pairs long and Xbol is 800 base pairs. The ends of both fragments are the Hindlll 
sites used for cloning. Numbers refer to base pairs. The exact arrangement of 25 base-pair 
fragments cut out by Hhal in the middle of Xbo3 has not been determined. The arrows denot- 
ing genes point in the direction of transcription (5' to 3') . 



104 



CARNEGIE INSTITUTION 



using standard restriction mapping 
methods. Hybridization with oS RNA re- 
vealed the location of the gene-coding 
sequences in each cloned fragment. It is 
apparent that the genes occur in clusters 
separated by different lengths of spacer 
DNA. Xbo3 contains two gene clusters, 
while Xbol has only one cluster. The 
number of genes per cluster varies from 
one to at least three. All clusters appear 
to be organized in the same way, as 
shown by the identical location of re- 
striction enzyme sites in the gene cluster 
regions of Xbol and Xbo3. The distance 
between genes in any cluster is a uni- 
form 70 base pairs, the same as the gene- 
pseudogene distance in Xlo 5S DNA (N. 
FedorofT: this Report). Since this spacer 
region should contain sequences involved 
in transcription termination for one gene 
and transcription initiation for the next 
gene, we are in the process of determin- 
ing its exact nucleotide sequence. We 
will then compare these sequences with 
the analogous ones already determined 
for X. laevis oocyte 5S DNA (Xlo). 
Since the spacer sequences of Xbo and 
Xlo have diverged considerably, se- 
quences that have been conserved may 
identify functional transcription control 
regions. 

The second gene in the Xbol cluster 
is missing the Hpall site in the middle 
of the gene, and sequence variants in 
Xbo 5S RNA indicate that a small per- 
centage of the genes lack this site. These 
genes also lack the Haelll site at a 
distance of about 17 nucleotides from 
its 5' end. This site occurs in the other 
gene of Xbol and in at least one gene 
of Xbo3. Since the resolution of the gels 
used in mapping Xbo3 w^as inadequate 
to detect this site in genes farther from 
the HinrRll end, it may be present in 
other genes of Xbo3 as well. In any case, 
nucleotide changes such as this one may 
prove useful in determining the precise 
region and the precise sequence required 
for correct transcription, using the oocyte 
injection system described above. 

The Xbo spacers consist primarily of a 



variable number of repeats of a 25 base- 
pair sequence cleaved by the restriction 
enzyme Hhal (Fig. 74). This sequence 
is also being determined. 

Thus, in contrast to Xlo, whose repeat- 



5' 10' 15' 20' 30' 45' 





Fig. 74, Autoradiograph of partial Hhal 
digests of Xbo3 run on 3% acrylamide 0.5% 
agarose composite gel. XboS was end-labeled 
with polynucleotide kinase and then partially 
digested with Hhal for the times (in min) 
shown above each slot. After electrophoresis the 
gel was dried and autoradiographed. The left 
end of the spacer is clearly resolved on this gel, 
showing the regularly repeating 25 base-pair 
Hhal fragment. 



DEPARTMENT OF EMBRYOLOGY 105 

length heterogeneity is confined pri- there is only one gene in each repeating 

marily to the AT-rich spacer, Xbo is unit. The gene-containing fragments cut 

heterogeneous in the length of its spacers out by Haelll (58 and 135 base pairs) 

and in the number of genes per cluster, have been sequenced by the method of 

Since restriction fragments indicative of Maxam and Gilbert (1977) and found 

the gene cluster arrangement are found to have the sequence predicted for the 

in digests of the whole population of Xbo somatic 5^S gene. The regions adjacent 

repeats, the structure seen in Xbo3 and to the 5' and 3' ends of the gene are 

Xbol may be characteristic of the total being sequenced for comparison with the 

population of repeating units in Xbo analogous sequences of Xbo 5S DXA. 

5S DNA. Hybridization studies indicate little or 

In Year Book 75, (p. 15) we reported no homology between the spacers of Xbs 

the characterization of a new 5S DNA and of Xbo. Whether the spacer of Xbs 

from A^. borealis. We have now identified contains a repeating sequence is not yet 

it as the somatic-type 5»S DNA (Xbs) known. In contrast to the AT-rich spacers 

by several methods. When injected into of Xlo and Xbo, Xbs has a GC-rich 

oocytes, as described above, Xbs DNA spacer. 

produces a large amount of full-length 

5S RNA. A Ti RNase fingerprint of this Nucleotide Sequence Analysis of the 

RNA was found to be identical to that Region Preceding the Xenopus borealis 

of somatic-type 5S RNA from tissue 5^ rRNA Gene 

culture cells (see Fig. 70). Xbs is cut by ^ , ,, 

,, ± ' ±' TT- JTTT • 4. Laurence Jay Korn 
the restriction enzyme Hinalli into 

homogeneous 900 base-pair fragments. As part of our attempt to understand 

The restriction enzyme map of one such transcription in eukaryotes, we are se- 

cloned fragment (Fig. 75) indicates that quencing the DNA region adjacent to 

Xb S 1 

Hind Hind 

HI m 



390 I 66 I 133 I 260 ^44 



50 I 135 I 58 I 56 I 54 I 110 | ? I 95 I 72 
< 430 ►H 317 >\< 116 — J 



j = Hpa n 

I =Hae HI 

I = Hha I 

< — = GENE 

Fig. 75. Restriction map of a cloned fragment of X. borealis somatic 5S DNA (Xbsl) . Num- 
bers refer to base pairs. The arrow denoting the gene-coding region points in the direction of 
transcription (5' to 3'). The question mark indicates a region where the arrangement of Haelll 
sites is uncertain. 



106 



CARNEGIE INSTITUTION 



SPACER 



PUTATIVE PROMOTER 



5S GENE 
65--- 






Hha I 
• 60 ^1 



t t 
Hae Hae 
III III 

^^7 



tt 
Hae 

III 



53 



•250- 



Hind III 



Hpa II 



Fig. 76. The restriction enzyme map of part of a cloned fragment of A", borealis oocyte 5/S 
DXA (Xbol). The numbers refer to base pairs. 



the 5' terminus of the Xenopus borealis 
oocyte-type oS rRNA gene. By analogy 
with prokaryotic systems, this region 
should contain the information for initi- 
ating transcription by RNA polymerase. 

Restriction enzyme analysis of a 
cloned fragment of A', borealis oocyte 5;S 
DNA (J. Doering and S. Emmons, per- 
sonal communication) reveals a Hindlll/ 
Hpall fragment of approximately 250 
base pairs which contains 65 base pairs 
of the dS RXA gene and approximately 
190 base pairs of the region preceding 
the gene (Fig. 76). The presence of re- 
striction cnzvme sites within the sequence 
(Hhal and Haelll] see Fig. 76) will 
facilitate sequencing studies. By com- 
paring the X. borealis oocyte-type 5*S 
sequence with the X. laevis oocyte and 
A', borealis somatic-type sequences, we 
hope to identify specific DNA regions 
with regulatory roles. Toward this end, 
a computer program has been written to 
facilitate analysis and comparison of 
nucleic acid sequences (see the report of 
Korn et al., below). 

DNA sequencing techniques have been 
applied to the X. borealis Hindlll/Hpall 
restriction enzyme fragment. Results are 
still preliminary. Not enough information 
is available to compare the putative pro- 
moter region with the X. laevis sequence. 
However, we have obtained the DNA 
sequence from a part of the restriction 
fragment which is analogous to the AT- 
rich spacer of X. laevis. The X. borealis 
sequence, like that of X. laevis, has large 



runs of T residues. Specifically, we find 
the sequence GTTTTTG repeats with a 
periodicity slightly greater than that of 
the 15-mer observed in A", laevis 5S 
DNA. 



Computer Analysis of 
Nucleic Acid Sequences 

Laurence Jay Korn, Gary L. Queen,* 
and Mark N . Wegman^ 

We have developed a computer pro- 
gram to facilitate the analysis of nucleic 
acid sequences. Originally designed to 
aid our studies on Xenopus 5S DNA se- 
quences, the program is of general use 
in analyzing and comparing nucleotide 
sequences. For example, the program can 
examine the sequence of a polynucleotide 
(DNA or RNA) for homologous regions 
of various types: repeated sequences, 
symmetries (sequences that read the 
same forward and backward), and dyad 
symmetries (sequences that read the 
same forw^ard and backward when A is 
interchanged with T and C with G). It 
can also search two or more sequences 
for subsequences they have in common. 

The computer program was written in 
the programming language PL/1- It con- 
sists of 1580 statements organized into 

* Dopartmonl of Mathematics, Cornell Uni- 
versity, Ithaca, New York 14850. 

t Thomas J. Watson Research Center, Inter- 
national Business Machines, Yorktown Heights, 
New York 10598. 



DEPARTMENT OF EMBRYOLOGY 107 

40 subroutines. Established structured When none of these conditions hold, the 
programming techniques and algorithms comparison is terminated. If the homol- 
were used in organizing and writing a ogy thus obtained meets certain criteria 
program designed for ease and flexibility set by the user, the homologous regions 
of application. One may specify which and their positions are printed. 
of 18 independent procedures is to be Some of the criteria that can be set 
applied to the nucleotide sequence. Ten are the minimum number of matches, 
parameters, which determine in various the maximum allowed length of a loop- 
ways the criteria for homology, may be out, and the minimum ratio of correct 
set. matches to total length of the homologous 

The first procedure of the program regions. The percent of matches is printed 

lists the entered sequence with every immediately beneath each homology, 

tenth nucleotide numbered. In the sec- The probability of that homology having 

ond procedure, the number and percent occurred by chance alone is also calcu- 

of each of the four nucleotides in the lated and listed. By specifying that only 

sequence is shown. The third procedure statistically improbable matches be 

counts each of the 16 possible dinucleo- printed, we can eliminate inferior homol- 

tides and lists their frequency. Similarly, ogies while retaining those most likely 

other routines display the distribution to be significant. 

of trinucleotides, counted in the three We believe the program will be very 

reading frames, both separately and helpful in analyzing nucleic acid se- 

together. quences. When the 49-nucleotide sequence 

Another procedure examines the nucleic preceding the X. laevis 5S DNA gene 

acid for regions rich in purines or py- was examined by the computer, several 

rimidines. The criterion for richness is potentially interesting homologies were 

that six out of eight consecutive nucleo- observed (see Fig. 72). The biological 

tide bases be of one type. The program significance of these homologies and their 

prints two copies of the nucleotide se- possible role in the control of transcrip- 

quence and overlines the purine-rich re- tion await further analysis. Computer 

gions in one and the pyrimidine-rich studies of other regions of the X. laevis 

regions in the other. A similar routine 5*S DNA and the X. borealis 5S sequence 

locates and prints the AT- and GC-rich are in progress, as well as detailed analy- 

regions. ses of prokaryotic regulatory sequences. 

Another aspect of the program may be 
invoked to find all occurrences of a given 

short string of nucleotides in the nucleic Preparation and Transcription of 

acid sequence. This feature is especially Bromodeoxyuridine-Substituted 

useful in locating restriction enzyme sites. Xenovus laevis 5S DNA 

The core of our program consists of 

algorithms to find repeated sequences, B.L.Murr 

symmetries, and dyad symmetries, which Current evidence suggests that differ- 

are not perfect. A representative output ential gene expression is determined in 

from these procedures is shown in Fig. part by variations of the base sequences 

72. To find homologies, the computer in regions adjacent to the transcription 

initiates a comparison at each pair of units. To examine this proposition we 

nucleotides. The comparison is continued are attempting to change the structure 

as long as the nucleotides match, or when of the Xenopiis laevis 5S DNA by sub- 

a mismatch does occur, if it is followed stituting bromodeoxyuridine (BrdU) for 

by several matches, or if nucleotides can all thymidine residues. There are two 

be '^looped out" to find new matches, principal reasons for examining this 



108 CARNEGIE INSTITUTION 

bromine-substituted DNA. First, it has result of incorporation of the BrdU into 

been reported that when the lac-operator DNA. 

is fully substituted by BrdU, its affinity Using the oocyte injection system, we 

for the lac repressor is enhanced tenfold, can test whether BrdU-substituted DNA 

Second, there are several well-documented can act as the template for accurate 

examples showing that exposure of differ- transcription of 5*S DNA. The bromine- 

entiating cells to BrdU leads to a sup- substituted gene might have a different 

pression of specialized proteins. The affinity for the polymerase and the other 

evidence suggests that the effect is the proteins necessary for transcription. 



THE COLLECTION OF HUMAN EMBRYOS 

Ronan O'Rahilly and Ernest Gardner 

The embryological collection is housed awaiting publication in the Handbook 

at the L^niversity of California, Davis, oj Clinical Neurology, edited by Vinken 

and inquiries about the collection should and Bruyn. Work has been begun on an 

be addressed to Professor R. O'Rahilly, atlas of the developing human brain, 

Carnegie Laboratories of Embryology, with special emphasis on staged material 

University of California, Davis Cali- of the embryonic period proper, 

fornia 95616. Some one hundred embryos A study of the development of the in- 

and fetuses were acquired during the past terpeduncular nucleus in the midbrain 

year. of the rhesus monkey and of the human 

has been made by Prof. N. J. Lenn 

-n, o (Davis), in collaboration with Prof. P. 

Developmental Stages IN -o i •. /tt in i tit ^t tt ir 

XT -n Rakid (Harvard) and Mr. N. Halfon 

Human Embryos /i-^ • \ rru n i • • ^u ^.u 

(Davis). The cellular origms, the path- 
Work continues on the revision of way of cellular migration, and the early 
stages 10 to 23 (R. O'Rahilly), on the structure of the interpeduncular nucleus 
tabulation of the timing and sequence of were analyzed. A striking correlation in 
developmental events in staged human these events was found between the two 
embryos (R. O'Rahilly) , and on the species when staging was used as a basis 
establishment of a computer catalogue of comparison, rather than age or crown- 
(Alexander Barry). With the aid of Dr. rump length. This work will provide a 
J. E. Drumm (Dublin), a comparison firm basis for electron microscopic in- 
was made between (1) the Carnegie C.-R. vestigations of this system in the rhesus 
length/age data and (2) the information monkey. 

now available relating the C.-R. length During the year, Dr. F. Miiller, Uni- 

determined ultrasonically in utero and versity of Basel, visited Davis and com- 

postovulatory age determined by basal pleted a study of the development of the 

body temperature. Very good agreement anterior falcate and lacrimal arteries, 

was found. (See Bibliography). Drs. Miiller and O'Rahilly are investi- 
gating the early development of the 

T>, TVT ci capuchin monkey, Cebus, and have pre- 

Development OF THE Nervous System ^ , ,, -^ I i i - -n . ^ xi_ 

pared a cardboard model to illustrate the 

Work continues on the developmental development of the human pancreas. 

neurobiology of primates (E. Gardner Prof. W. Wozniak, Medical Academy of 

and associates). A chapter on "The de- Poznan, visited Davis and continued his 

velopmental anatomy and histology of studies of the developing brain and spinal 

the human central nervous system" is cord. An article by Wozniak and associ- 



DEPARTMENT OF EMBRYOLOGY 



109 



ates on the types of neural cells in the 
spinal ganglia of human embryos and 
early fetuses has been submitted for pub- 
lication. It includes electron microscopic 
as well as light microscopic data. An in- 
vestigation of the onset and sequence of 
joint formation and ossification in the 
presacral portion of the human vertebral 
column is being undertaken by Professors 



A. Ornoy (Jerusalem), E. Gardner, and 
D. J. Gray (Stanford). 

Visitors to the collection included Pro- 
fessors E. C. Amoroso (Cambridge) , P. A. 
de Vries (San Jose), G. Gitlin (Stanford 
and Jerusalem), H. N. Marvin (Little 
Rock, Arkansas), W. P. Luckett (Oma- 
ha), B. Maron (Bethesda, Maryland), 
and E. M. Ramsey (Washington, D.C.). 



STAFF ACTIVITIES 



During the year staff members partici- versity ; University of Maryland ; Rocke- 
pated as chairmen or speakers at the feller University; National Jewish Hos- 
following conferences: Cold Spring Har- pital, Denver; National Institutes of 
bor Symposium on '^Chromatin"; Gordon Health; University of Texas; Duke Uni- 
Conferences on '^Animal Cells and Vi- versity; University of Maryland, Balti- 
ruses," on "Chromatin," and on "Lipid more County Campus ; University of Ala- 
Metabolism"; Rothschild School on bama Medical Center; Case Western Re- 
"Membrane-Cytoskeleton Interactions" serve; Cold Spring Harbor Laboratories ; 
in Jerusalem; Membrane Biology Col- State University of New York at Stony 
loquium at Rockefeller University ; Neu- Brook and at Albany; University of 
rosciences Program Symposium at Wash- Connecticut Health Center ; Florida State 
ington University; Neurosciences Re- University; Roswell Park Memorial In- 
search Program Work Session on "The stitute; University of Pittsburgh; Uni- 
Developmental History of the Neuron" ; versity of Chicago ; Northwestern Univer- 
Tissue Culture Association Decennial sity; University of Indiana; University 
Review Conference on "Gene Expression, of North Carolina; Roche Institute of 
Regulation and Cultured Cells"; Muscu- Molecular Biology; St. Louis University; 
lar Dystrophy Association Fifth Inter- Princeton University ; and Massachusetts 
national Scientific Congress; NIGMS Institute of Technology. 
Medical Training Program Workshop on Beside the participation of staff in 
"Current Problems in Neurobiology"; international symposia, they presented 
National Paraplegia Foundation on lectures at the MRC Unit of Molecular 
"Growth of the Neuron"; Meeting on Biology, Cambridge, England; ISREC, 
Biomolecular Evolution, Paris; Work- Lausanne; Hebrew University, Jeru- 



shop on "Silk Gland Differentiation," 
Lyon; Tenth International Congress of 
Biochemistry, Hamburg; M. D. Anderson 
30th Annual Symposium on Fundamental 
Cancer Research: "Cell Differentiation 
and Neoplasia"; Plenary Lecture at the 
American Society of Biological Chemists; 



salem; Universite Libre of Brussels; 
Friedrich-Miescher Laboratorium in 
Tubingen ; and the Max Planck Institute 
at Munich. 

Members of the staff served on study 
sections of the National Institutes of 
Health in Cell Biology and in Bio- 



Symposium on "Genetic Regulation in physics and Biophysical Chemistry, and 

Eukaryotic Cells," Washington Univer- on the National Science Foundation's 

sity; EMBO Workshop on "Sequences in section on Cell Biology. 

Genes and Spacers," Davis; and Sym- Editorial service for journals was per- 

posium on "Developmental Biology," formed as the Editor of Developmental 

Indiana University. Biology and Associate Editor for the 

Lectures were given at Harvard Uni- Journal of Cell Biology and Cell. 



110 



CARNEGIE INSTITUTION 



A staff member assisted in the design 
of the Hall of Evolution at the Smith- 
sonian Museum of Natural History. 
Additional consultant activities included 
membership on visiting committees for 
the Department of Biology at ]\Iassa- 
chusettc? Institute of Technology, the De- 
partment of Biochemistry and Molecular 
Biology at Harvard University, and the 
Roche Institute of ^Molecular Biology, 
and service on the Board of Scientific 
Counselors of the National Institute of 
Child Health and Development. 

Six staff' members hold joint appoint- 
ments in either the Department of Bio- 
physics or the Department of Biology at 
Johns Hopkins University; they assisted 
in courses on advanced cell biology, de- 
velopmental biology, advanced biochem- 
istry, and neurobiology. 

Continued participation by the staff in 
the national debate on recombinant DNA 
included the National Academy Forum 
on Recombinant DNA, a public debate 
at the Smithsonian Institute, the presen- 
tation of testimony to the Environmental 
Protection Agency, and several public 
debates and lectures in the Baltimore 
area. 

Seminars 

The Department offers at least two 
seminars each week, one of them usually 



presented by a scientist from outside the 
Department. This year 20 invited speak- 
ers from Johns Hopkins University and 
the University of INIaryland participated. 
In addition the following scientists spoke: 
Tom Cech, Massachusetts Institute of 
Technology; Vincent Chiappinelli, Uni- 
versity of Connecticut at Storrs; George 
N. Cohen, LTnstitut Pasteur; Tom 
Ducibella, Harvard University; Henry 
Epstein, Stanford University; Eric Frank, 
Harvard University; Werner Franke, 
German Cancer Research Center, Heidel- 
berg; J. -P. Garel, Roche Institute of 
Molecular Biology; Richard Gordon, Na- 
tional Institutes of Health; Barbara 
Hamkalo, University of California at 
Irvine; Wolfgang Hennig, Max Planck 
Institute, Tubingen; Tasuku Honjo, 
Tokyo University; Ann Hubbard, Yale 
University; Jean Lauder, University of 
Connecticut; Ted Maden, Glasgow Uni- 
versity; Bert O'Malley, Baylor College 
of Medicine; Carl Parker, Washington 
University at St. Louis; Joan Prives, 
Weizmann Institute; Cary Queen, Cor- 
nell University ; Bob Roeder, Washington 
University ; Shlomo Rotshenker, Harvard 
University; K. Scriabin, Harvard Uni- 
versity; Virginia Walbot, Washington 
University of St. Louis; Sam Ward, 
Harvard University; Harold Weintraub, 
Princeton LTniversity. 



BIBLIOGRAPHY 



Brown, D. D., and J. B. Gurdon, High fidel- 
ity transcription of 55 DNA injected into 
Xenopus oocytes. Proc. Nat. Acad. Sci. 
USA. 74, 2064-2068, 1977. 

BrowTi, D. D., see also Doering, J. L., Reader, 
R.H., andWenauer,P.K. 

Bustin, M., R. H. Reeder, and S. L. Mc- 
Knight, Immunological cross reaction be- 
tween calf and Drosophila histones. J. Biol. 
Chem. 2o2, 3099-3101, 1977. 

Dawid, I. B., C. K. Klukas, S. Ohi, J. L. 
Ramirez, and W. B. Upholt, Structure and 
evolution of animal mitochondrial DNA. In 
Genetic Function of Mitochondrial DNA, 



C. Saccone and A. M, Kroon, eds., Elsevier/ 
North Holland Biomedical Press, Amster- 
dam, The Netherlands, pp. 3-13, 1976. 

Dawid, I. B., and P. K. Wellauer, A reinvesti- 
gation of 5'— >3' polarity in 405 ribosomal 
RNA precursor of Xenopus laevis. Cell 8, 
443-448, 1976. 

Dawid, I. B., see also Klukas, C. K., Reeder, 
R. H., Tartof, K. D., Upholt, W. B., and 
Wellauer, P. K. 

Devreotes, Peter N., J. M. Gardner, and 

D. M. Fambrough, Kinetics of biosynthesis 
of acetylcholine receptor and subsequent 
incorporation into plasma membrane of 



DEPARTMENT OF EMBRYOLOGY 



111 



cultured chick skeletal muscle. Cell 10, 
365-373, 1977. 

Devreotes, P. N., see also Fambrough, D. M. 

Doering, J. L., S. Emmons, and D. D. Brown, 
Characterization of two types of 5S DNA 
in Xenopus borealis. Fed. Proc. 36, 878, 
1977. 

Drachman, D. B., and D. M. Fambrough, Are 
muscle fibers denervated in myotonic 
dystrophy? Arch. Neurol. 33, 485-488, 
1976. 

Drumm, J. E., and R. O'Rahilly, The assess- 
ment of prenatal age from crown-rump 
length determined ultrasonically. Amer. J. 
Anat. 148, 555-560, 1977. 

Emmons, S., see Doering, J. L. 

Fambrough, D. M., Development of cholin- 
ergic innervation of skeletal, cardiac and 
smooth muscle. In Biology of Cholinergic 
Function, A. M. Goldberg and I. Hanin, 
eds.. Raven Press, New York, pp. 101-160, 
1976. 

Fambrough, D. M., Specificity of nerve-muscle 
interactions. In Neuronal Recognition, S. 
Barondes, ed.. Plenum Press, New York, 
pp. 25-67, 1976. 

Fambrough, D. M., and P. N. Devreotes, De- 
velopment of chemical excitability in skele- 
tal muscle. In Biogenesis and Turnover of 
Membrane Macromolecules, J. S. Cook, 
ed.. Raven Press, New York, pp. 121-144, 
1976. 

Fambrough, D. M., see also Devreotes, Peter 
N., and Drachman, D. B. 

Fedoroff, N., P. K. Wellauer, and R. Wall, 
Intermolecular duplexes in heterogeneous 
nuclear RNA from HeLa cells. Cell 10, 
597-610,1977. 

Gardner, E., and R. O'Rahilly, The nerve 
supply and conducting system of the hu- 
man heart, at the end of the embryonic 
period proper. J. Anat. 121, 571-587, 1976. 

Gardner, E., see also O'Rahilly, R. 

Gardner, J. M., see Devreotes, Peter N. 

Giza, P. E., see Suzuki, Y. 

Gurdon, J. M., see Brown, D. D. 

Higashinakagawa, T., H. Wahn, and R. H. 
Reeder, Isolation of ribosomal gene chro- 
matm. Dev. Biol. 55, 375-386, 1977. 

Higashinakagawa, T., see also Reeder, R. H. 

Klukas, C. K., and I. B. Dawid, Character- 
ization and mapping of mitochondrial ribo- 
somal RNA and mitochondrial DNA in 
Drosophila melanogaster. Cell 9, 615-625, 
1976. 

Klukas, C. K., see also Dawid, I. B. 



McMahan, U. J., see Muller, K. J. 

McKnight, S. L., see Bustin, M. 

Meyer, D. B., and R. O'Rahilly, The onset of 
ossification in the human calcaneus, Anat. 
Embryol. 150, 10-33, 1976. 

Miller, Jr., 0., see Reeder, R. H. 

Miiller, F., The development of the anterior 
falcate and lacrimal arteries in the human. 
Anat. Embryol. 150, 207-227, 1977. 

Muller, K. J., and U. J. McMahan, The 
shapes of sensory and motor neurons and 
the distribution of their synapses in ganglia 
of the leech: a study using intracellular 
injection of horseradish peroxidase. Proc. 
R. Soc. Lond. B. 19^, 481-499, 1976. 

Ohi, S., see Dawid, I. B. 

O'Rahilly, R., Prenatal human development. 
In Biology of the Uterus, R. M. W\Tin, ed., 
Plenum Press, New York, pp. 35-57, 2nd 
edition, 1977. 

O'Rahilly, R., The development of the vagina 
in the human. In Morphogenesis and Mal- 
formation of the Genital System, R. J. 
Blandau and D. Bergsma, eds., Birth De- 
fects, Original Article Series, Liss, New 
York, 13, 123-136, 1977. 

O'Rahilly, R., and E. Gardner, The embryol- 
ogy of bone and bones, in Bones and Joints 
(Intl. Acad, of Pathology Mono. No. 17), 
L. V. Ackerman, H. J. Spjut, and M. R. 
Abell, eds., Williams and Wilkins, Balti- 
more, pp. 1-15, 1976. 

O'Rahilly, R., see also Drumm, J. E., Gard- 
ner, E., and Meyer, D. B. 

Ozato, K., see Pagano, R. E. 

Pagano, R. E., K. Ozato, and J. M. Ruys- 
schaert. Intracellular distribution of lipo- 
philic fluorescent probes in mammalian 
cells. Biochim. Biophys. Acta 4^5, 661- 
666, 1977. 

Ramirez, J. L., see Dawid, I. B. 

Reeder, R. H., D. D. Brown, P. K. Wellauer. 
and I. B. Dawid, Patterns of ribosomal 
DNA spacer lengths are inherited. J. Mol. 
Biol. 105, 507-516, 1976. 

Reeder, R. H., T. Higashinakagawa, and 0. 
Miller, Jr., The 5'-^3' polarity of the 
Xenopus ribosomal RNA precursor mole- 
cule. Ce// <?, 449-454, 1976. 

Reeder, R. H., see also Bustin, M., Higashina- 
kagawa, T., and Wellauer, P. K. 

Ruysschaert, J. M., see Pagano, R. E. 

Suzuki, Y., Accentuated expression of silk 
fibroin genes in vivo and in \\Xyo. Tenth 
International Congress of Biochemistry, 
Abstracts, p. 77, 1976. 



112 



CARNEGIE INSTITUTION 



Suzuki, Y.. and P. E. Giza. Accentuated ex- 
pression of silk fibroin genes in vivo and in 
Wtro. J. Mol. Biol. 107\ 1S3-206. 1976. 

Tanof. K. D., and I. B. Dawid, Similarities 
and differences in the structure of X and Y 
chromosome rRXA genes of Drosophila. 
Xaturc eeS, 27-^0, 1976. 

Upholt, W. B.. and I. B. Dawid, Functional 
organization and evolution of animal mito- 
chondrial DNA. In Genetics and Biogene- 
sis of Chloroplasts and Mitochondria, Th. 
Bucher et al., eds., Elsevier/ North Holland 
Biomedical Press, Amsterdam, The Nether- 
lands, pp. 5S7-592, 1976. 

Upholt. W. B.. see also Dawid, I. B. 

Wahn, H., see Higashinakagawa, T. 

Wall.R...<;rf Fedoroff, N. 



Wellauer, P. K., and I. B. Dawid, The struc- 
tural organization of ribosomal DNA in 
Drosophila melanogaster. Cell 10, 193-212, 
1977. 

Wellauer, P. K., I. B. Dawid, D. D. Brown, 
and R. H. Reeder, The molecular basis for 
length heterogeneity in ribosomal DNA 
from Xenopus laevis. J. Mol. Biol. 105, 
461-486, 1976. 

Wellauer, P. K., R. H. Reeder, I. B. Dawid, 
and D. D. Brown, The arrangement of 
length heterogeneity in repeating units of 
amplified and chromosomal ribosomal 
DNA. from Xenopus laevis. J. Mol. Biol. 
105, 487-505, 1976. 

Wellauer, P. K., see also Dawid, I. B., Fedor- 
off, N., and Reeder, R. H. 



PERSONNEL 

Year Ended June 30, 1977 
(including those whose services ended during the year) 



Research Staff 



Donald D. Brown, Director 
Igor B. Dawid, Biochemistry 
Dougla.^ M. Fambrough, Biochemistry 
Kenneth J. Muller, Neurobiology 
Richard E. Pagano, Biophj'sics 
Ronald H. Reeder, Biochemistry 
Yoshiaki Suzuki, Biochemistry 

Research Associates (Extramural) 

Bent G. Boving, Detroit, Michigan 
Robert L. DeHaan, Atlanta, Georgia 
Ernest Gardner, Davis, California 
Arthur T. Hertig, Boston, Massachusetts 
In\in R. Konigsberg, Charlottesville, Vir- 
ginia 
Ronan O'Rahilly, Davis, California 
Elizabeth M. Ramsey, Washington, D.C. 

Postdoctoral Fellov:s and 
Grant-Supported Associates 

Peter Botrhan, Fellow of the U.S. Public 
Health Service and Carnegie Institution 
of Wa.'>:hington 

Salvatore T. Carbonetto, Fellow of the 
U.S. Public Health Sorvice 

Diana Card, Fellow of Muscular Dystro- 
phy Association of America, Inc. 



Jeffrey Doering, Fellow of the U.S. Pubhc 
Health Service 

Mark Dworkin, Fellow of Carnegie Insti- 
tution of Washington 

Scott Emmons, Fellow of the National 
Cystic Fibrosis Research Foundation^ 

Nina Fedoroff, Fellow of the U.S. Public 
Health Service and Carnegie Institution 
of Washington; U.S. Pubhc Health Serv- 
ice Grant (Brown) 

Paul Geshelin, Fellow of the U.S. Public 
Health Service^ 

Elizabeth Godwin, U.S. Public Health 
Service Grant (Dawid) 

Lawrence J. Korn, Fellow of Helen Hay 
Whitney Foundation 

Eric Long, Fellow of the Swiss National 
Fund for Scientific Research 

Yasumi Ohshima, Fellow of Carnegie Insti- 
tution of Washington 

Keiko Ozato, Fellow of Marine Biological 
Laboratory^ 

Richard Rotundo, Fellow of Carnegie In- 
stitution of Washington 

Alex Sandra, U.S. Public Health Service 
Grant (Pagano) 

Barbara Sollner-Webb, U.S. Public Health 
Service Grant (Reeder) 

Masatoshi Takcichi, Fellow of Carnegie 
Institution of Washington* 



DEPARTMENT OF EMBRYOLOGY 



113 



Katherine Tepperman, Fellow of the U.S. 

Public Health Service'^ 
Yoshihide Tsujimoto, U.S. Public Health 

Service Grant (Suzuki) 
Walter Wahli, Fellow of the Swiss National 

Science Foundation 
Harvey Wahn, U.S. Public Health Service 

Grant (Reeder) 
Peter K. Wellauer, Fellow of the National 

Cystic Fibrosis Research Foundation^' 

Students 

Jeffrey Chernak, Undergraduate, Cornell 
University 

Brian Cooley, Undergraduate, Johns Hop- 
kins University 

Peter Devreotes, Graduate, Johns Hopkins 
University 

John M. Gardner, Graduate, Johns Hop- 
kins University 

Margie M. Goldberg, Undergraduate, 
Goucher College 

Robert A. Hipskind, Graduate, Johns Hop- 
kins University 

Les Katzel, Graduate, Johns Hopkins Uni- 
versity 

Marc C. Krauss, Graduate, Johns Hopkins 
University 

Jose Ramirez, Graduate, Johns Hopkins 
University 

Shigeru Sakonju, Graduate, Johns Hopkins 
University 

Nancy A. Union, Undergraduate, Goucher 
College 

Visiting Investigators and 
Extramural Collaborators 

Robert Benbow, Baltimore, Maryland 
Michael Bustin, Bethesda, Maryland 
Tom Cech, Cambridge, Massachusetts 
Michael Edidin, Baltimore, Maryland 
Patricia Gearhart, Baltimore, Maryland 
John Gurdon, Cambridge, England 
Uel J. McMahan, Boston, Massachusetts 
Barbara R. Migeon, Baltimore, Maryland 
Oscar Miller, Jr., Charlottesville, Virginia 
Brown L. Murr, Baltimore, Maryland 



Keiko Ozato, Baltimore, Maryland 
Cary L. Quf;en, Ithaca, New York 
R. M. Ptuysschaert, Brussels, Belgium 
Ken Tartof, Philadelphia, Pennsylvania 
Hans Weiss, Heidelberg, Germany 
Peter Wellauer, Lausanne, Switzerland 
John Wienstein, Bethesda, Maryland 

Clerical and Technical Staff 

Elaine S. Asch, Senior Technician 
James H. Blackwell, Custodian 
Paul Blackwell, Custodian (part-time) 
Jeffrey L. Ciemny, Recorder^ 
William H. Duncan, Senior Technician 
Ernestine V. Flemming, Laboratory Helper 
Anne K. Francis, Secretary^ 
Paul E. Giza, Technician 
Richard D. Grill, Photographer 
Virginia Hicks, Laboratory Helper 
Mary E. Hogan, Technician 
WilHam L. Johnson, Custodian 
John E. Jones, Custodian 
Eddie Jordan, Senior Technician 
Catherine R, Lane, Librarian (part-time) 
AHce H. Mabin, Laboratory Helper 
Thomas F. Malooly, Business Manager 
Barbara Melnick, Secretary 
Thomas F. Miller, Custodian 
Joyce Patterson, Laboratory Helper 
John Pazdernik, Building Engineer 
Betty Lou Phebus, Bookkeeper 
Martha L. Rebbert, Senior Technician 
Susan D. Satchell, Secretary 
Patricia Schmidt, Secretary 
Ginny Selby, Secretary (part-time) 
Bessie Smith, Laboratory Helper 
Delores Somerville, Senior Technician 
Barbara Thomas, Technician 
John Wiser, Machinist 



' To September 30, 1976. 
' To February 14, 1977. 
'To August 31, 1976. 
* To August 31, 1976. 
' To July 29, 1976. 
« To Julv 15, 1976. 
' To October 29, 1976. 
'To April 21, 1977. 



Hale Observatories 



Operated by Carnegie Institution of Washington 
and California Institute of Technology 

Pasadena, California 



Horace W. Babcock 
Director 

J. Beverley Oke 
Associate Director 



OBSERVATORY COMMITTEE 

Horace W. Babcock, Chairman 

J. Beverley Oke, Vice-Chairman 

James E. Gunn 

George W. Preston 

Allan Sandage 

Wallace L. W. Sargent 

Maarten Schmidt 

Arthur H. Vaughan 



Carnegie Institution of Washington Year Book 76, 1976-1977 



Contents 



Introduction 119 

Observing Conditions 124 

Physics of the Sun 125 

Mount Wilson observations 125 

Solar magnetic fields 126 

Large-scale velocity fields 127 

Solar pulsations 127 

Big Bear Solar Observatory 127 

Macrospicules, x-ray bright-point 

flares and spicules 128 

X-ray spectra of flares 128 

Physics of flares 129 

Solar radio astronomy 129 

Solar System 130 

lo 130 

Comets and asteroids 132 

Stellar Spectroscopy 132 

White dwarfs 132 

Lower end of the main sequence , . 133 

B-type stars 133 

Red giants in globular clusters 134 

Stellar Chromospheres 134 

Instrument for the study of 

stellar chromospheres 134 

Flare stars 135 

Millimeter-Band Photometry 135 

One-millimeter photometry of 

extragalactic objects 135 

Thermal sources 135 

Nonthermal sources 136 

Observing procedures 137 

Submillimeter heterodyne 

spectroscopy 138 

Globular Clusters 138 

Infrared studies of red giants in 

globular clusters 138 

Interstellar Matter and Gaseous Nebulae 139 

Planetary nebulae 140 

One-millimeter photometry of the 

Crab Nebula ' 140 

Pulsars 140 

Secular decrease in the visible 

intensity of the Crab pulsar 140 



X-Ray Sources 141 

Supemovae 144 

The Galaxy: Its Halo and 

Globular Clusters 144 

Metal abundances in globular clusters 144 

M15 main-sequence photometry 145 
Color-magnitude diagram of two 

remote halo clusters 146 

NGC 5053 146 

The remote Serpens cluster Palomar 5 146 
The outer globular clusters and 

satellites 147 

Molecular hydrogen in galactic sources 148 

Galactic center observations 149 

Luminosity function of white dwarfs 

and hot subdwarfs 149 

H and K objective-prism survey .... 149 

Galaxies 150 

Composition gradients across spiral 

galaxies 150 

Binary galaxies 150 

Compact galaxies 150 

Globular clusters in M31 151 

Globular clusters in M87 151 

Dynamical studies 152 

Velocity dispersions in galaxies 152 

Bright spiral galaxies 153 

Seyfert galaxies 153 

Grouping galaxies 154 

Extragalactic observations at 

1 to 10 microns 154 

NGC 4151 155 

NGC 1199 155 

Multiplicity of nuclei of ellipticals . . . 156 

Clusters of Galaxies 156 

"Missing mass" in clusters 156 

Velocity field near rich clusters of 

galaxies 157 

Velocity anomalies in the Virgo cluster 157 

Search for evolutionary changes 157 

Search for intergalactic hydrogen .... 157 

Cluster models 158 

Radio Sources 159 

3CR identification program 159 

Identifications of radio sources 159 



Quasars and Quasi-Stellar Objects 159 
Photometry and spectroscopy in the 

S*^ and 15^' survey fields 160 

Bright survey field 161 

Spectroscopic observations 161 

Infrared photonietry of QSS 162 

Absorption-line spectra 162 

Peculiar quasars 163 

Observational Cosmology 163 

The velocity field of nearby galaxies . . 163 

Solar motion relative to the 

Local Group 164 

E\'idence for a positive curvature of 
the Hubble diagram for brightest 

cluster galaxies 164 

The Hubble diagram 166 



Theoretical Studies 167 

The abundance distribution in the 

galactic halo 167 

Instrumentation 167 

"Charge-coupled" detectors 167 

Photon-coimting spectrometers 167 

Infrared photometer 168 

Palomar aluminizing program 168 

5-meter telescope control room 169 

Astroelectronics Laboratory 169 

Guest Investigators 170 

Bibliography 185 

Staff and Organization 191 



INTRODUCTION 



The advance of astrophysics in general 
and of cosmology in particular has been 
limited by the rate at which data can be 
collected. For each investigator who plans 
and conducts extensive programs for the 
acquisition of basic data, there are sev- 
eral who are ready to interpret the ob- 
servations and, using them as a founda- 
tion, to erect a framework of theory 
thereon. In too many instances, over- 
extended interpretations or conclusions 
have been based on data samples that 
are marginal or inadequate. Some im- 
provement of this data-limited situation 
is resulting from the several large new 
optical and radio telescopes that are be- 
coming operational in this decade, and 
also from new instruments above the 
earth's atmosphere. Certainly great im- 
provements have already taken place 
through the advent of two-dimensional 
photon-counting devices for spectrometers 
and for image photometry. At the same 
time, photographic plates with improved 
characteristics remain indispensable for 
wide-field recording. When finally it be- 
comes possible for astronomers routinely 
to measure with high efficiency and high 
resolving power the direction, energy, flux 
rate, and polarization of incoming pho- 
tons over an extended image with negli- 
gible contamination from the sky, a 
fundamental if not ultimate plateau of 
instrumental performance will have been 
achieved. 

Important progress toward this goal 
of improved instrumentation continues 
through the work of many individuals. 
At the Hale Observatories those most 
involved include Gunn, Kristian, Oke, 
Persson, Shectman, and Westphal. De- 
vices of several types are in use or under 
test, but among the most promising are 
the CCDs, or charge-coupled devices. 
vSome of these are currently being tested 
in collaboration with personnel of the 
Jet Propulsion Laboratory. 

The Observatories have a record of 



support of long-term "sustaining" pro- 
grams of data acquisition that can pro- 
vide a substantial base for many investi- 
gators. An example of such a long-term 
program is that of acquiring and publish- 
ing a consistent body of data on the 
observed velocities (redshifts) of all the 
brighter galaxies. Now being brought to 
completion by Sandage and Tammann, 
this effort has been under way for forty 
years. It was begun by Hubble in his 
contacts with N.U. Mayall of the Lick 
Observatory and in direct collaboration 
with Milton Humason at Mount Wilson, 
beginning in 1936. Its aim was the acqui- 
sition of data either by direct spectro- 
scopic observation or by compilation 
from published sources, to result in red- 
shifts of all of the 1249 bright galaxies 
of the Shapley-Ames catalogue. (The 
catalogue, published by the Harvard Col- 
lege Observatory in 1932, lists positions, 
angular sizes, and estimated magnitudes.) 
A 1956 paper by Humason, Mayall, and 
Sandage summarized results of the pro- 
gram to that time. New spectroscopic 
observations, including many obtained 
by Sandage in Australia in 1969 and 
others made by him at Palomar from 
1970 to 1977, have resulted in 670 new 
redshifts for bright galaxies. Now^, Sand- 
age and Tammann, in collaboration, have 
compiled all known redshifts for the 
galaxies in the catalogue. It is expected 
that the revision will be published by the 
Carnegie Institution in 1978. 

The revised Shapley-Ames catalogue 
will include reclassification of the types 
(spiral, elliptical, irregular, etc.) of all 
listed galaxies on the Hubble system. 
This reclassification was initiated by 
Hubble in 1946 on the basis of improved 
direct photographs. Over the years, 
Sandage has accumulated plates with the 
5-meter Hale Telescope in the north and 
with the 1 -meter Swope Telescope at Las 
Campanas in the south. These photo- 
graphs, together with others in the col- 



119 



120 



CARNEGIE INSTITUTION 



lection of plates made with the Blount 
Wilson telescopes, form the basis for the 
more than 1200 new galaxy types now 
being prepared for publication. 

The immediate purpose of Sandage and 
Tammann in compiling the redshift ob- 
servations is to provide a data sample 
that will permit determination of the 
sun's motion (and of the motion of our 
Galaxy) relative to the inner metagal- 
axy — "our part of the Universe." Analy- 
sis of the new body of data, with its 
nearly comj'jlete velocity coverage, has 
been begun by A. Yahil of Tel Aviv 
University and Tammann with the aim 
of measuring perturbations of the local 
velocity field in the presence of density 
contrasts. The goal is to assess the role 
of gravity in determining the global 
world model by using the velocity per- 
turbations as measures of the local ratio 
of kinetic energy to gravitational poten- 
tial energy. 

In 1962. Eggen, Lynden-Bell, and 
Sandage presented observational evidence 
showing that our Galaxy formed by con- 
traction from a primordial gas cloud. 
Stars and globular clusters that we now 
identify as ''old" formed during the con- 
traction and continue to show a roughly 
spherical distribution (the ''halo") and 
to pursue inclined orbits around the cen- 
troid of the system; these objects do not 
interact dynamically with the residual 
gas. The remnants of the contracting gas 
clouds, however, are impermeable to one 
another and do interact, generally col- 
lapsing to a plane determined by the 
angular momentum of the system. There 
they give rise to successive generations 
of young stars. 

The subject of the structure and evolu- 
tion of galaxies is now very active, and 
significant new insights are being 
achieved. A few years ago, Searle re- 
ported the discovery of chemical com- 
position gradients across the disks of 
spiral galaxies. The discovery has been 
sustained, and attention has turned to 
the origin of the gradients and to the 
detailed physics of the ionized regions 



whose spectra provide evidence for these 
gradients. In the past year, Searle has 
collaborated with G. A. Shields of the 
l^niversity of Texas in analyzing new 
observations of emission regions in the 
spiral IVIIOI. Searle and Shields find that, 
in addition to the well-established abun- 
dance gradient, there is also a gradient in 
temperature of the ionizing stars, the 
hottest stars occurring far from the center 
of the galaxy. They suppose that the 
ionizing stars share the abundance gradi- 
ent of the gas and show that this has 
important effects on the character of the 
ionizing radiation emitted by these stars. 
When these effects are both taken into 
account, the detailed models produce an 
excellent fit to the new observations, and 
Searle and Shields find that the 0/H 
abundance ratio falls off as r~^/^ when r, 
the distance from the center of the gal- 
axy, lies between 5 and 25 kiloparsecs. 
The observations rule out a theoretical 
prediction that the abundance would de- 
crease linearly with the radius. 

Shectman and Preston have initiated 
a search for stars of very low metal 
abundance in the halo of our Galaxy. The 
discovery of such objects would place 
important constraints on the early his- 
tory of nucleosynthesis during the con- 
traction phase. For this survey, they have 
equipped the 46-cm Schmidt telescope at 
Palomar with a large interference filter 
and an objective prism. The filter limits 
the extent of each spectrum to 100 A 
around the H and K lines of ionized 
calcium. This technique, with a survey 
limit near the 14th magnitude, permits 
easy rejection of the vast majority of 
stars showing normal H and K line 
strengths. The residual group of rarer 
objects includes white dwarfs, nuclei of 
planetary nebulae, and very-low-metal- 
abundance stars that are the objects of 
the survey. 

The use of the SIT Vidicon Cassegrain 
spectrograph and the multichannel spec- 
trometer has resulted in the discovery of 
over fifty additional degenerate stars by 
Greenstein and collaborators. They find 



HALE OBSERVATORIES 121 

continued evidence for stratification in trograph of the Hale Telescope. The 
the atmospheres of degenerate stars, and mass-to-light ratio is about 3 in visual 
for the presence of relatively sharp but units — rather higher than generally ex- 
weak hydrogen lines in the spectra of pected. This has im[)ortant implications 
quite cool objects that are dominated by for dark remnants that may contribute 
helium. Two red degenerate stars studied to the mass of the cluster, 
by Greenstein and Dr. W. F. van Altena Kristian, Sandage, and Westphal are 
of Yale University are among the in- continuing their program for measure- 
trinsically faintest known, with visual ment of redshifts and magnitudes of 
luminosity of about 10~* that of the sun. brightest cluster galaxies to extend the 

Miinch has collaborated with Drs. Fred Hubble diagram to large redshifts. They 

Roessler and John Trauger of the Uni- now present new photometry for 33 

versity of Wisconsin in studying the clusters and new redshifts for 50 clusters, 

physics of the magnetosphere of the extending to ^ = 0.75. The new data, 

planet Jupiter. They used the PEPSIOS combined with earlier samples, show evi- 

spectrometer (a pressure-scanning Fa- dence for a positive curvature of the 

bry-Perot interferometer of 150-mm Hubble diagram, with a formal value of 

aperture). The instrument offers a re- the deceleration parameter q^ (uncor- 

solving power of 130,000 and a circular rected for evolution) of 1.6. 

field of view of 30'' in diameter. While To avoid possible selection effects for 

many questions remain unanswered, the largest redshift clusters, Kristian, 

Miinch has concluded that the heavy-ion Sandage, and Westphal restricted the 

abundances approximate those expected analysis of their sample to clusters with 

for a meteoritic composition and do not z < 0.4. The currently available data 

remotely approach those expected for a samples show, for the first time, a sig- 

Jupiter-like composition. The plasma- nificant departure of the Hubble diagram 

sphere seems to be chemically isolated from a straight line, with persistent indi- 

from the planet and from the solar wind, cation of a positive curvature. If no 

The new application of heterodyne evolutionary corrections are applied, the 
spectroscopy at submillimeter wave- formal best-fit value for go is 1.6 =b 0.35. 
lengths has been begun at the 5-meter The dispersion in the absolute magni- 
telescope in collaboration among Drs. tudes of the brightest cluster galaxies 
T. Phillips and T. Huggins of the Bell continues to be strikingly small : the best- 
Telephone Laboratories and Neugebauer fit values are My = —23.28 and M^ =^ 
and Werner of the Hale Observatories. — 24.09, with a dispersion of 0.28 mag for 
The receiver, based on an InSb hot- the first-ranked cluster galaxy in each 
electron bolometer mixer, is mounted at passband. 

the prime focus of the telescope. Its use After a lapse of nearly fifty years since 
has resulted in the first detection in an Hubble's original discovery of the red- 
astronomical source of the 7 = 3 -> J = shift-distance relation, and its extension 
2 line of CO at 345 GHz. The line has by a factor of 200 in distance, the data 
been mapped over the central few arc appear to be near to fulfilling their 
minutes of the Orion molecular cloud, original promise as a possible test for 
The emission peak is within 10'' of known cosmological models. The validity of this 
infrared sources. approach for finding Qo is now dependent 

Gunn and Dr. R. F. Griffin of Cam- on the outcome of efforts to understand 

bridge Observatories, England, have com- the nature and size of galaxy-evolution 

pleted their observations and analyses of effects during the look-back time. To 

individual giant stars in the globular consider two opposite cases, the present 

cluster M3 as obtained with their tern- data show that if the universe is nearly 

plate spectrometer at the coude spec- empty {qo ^ 0) , then galaxies must have 



122 



CARNEGIE INSTITUTION 



been about 1 mag brighter at 2 = 0.4. 
On the other hand, if there has been no 
net brightness evohition since z = 0.4, 
then the data show that the universe is 
iirmly closed, finite, and osciUating. 

Wilkinson and Oke have completed a 
study of the absolute spectral-energy 
distributions of 54 bright<^st galaxies in 
faint clusters. About 15 objects have red- 
shifts between z = 0.10 and 0.21 and 
constitute the sample with short look- 
back time. The remaining 39 clusters 
have redshifts between 0.21 and 0.47. 
Over the range in time corresponding to 
z = 0.10 to 0.46, B — V is foimd not 
to change by more than 0.03 mag. Other 
effects of size comparable to or greater 
than any color evolution are present, 
and a comparative analysis of the indi- 
vidual spectral-energy distributions sug- 
gests that one significant effect may be 
a dispersion in metallicity by a factor 4 
among the galaxies in the sample. 

Oke and Richstone used the multi- 
channel spectrometer and the SIT-Vidi- 
con digit-al spectrograph to resolve spati- 
ally the quasar 3C249.1, previously 
thought to be stellar. These observations 
revealed narrow emission lines of [0 II] , 
[0 III], and [Ne III] from a region 
about 2" away from the quasar at a 
redshift consistent with that of the 
quasar. This is the third instance of such 
a phenomenon. It appears to rule out a 
gravitational model for the quasar red- 
shift. 

In general, it has not yet proved pos- 
sible to decide where the absorption lines 
of quasars and quasi-stellar objects origi- 
nate — whether in material ejected at high 
speeds from the QSO's or in unrelated, 
intervening objects such as galactic halos. 
Dr. A. Boksenberg, University College 
London, and Sargent used the IPCS at 
the coude spectrograph of the Hale Tele- 
scope to demonstrate that absorption 
lines are produced in the spectrum of at 
least one QSO, 3C232 with z,.m = 0.53, 
by matfrial in the outer parts of a galaxy, 
XGC: 3067. The QSO 3C232 and the Sa 
galaxy NGC 3067 are separated by r9 



on the sky. The redshift of the galaxy is 
z == 0.005. Haschick and Burke (Astro- 
phys. J. [Lett.] , 200, L137, 1975) showed 
that the 21 -cm line in the radio spectrum 
of 3C232 is observed in absorption at a 
velocity of 1418 ± 2 km s~^ despite the 
fact that the line of sight to 3C232 passes 
17 kpc away from the center of NGC 
3067. Boksenberg and Sargent observed 
the optical spectrum of 3C232 in the 
vicinity of the Ca II H and K lines and 
at a resolution of 1 A. They found ab- 
sorption lines corresponding to Ca II H 
and K at a redshift of 1406 dz 11 km s-^. 
The lines are quite strong, with an equiv- 
alent width of 0.4 A for K. A line of this 
strength would require a typical path 
length of about 1.3 kpc in the plane of 
our Galaxy near the sun; however, it has 
been shown that insterstellar lines of 
comparable strength can be found in 
the spectra of globular-cluster horizon- 
^tal-branch stars in the halo of our Galaxy. 

The observations by Boksenberg and 
Sargent establish that heavy elements 
which could produce QSO absorption 
lines are present in the interstellar gas 
far out in the halo of the disk of a spiral 
galaxy. This galaxy presents a much 
larger cross section for the production 
of absorption lines than would be ex- 
pected from its optical size. 

A study of the Crab Nebula at a wave- 
length of 1 mm has been completed by 
Werner, Neugebauer, and associates. The 
nebula was mapped with 1' resolution in 
twilight observations at the prime focus 
of the 5-meter telescope. The peak 1-mm 
surface brightness is seen in the center 
of the nebula at or near the position of 
the pulsar; the distribution of radiation 
around this j)eak is roughly elliptical, 
with half-power width --2:5 X 4:5. The 
result is in agreement with the size and 
shape of the nebula as determined at 
longer wavelengths. This agreement has 
been used to estimate the flux expected 
from the faint outer regions. On this 
})asis, the total 1-mm flux from the Crab 
Nelmla is found to be 300 ±: 80 Jy. 

The investigators found that both the 



HALE OBSERVATORIES 123 

total 1-mm flux from the Crab Nebula special attention to adjustment of electri- 
and the spatial distribution of the 1-mm cal, mechanical, and optical systems, and 
radiation are consistent with expectations with much effort devoted to completion 
from radio wavelength observations. The of essential auxiliary instruments. Ex- 
results indicate that the emission from cessive deflection of the support system 
the Crab Nebula down to wavelengths as of the Cassegrain secondary mirror had 
short as 1 mm can be attributed to syn- to be corrected by designing and install- 
chrotron emission from a single distribu- ing a new gravity-sensitive self-aligning 
tion of electrons. mechanism in the flip cage. This mecha- 

A program of observations from 0.3 nism was adjusted and successfully 

to 10 microns of all quasars brighter than tested in February 1977, at which time 

F = 17 has been completed with the in- the primary and secondary mirrors of 

frared photometer by Becklin, Matthews, the telescope were collimated. In April, 

and Neugebauer and by Oke with the the Gascoigne-Bowen correcting lens, the 

multichannel spectrometer at the 5- third and final element of the modified 

meter telescope. The preliminary results Ritchey-Chretien wide-angle optical sys- 

are already clear: (1) There is evidence tem, was finished and installed in the 

for a number of types of infrared-con- telescope. 

tinuum energy distribution. (2) Although April 1977 saw the first scientific use 

the energy distribution cannot be char- of the new telescope, by Dr. Charles H. 

acterized by simple power laws, there is, Townes and collaborators for infrared 

in general, an increase of flux density investigations of the center of the galaxy 

with decreasing frequency. (3) Although and by Babcock and Brucato for direct 

some quasars emit most of their energy photography. 

in the infrared at wavelengths equal to or Dr. Townes, together with Fred Baas 

greater than 10 /a, a significant fraction and John Lacy, all of the University of 

emit their maximum energy near 3 fx. California, used a spectrometer working 

Zirin completed an extensive study of in the far infrared with a tandem Fabry- 
solar flares, comparing the optical emis- Perot-grating system having completely 
sion in Ha and the A3835 band that he cooled optics so that sensitivity was 
observed at Big Bear with data on ener- limited primarily by photon noise of 
getic electrons reported by x-ray and radiation emitted in the path between 
radio astronomers elsewhere. Among the the spectrometer and the object observed, 
conclusions reached were the following: Observations were made of the 12.8-/X 
(1) Hard x-ray emission appears only in line of Ne II in the galactic center and 
impulsive flares having initial rise times in a number of planetary nebulae. The 
of less than one minute. (2) No delay primary objective was to obtain velocity 
was found between the start of hard and spatial distribution of the ionized 
x-ray activity and the start of Ha emis- gas component of material in the galactic 
sion. (3) The Ha intensity depends on center; Ne II provided one of the most 
the soft x-ray flux; emission in the A.3835 convenient probes into this region. Spec- 
band is observed when the soft x-ray tra were taken in 24 fields of view near 
flux exceeds 5 X W phot cm^^ sec at the center of the Galaxy, each of 7" 
the earth. In a number of instances, Ha diameter and with a spectral resolution 
knots brightened simultaneously although corresponding to a velocity spread of 
they were at considerable distances from about 40 km s~^. The spectra obtained 
the source of activity. The exciting agent from the galactic center showed remark- 
(hard electrons) must have traveled with able variations in intensity of the neon 
velocities of at least 5000 km s~^. line and in its velocity distribution among 

The 2.5-meter du Pont Telescope un- fields of view separated on the relatively 

derwent fitting out during the year, with small scale of about 1/6 parsec. Most 



124 



CARNEGIE INSTITUTION 



of the neon is redshifted by amounts 
varying up to several hundred km s~^. 
However, there are also substantial 
amounts of blueshifted neon with equally 
large Doppler shifts. 

Also in the month of April, Babcock 
and Brucato tested the wide-angle pho- 
tographic capability of the du Pont Tele- 
scope, using plates as large as 50 X 50 
cm-. The diagonal of such a plate cor- 
responds to 2.1° at a scale of 10.8" per 
millimeter. Uniformly good star images 
were recorded over the whole of each 
plate in excellent seeing. One of the 
large plates, of the cluster of galaxies in 
Centaurus. is being used by Dressier and 
Sandage in a study of the distribution 
of galaxy types as a fimction of distance 
from the center of the cluster; the pur- 
pose is to understand the formation of 
SO galaxies. 

Auxiliary instruments scheduled for 
installation, tests, and observations on 
the du Pont Telescope before the end 
of 1977 include the Cassegrain instru- 
ment adaptor base, the Cassegrain spec- 
trograph, and the infrared photometer. 

An important part of the research con- 
ducted with the facilities of the Hale 
Observatories was accomplished by 
astronomers from other institutions who 
were invited to come as guest investi- 
gators to conduct research projects ap- 
proved by the Observatory Committee. 
Some 58 astronomers from 38 institutions 



were accommodated. Of particular in- 
terest and value to astronomers of the 
Hale Observatories were the opportuni- 
ties to collaborate with guest investi- 
gators who brought with them novel and 
productive auxiliary instruments of types 
not otherwise available. A partial list of 
examples might include Dr. A. Boksen- 
berg of the University College, London, 
with his image-photon-counting system; 
Dr. T. G. Phillips of Bell Telephone 
with his heterodyne spectrometer; Dr. 
Charles T. Townes of the University of 
California with his helium-cooled spec- 
trometer for the far infrared, and Drs. 
J. Trauger and F. Roesler of the Uni- 
versity of Wisconsin with their PEPSIOS 
interferometer. 

While basic support for the Hale Ob- 
servatories is provided by the California 
Institute of Technology (for the Palomar 
Observatory) and by the Carnegie In- 
stitution of Washington (for the Mount 
Wilson Observatory and the Las Cam- 
panas Observatory), a majority of staff 
astronomers receive grant support for 
their principal researches from federal 
agencies: the National Science Founda- 
tion, the National Aeronautics and Space 
Administration, and the Office of Naval 
Research. Thus many of the results listed 
in this report depend importantly on 
federal funds. Not less appreciated are 
gifts from foundations, from industry, 
and from individuals. 



OBSERVING CONDITIONS 



The 2.5-meter Hooker telescope on 
Mount Wil.'^on was used for observations 
on 244 complete nights and 121 partial 
nights for a total of 2461 observing hours. 
The telescope was not out of service for 
repairs or engineering services requiring 
more than two hours during any one 
night. The 1.52-meter telescope was also 
in regular use. At Mount Wilson the total 
rainfall for the year was 750 mm and 
the total snowfall was 1600 mm. 

The 5-meter Hale Telescope at Palo- 



mar Mountain was used for a total of 
3063.6 hours, of which 2750.1 were night- 
time hours, as shown in Table 1. The 
difference represents twilight or daylight 
time that was used for planetary or in- 
frared observations not requiring a dark 
sky. The Palomar 1.52-meter telescope 
was in nearly constant use, while the 
two Schmidt telescopes (1.2-meter and 
46-cm) were in regular use except during 
the light of the moon. 
Total precipitation at Palomar was 



HALE OBSERVATORIES 



125 



TABLE 1. Observations With the Hale Telescope 









Zero 


Total 


Hours of 




Complete 


Partial 


Observation 


Hours 


Nighttime 


Month 


Nights 


Nights 


Nights 


Worked 


Observing 


July 


27 


4 





236.8 


263.8 


August 


29 


1 


1 


265.7 


265.7 


September 


14 


8 


8 


160.0 


160.0 


October 


22 


7 


2 


274.0 


264.0 


November 


23 


3 


4 


284.5 


274.2 


December 


23 


5 


3 


318.7 


280.8 


January 


18 


3 


10 


265.6 


214.6 


February 


24 


3 


1 


341.5 


278.0 


March 


20 


6 


6 


251.5 


229.5 


April 


24 


5 


1 


305.1 


219.7 


May 


10 


10 


11 


135.4 


117.6 


June 


24 
. 258 


3 
37 


3 
60 


224.8 


209.2 


Total 


3063.6 


2750.1 



735 mm, with 960 mm of snow. The 
maximum temperature was 34 °C, reached 
in July 1976 and June 1977; minima of 
— 8°C were reached in January and in 
March. 

Public visitors at the Palomar Ob- 
servatory numbered 94,590 for the year. 

At the Las Campanas Observatory in 



Chile, the 2.5-meter du Pont telescope 
underwent testing and commissioning. 
The mirrors were collimated in March 
1977, and the first scientific observations 
were made in May. The 1-meter Swope 
Telescope was used on 208 nights by 14 
different observers. Snowfall for the year 
amounted to 326 mm. 



PHYSICS OF THE SUN 



Mount Wilson Observations 

Synoptic observations of the sun con- 
tinue at Mount Wilson under the super- 
vision of Howard. Between June 1, 1976, 
and May 31, 1977, the following observa- 
tions were obtained: 



Direct photographs 


279 


Ha spectroheliograms, 




9-meter focus 


487 


K2 spectroheliograms, 




9-meter focus 


482 


Full-disk magnetograms 


284 


Integrated-light magnetic-field 




measurements 


231 


Sunspot drawings 


309 


Sunspot magnetic-field 




measurements 


301 



Solar observations were made on 317 
days. 



The daily magnetograms are published 
in the monthly publication Solar Geo- 
physical Data by the National Oceanic 
and Atmospheric Administration. The 
magnetic synoptic charts are published 
in the Quarterly Bulletin on Solar Ac- 
tivity of the International Astronomical 
Union. Partial support for these obser- 
vational programs comes from the Na- 
tional Aeronautics and Space Administra- 
tion, the National Science Foundation, 
and the Office of Naval Research. 

Since late in 1966, the digitized solar 
magnetic and velocity data from the 
Mount Wilson observations have been 
preserved on magnetic tape. A pass 
through this large amount of data to 
study magnetic or velocity characteristics 
over a long time interval is an expensive 
and time-consuming enterprise. In order 



126 CARNEGIE INSTITUTION 

to facilitate a number of studies of long- some flux will be lost because some 

term properties of the sun, a rereduction measurements will include field elements 

of all the accumulated data has been of both signs, which will tend to cancel, 

started. A part of the rereduction is the If during the approach to minimum 

storage of a condensed data set for each (1974-1975) the polar fields became 

day's observation. At the completion of more unipolar in each hemisphere, the 

the project, expected during the next measured total flux could have increased 

year, condensed data from the 11-year without any comparable increase in the 

interval will be available on one mag- number of field lines because there was 

netic tape. less cancellation of flux by opposite 

polarity fields. 

c 1 ^^ I- IT- ij Howard, in collaboration with Dr. Z. 

Svestka of American Science and Engi- 

Howard has estimated the true average neering, has studied the photospheric and 
magnetic field strength at the poles of coronal magnetic-field configuration asso- 
the sun. This quantity is of some im- ciated with a large complex of activity 
portance because solar wind models de- in 1973. The Mount Wilson magneto- 
pend critically on the true field strength graph measurements were used in con- 
in the photosphere. Recent models of junction with the A.S. & E. Sky lab x-ray 
coronal holes extended to the interplane- observations. The basic components 
tary medium have led to inferred average (active regions) of the complex were 
polar-field strengths of about 20 gauss, connected throughout its lifetime of seven 
Since the magnetograph measures only solar rotations through systems of mag- 
the line-of-sight component of the mag- netic field lines, including some across 
netic field, it has at times been assumed the equator. The visibility of individual 
that a strong polar field might exist but loops in these connections was greatly 
escape detection. Howard's analysis, how- variable and typically shorter than one 
ever, shows that the average polar fields day. Only the faint loops connecting 
measured at Mount Wilson (in recent active regions with remnants of old fields 
years, 1 to 2 gauss) cannot be low by can be seen in about the same shape for 
more than a factor 5, and probably are many days. Brightenings of x-ray loops 
not too low by more than a factor 2. were generally related to variations in 
Within about 10° of each pole, the mea- the magnetic-field strength or configura- 
surements are not reliable enough to use tion near one of the footpoints. The x-ray 
in such an analysis. loops that interconnect active regions 

Howard has found that, starting in generally connect to field elements in 
mifl-1974, the total magnetic flux (F^ = the periphery of the regions — never to 
i F+ I -|- I f- |) at latitudes poleward of sunspots. Some striking loop brightenings 
40° in each hemisphere has increased by were associated with flares, but the loop 
a factor of about 2.5. No comparable brightening and the flux occurrence 
change was seen in the total flux equator- seemed to be two independent conse- 
ward of 40°. Since the total flux poleward quences of a common triggering action: 
of 40° latitude represents only about 5% the emergence of new magnetic flux, 
of the total flux of the whole solar sur- Z. Svestka and C. V. Solodyna of 
face, this is not a large effect. It may be A.S.&E., R. H. Levine of the Center for 
that this is not a real flux increase on Astrophysics, and Howard have studied 
the sun but a change in the distribution Skylab x-ray and Mount Wilson mag- 
pattern of positive and negative field netic observations to determine whether 
elements. The measured flux depends on or not open field lines may be found in 
the aperture size because unless the aper- active regions. '^Opcn" field lines are 
ture is the size of the field elements, those that extend into interplanetary 



HALE OBSERVATORIES 



127 



space. It was found that some of the for the well-known 5-minute oscillation, 

dark gaps seen between interconnecting no periods were found in the data. Upper 

loops and interior loops of active regions limits of 1 ms-^ were established for 

may be the loci of open fields, as has such periodic motions for the velocity 

been predicted by global potential ex- signal, 0.02% for the (line-wing) in- 

trapolation of photospheric magnetic tensity signal, and 0.03 gauss for the 

fields. The field lines may be open only magnetic signal, 
in a later stage of the active-region 

development. j^-^ ^^^^ ^^^^^ Observatory 

T o 7 T7 7 -i ET- 7j Durlug the year, the 65-cm vacuum 

Larqe-bcale Velocity tields ^ , ^ ^^ ^ ^ ^• ^ ^ ^ ux 

^ ^ telescope was aligned and light brought 

The magnetogram reduction computer to the coude focus. The Zeiss universal 
programs have been largely rewritten filter and associated systems were brought 
by Boy den for the data rereduction under computer control. Diurnal drift of 
project. As a part of the reanalysis, the the photoelectric guiders was found to 
background velocities on the solar disk be due to differential flexure and was 
were examined in detail. This involved removed by relocating the guiders. Auto- 
subtracting the rotation, the limb red- matic camera controls have been added; 
shift, and the effects of the earth's orbit six cameras may now be operated simul- 
and rotation. After doing this, Howard taneously. 

and Boyden discovered that an additional Observational programs centered on 
effect remained — a low-amplitude, low- quiet-sun phenomena: spicules, solar ro- 
latitude, symmetric east-west line shift tation, lifetime of the chromospheric net- 
that varies linearly with the sine of the work, lifetime of quiet-sun magnetic 
central meridian distance. A possible fields, nature of the helium chromosphere, 
explanation is that the supergranular and mapping coronal holes, 
motions (observed to be largely hori- Adams has acquired new data for in- 
zontal) have a net upward component, vestigation of the rotation curve for 
This would favor the motion toward the short-lived solar filaments. In an attempt 
observer near the solar limb. As the re- to clarify the geometry of the magnetic 
reduction proceeds, more data will be- field involved in the solar-cycle field- 
come available with which to examine reversal, Adams has developed a model 
this and other possible explanations. in which surface reconnection of flux 

from decaying active regions provides 

Solar Puhatiom ^^^^ necessary link in producing the 

reversal. 

A series of observations was made in Hurford has continued his work with 

August 1976 at the 150-foot Tower Tele- the NASA-constituted Hard X-Ray 

scope in an attempt to detect global Imaging Facility Definition Team on the 

pulsations of the sun. Such pulsations design of an imaging instrument. This 

with an amplitude of 5 ms-^ and a period Shuttle-borne instrument will provide 4"- 

of 160 min have been reported by ob- resolution images of solar flares and 

servers at the Crimean Astrophysical cosmic sources between 2 and 80 kev in 

Observatory. Also, Hill and his associates order to better understand the behavior 

at the University of Arizona have made of nonthermal particles. During the past 

solar diameter measurements that indi- year he has developed an improved x-ray 

cate low-mode pulsations with periods in collimator configuration that permits 

the range of 50 min. The Mount Wilson high-resolution wide-field imaging, 

observations w^re examined for pulsa- Barry J. LaBonte, a graduate student, 

tions between 4 min and 180 min. Except worked on measurement of the helium 



128 



CARNEGIE INSTITUTION 



D3 line profile with a birefringent filter. 
For plages on the sun's disk, he found 
the best-fit Gaussian has a 1/e width of 
0.4 A. with negligible instrumental con- 
tribution. The D3 opacity is produced in 
regions with thermal line width — 0.1 
A; the nuich larger observed width indi- 
cates large nonthermal motions in the 
chromosphere. 

Microphotometry of calcium iv-line 
photographs in the regions of polar 
coronal holes has been carried out by 
K. A. ^larsh. who foimd that the chro- 
mospheric network exterior to a hole has 
a slightly broader intensity distribution 
than that inside the hole, a fact that can 
be attributed to a greater number of 
bright network elements outside the hole, 
^larsh has also made a study of high- 
resolution filtergrams of the solar limb 
in D3 and ofT-band Ha in order to in- 
vestigate the spatial structure of the D3 
chromosphere. It was found that spicules 
provide the major contribution to the 
peak D3 intensity, with the remainder 
of the emission coming from a semi- 
homogeneous background component at 
low height. The observations can be un- 
derstood on the basis of the photoioni- 
zation model, whereby it was found that 
helium is only slightly ionized at the 
height of the D3 peak, and that spicules 
are at least three times denser than their 
surroundings at this height. In coronal 
holes, the D3 emission is confined to iso- 
lated patches, but these patches have the 
same basic character as the spicule 
bushes that comprise the normal chro- 
mosphere. 

Macro spicules, X-Ray Bright-Point 
Flares, and Spicules 

Two solar phenomena that were newly 
ob.served from Skylab are extreme ultra- 
violet macrospicules and flares in x-ray 
bright points. Moore and F. Tang, in 
collaboration with J. D. Bohlin at the 
Naval Research Laboratory and L. 
Golub at American Science and Engi- 
neering, have completed an extensive 



comparison of Ha observations from Big 
Bear Solar Observatory with EUV and 
x-ray observations from Skylab; they 
find that macrospicules and x-ray bright- 
point flares are closely related. 

Moore and Tang found that time-lapse 
Ha filtergram movies of the solar limb in 
quiet regions show small surgelike erup- 
tions that are quite similar to EUV 
macrospicules in size, shape, motion, and 
duration. They therefore named these 
transient Ha features Ha macrospicules. 
From the similarity of Ha macrospicules 
and EUV macrospicules and from com- 
parison of simultaneous Ha and He II 
304 A observations, Moore et al. conclude 
that Ha macrospicules are EUV macro- 
spicules viewed in Ha, although most 
EUV macrospicules are too faint in Ha 
to appear on Ha filtergrams of normal 
exposure. 

From comparison of simultaneous x- 
ray and Ha observations of flares in 
x-ray bright points situated on the limb, 
Moore et al. find that flares in x-ray 
bright points often produce Ha macro- 
spicules. This suggests that all macro- 
spicules may be produced by similar, 
but usually weaker, microflares and that 
spicules may be generated by still smaller 
microflares. 

X-Ray Spectra of Flares 

Moore has analyzed the soft x-ray 
spectrum of 11 flares observed simul- 
taneously from the SOLRAD-9 satellite 
(A < 20 A) and from the OSO-7 satellite 
(A < 3 A). He found that both spectral 
ranges gave the same temperature and 
emission measure for the emitting flare 
plasma to within the accuracy of the 
data; i.e., the A < 20 A flux and the 
A < 3 A flux are both emitted from ap- 
proximately the same plasma. The de- 
rived temperature of this plasma at flare 
maximum is invariably in the range 1-2 
X 10^ K. Solar plasma in this tempera- 
ture range emits about 80% of its radi- 
ation shortward of 20 A. Therefore, the 
comparison of SOLRAD-9 and OSO-7 



HALE OBSERVATORIES 



129 



thermal x-ray flux observations shows 
that the A < 20 A soft x-ray flux is a 
good measure of the total radiative loss 
rate from the 7" > 10^ K flare plasma, 
while the A > 20 A XUV flux is a good 
measure of the radiative output from all 
lower temperature (T < 10"^ K) com- 
ponents of the flare. 



Physics of Flares 

Zirin completed an extensive study of 
solar flares, with the object of under- 
standing the temporal, spatial, and ener- 
getic relations between energetic elec- 
trons (observed by x-ray and radio) and 
optical emission in Ha and the A 3835 
band. The following conclusions were 
reached: 

1. For about 50 flares with good x-ray 
and spatial data, an average lag of ± 3 
sec was found between Ha start and 
hard x-ray (HXR) start, as well as be- 
tween Ha peak and HXR peak. If the 
soft x-ray (SXR) peak lags the HXR 
peak, the Ha brightness will continue at 
the peak value, decaying with the SXR 
flux. 

2. The Ha intensity depends on the 
SXR flux. Emission in the 3835 band is 
observed when the 5.1-6.6 keV SXR flux 
exceeds 5 X 10^ phot cm-^ sec at the 
earth. HXR emission appears only in 
impulsive flares with initial rise time of 
less than one minute. 

3. Multiple HXR spikes are connected 
with complex flares by a series of sepa- 
rate optical phenomena; each spike 
appears to be connected to a distinct 
happening rather than some oscillatory 
process. In some cases, however, homolo- 
gous flares will occur within hours at the 
same place with the same Ha and x-ray 
properties. 

4. In several cases. Ha knots sepa- 
rated by considerable distances appeared 
simultaneously. The exciting agent must 
have traveled at least 5000 km s~^ and 
(since an HXR spike was simultaneous) 
the cause must have been hard electrons. 



5. In all cases where flares near the 
limb were observed, an elevated Ha 
source was seen. Normally this was a 
preexisting mound or arch of cooler ma- 
terial suddenly excited by the onslaught 
of hard electrons. Calculations show that 
the cool material will be heated within 
10-100 sec to SXR source temperatures, 
and about 10% of the electron energy 
will come out in Ha, the rest going to 
thermal energy. 

Solar Radio Astronomy 

The solar interferometer equipment at 
Owens Valley Radio Observatory has 
become operational, and Hurford, Marsh, 
and Zirin have been carrying out a pro- 
gram of solar radio observations at 2.8 
cm with two objectives: (1) to study the 
emission and polarization of flares and 
active regions, and (2) to study the 
small-scale structure of the quiet sun 
to determine the upper chromospheric 
temperature distribution. There is little 
to say about the active sun because there 
are few flares in this quiet time. How^- 
ever, one flare wath a flux of 4 X 10~^ 
solar flux units (400 Jy) was observed. 
Optical changes in the observed flare cor- 
respond to phase shifts in the positional 
fringes, and analysis is under way to 
determine the relative position of the 
optical and radio source. 

Quiet-sun observations have shed some 
light on the puzzling quiet-sun fringes 
observed years ago by Lang and Zirin. 
By observations at several baselines, it 
has been found that (1) the fringes are 
uniform over the sun; (2) the fringe 
amplitude increases as resolution de- 
creases; and (3) the sources are un- 
polarized and there is no correlation be- 
tween different baselines. 

A model has been proposed in which 
the sources are a random superposition 
of components of the chromospheric net- 
work. These thermal sources are about 
10^ °K hotter than the background. This 
model fits fringes observed at 8.6 cm 
and 11 cm as well. 



130 



CARNEGIE INSTITUTION 



SOLAR SYSTEM 



lo 



With the 150-mm PEPSIOS spectrom- 
eter of the I'niversity of Wisconsin in- 
stalled at the coude laboratory of the 
5-nieter telescope. Miinch. in collabora- 
tion with Drs. Fred Roesler and John 
Trauger of the University of Wisconsin, 
has studied the [S II] AA 6716-6730 lines 
emitted in- the plasma contained in the 
Jupiter magnetosphere. During the nights 
of October 7-11, 1976, 70 line scans were 
obtained with a resolving power of 
130.000 and a circular field of view^ of 
30" diameter. An example of the quality 
of the tracings is shown in Fig. 1, which 
shows the raw data (step graphs) super- 
posed by Gaussian forms fitted by least 
squares. From the study of the material 
available, the following conclusions have 
been drawn: 

1. The S+ ions are corotating with the 



Jupiter magnetic field. When we adopt 
the rest wavelengths determined by meas- 
urements in spectra of emission nebulae, 
a small systematic difference appears 
between the observed and expected wave- 
lengths in the corotating frame. We 
ascribe it to inaccuracy of the rest wave- 
lengths, which should be increased by 
0.05 A for both lines. 

2. If the distance r from Jupiter is ex- 
pressed in terms of a(Io) , the semi-major 
axis of lo's orbit, then the maximum at 
r := 0.8 a(Io). No emission was detected 
at r = fl(Io), although our field of view 
had a diameter of 0.2 a(Io). The surface 
brightness in the three tracings obtained 
at r = 0.5 a(Io) appears to be only half 
of its maximum value at r = 0.8 a(Io). 

3. The S+ emission is strongly con- 
centrated toward the plane of lo's orbit. 
No emission was observed when the field 
of view had a magnetic latitude of ±20°. 



5x10"^ 






I xiO' 



5XI0- 



5(6717) 
S(673l) 



1.0 0.9 08 




Np~N(S*) 



0- 



10' 



N3(cm^) 



Fig. 1. Repre.sentative scans of tho X6716.47 and \6730.85 lines of singly ionized sulfur in 
Jupiter'.s corotating pla.'^ma, as obtained at 7.5'' UT on October 11, 1976. The spectra 
characterize a 30" field of view centered at 0.8 lo orbital radii west of Jui)iter and within 
2'^ of Jupiter's magnetic equator at a time when lo was near eastern elongation. Nearly 
equal 45 Rayleigh surface brightnesses are obtained for these two lines. 



HALE OBSERVATORIES 



131 



4. The S+ emission rate appears to 
depend on the relative geometry of the 
Jupiter magnetic field, the orbital longi- 
tude of lo, and the line of sight. The 
dependence, however, cannot be made 
precise on the basis of the available ma- 
terial because the number of tracings is 
insufficient to extricate the various time 
factors involved in the intensity vari- 
ations of the lines. 

5. The width of the S+ lines is between 
7.0 and 7.5 km s~^. After allowing for 
instrumental broadening, the intrinsic 
width of the lines, if assigned to pure 
thermal motions, corresponds to a tem- 
perature of 2,000° K. 

6. The doublet intensity ratio [A6718] / 
[A6730] has the value of 0.90 ± 0.10, 
which constrains the values of the elec- 
tron density Ne to the range indicated in 
Fig. 2. The given uncertainty for the 
value of the doublet ratio is not due to 
noise in the tracings but rather to the 
time variability of the line intensities. 
The constraint Ne — A^(S + ) on the ion 
density A^(S+), together with the values 



CO 

z 

LxJ 




J I I \ \ L 



-0.2 0.0 +0.2 
WAVELENGTH -Xo( A) 

Fig. 2. Electron density and temperature in 
Jupiter's co-rotating plasma at a distance 0.8 lo 
orbital radii from Jupiter. The range of allowed 
values is constrained by the observed ratio of 
[S II] line strengths, the observed line widths 
(Tg < 30,000°K), and charge neutrahty of the 
plasma. The data are representative for obser- 
vations during the period S-S*" UT on October 
11, 1976. 



of T obtained from the line widths, de- 
fines the domain indicated in Fig. 2. 
MiJnch concludes that the heavy ion 
abundances approximate those expected 
for a meteoritic composition; namely, in 
proportions Na:Mg:Si:S:Fe = 0.04:1.0: 
1.0:0.6:1.0. In particular, the H-, He-, 
and CNO-group ions cannot be present 
in any proportion remotely approaching 
that expected for a Jupiterlike compo- 
sition. 

It is believed that this result has far- 
reaching conceptual implications on the 
origin of the Jupiter plasmasphere, as it 
means that the confined plasma torus 
seen in S+ does not ''communicate" with 
Jupiter, nor does it bear the signature 
of the solar wind. The evidence thus is 
overwhelmingly in favor of a satellite or 
meteoritic origin for the thermal plasma 
observed in the Jupiter magnetosphere. 
But this conclusion raises a difficult 
problem: Atoms leaving lo, upon col- 
lision ionization, produce ions that have 
a velocity of 57 km s~^ with respect to 
the magnetic field on which they are 
trapped and therefore will gyrate wdth 
this velocity around their guiding centers. 
The free electrons will thermalize by 
elastic scattering in a few minutes to an 
assembly characterized by kinetic tem- 
perature of about 10^ °K. If the entire 
plasma could relax into equilibrium by 
particle-to-particle collisions, it would 
reach a temperature half as great, after 
undergoing ionization and excitation, but 
the time required would be of the order 
of eight months. It is most likely the 
collective plasma instabilities will set in 
within a much shorter time scale, which 
somehow will dissipate the high internal 
energy. The energy per ion-electron pair 
created on ionization of an atom leaving 
lo, in the corotating frame, is 7 X 10~^° 
erg, and, for a flux of Na atoms lea\'ing 
the lo surface of 10' atoms cm~- s~^, 
the total energy being injected into the 
plasma is 2 X 10^" ergs s~^. This energy 
has to be dissipated before the plasma 
settles down to a temperature of 20.000°K, 
as observed, but the process through 



132 



CARNEGIE INSTITUTION 



which the dissipation takes place is not scope was begun by Kowal in December 
yet clear. I'ndoubtedly some ''dumping" 1976. The main purpose of this program 
into the Jupiter ionosphere takes place is to study the distribution of very dis- 
hy diffusion along the magnetic lines of tant comets. In addition to comets, any 
force of Coulomb-scattered ions and new objects nearer than Mars or more 
electrons, but radiative losses from the distant than Jupiter will be followed, 
hot plasma (5CX).000'^K) will also occur. Thus far, two ''lost" objects have been 
If radiation is the predominant loss recovered and two new objects have been 
mechanism, it would balance the energy found. The "classical" Apollo-type aster- 
input for a hot ion density of 100 cm~^. oid Adonis was recovered in February 
The fact that the S+ emission originates 1977. This object had not been seen 
in a torus centered not at r = a(Io), since 1936. Periodic Comet Taylor (1916 
where the neutral atoms leaving lo be- I) was found on plates taken in Decem- 
come ionized, but at r = 0.8 a(Io) sug- ber 1976. This comet had not been seen 
gests the existence of the hot plasma at since 1916 and was thought to be hope- 
r ^ a(Io). This hot plasma could have lessly lost. It split into two pieces in 
been detected by the Plasma Analyzer 1916. Only component "B" is now visible. 
Experiment of Pioneer 10. The radiation A new Apollo-type asteroid, designated 
detected in the vicinity of lo's orbit by 1977 HB, was found by Kowal in April 
the short-wavelength channel of the 1977. The orbit has a semimajor axis 
Pioneer 10 UV photometer could also be of 1.08 A.U., making the asteroid a can- 
the line emission of the hypothetical didate for a possible space probe. In 
coronal plasma ^Ig X AA625-610, Si XII terms of energy requirements, 1977 HB 
AA520-50. Mg IX A368, etc. Further is probably the easiest object to reach, 



theoretical study of the plasma physics 
problems involved will be required to 
provide a basis for these tentative con- 
clusions. 



other than the Moon. 

The first new comet of the program 
was found in April 1977. Comet Kowal 
(1977 f) has a period of 15 years and a 
perihelion distance of 4.65 A.U. 

This project is under the general di- 
rection of Mlinch and is funded by Na- 
A systematic survey of the ecliptic tional Aeronautics and Space Adminis- 
region with the 1.2-meter Schmidt tele- tration Grant NGL 05-002-140. 



Comets and Asteroids 



STELLAR SPECTROSCOPY 



White Dwarfs 

The use of the SIT-Vidicon Cassegrain 
spectrograph and the multichannel spec- 
trophotometer has resulted in discovery 
of over 50 additional degenerate stars 
by Greenstein and collaborators. At- 
tempts are being made to extend the 
search for these objects fainter than 
magnitude 18. Observations with the 
SIT. in particular, have shown that 
higher resolution (about 5 A) permits 
detection of weak metallic lines and, 



particularly interesting, very weak hy- 
drogen lines in cool degenerate stars. The 
hydrogen lines persist down to tempera- 
tures well below 7000°, even though one 
expects that, because of convection, the 
mixing of the outermost hydrogen layers 
and the deeper layers of more normal 
composition should be bringing metal to 
the surface. Thus continued evidence 
exists for stratification in the composition 
of the degenerate stars and the presence 
of relatively sharp but weak hydrogen 
lines in quite cool objects which are 



HALE OBSERVATORIES 133 

almost certainly dominated by helium, jects are clearly among the lowest lu- 

The number of intrinsically faint red minosity stars known; some are of large 

degenerate stars has been substantially space velocity as well as: low luminosity, 

increased so that there are now approxi- which is rare. An example is LP 16-36 

mately 50 known red degenerates of with a visual absolute magnitude My ^= 

temperature 7000° or lower. A few have 16.5 and a space motion of 200 km s-^ 

quite strong metallic lines. One, GD 401, In addition, in collaboration with George 

has H and K of 175 A equivalent width. Gatewood of the University of Pitts- 

An especially interesting object, LP93- burgh, who plans parallax studies of the 

21, is clearly underluminous for its colors, very faint stars of the LP survey, some 

presumably because its atmosphere has intrinsically very faint M dwarfs have 

extremely strong molecular carbon bands, been found, including two near Mv + 

The SIT permits resolution of the vibra- 17.9, among the faintest stars known, 

tional structure and suggests equilibra- Such stars can be found only if close to 

tion between vibrational, rotational, and the sun; any appreciable number will 

local temperatures. From colors, LP93- substantially increase our knowledge of 

21, which has a proper motion of 1.77'' the frequency of stars of the smallest 

per year, would be given a luminosity mass, 
such that its tangential space motion 
would be over 1000 km s~^. In fact, the 

star must be intrinsically fainter and B-Tvvp S^nrs 
closer than the colors would indicate, but 

even with a maximum reasonable cor- Preston and Sidney Wolff of the Uni- 
rection, which reduces its radius to one- versity of Hawaii have completed a study 
half the mean of the average degenerate of the rotations and the incidence of 
star, the space motion is nearly 600 km MgMn stars in a large color-limited 
s~i with a retrograde and eccentric sample of B-type stars. Projected rota- 
galactic orbit. A pair of red degenerate tional velocities with a resolution of 10 
stars, LP380-5/6, have been studied in km s~i were obtained from Palomar 
cooperation with W. F. van Altena of coude spectrograms. HgMn stars were 
Yale University, who has obtained a discovered by examination of these spec- 
parallax for those objects with the Kitt trograms and, additionally, by a moder- 
Peak National Observatory 4-meter re- ate dispersion (50 A mm"~^) survey at 
flector. The two stars are among the Mauna Kea of the strong ultraviolet 
intrinsically faintest known, with a visual lines of Mn II. For the latter survey, 
luminosity approximately 10~^ that of discovery probability for Mn stars is 
the sun. virtually independent of rotation for v 

sin i < 100 km s~^. Inversion of the 

T 17 ^ I ±-L nr ' o i^sini distribution for the whole sample 

Lower hind 0] the Main Sequence , -r , .^ ^. ^ ^ - ■ a ^ ,^ 

by Lucy s iterative technique yields the 

In the survey of proper-motion stars rotational velocity distribution for late 

from the Lowell Observatory catalogs B-type stars. The distribution rises from 

of Giclas and collaborators, the apparent a small (indeterminate) value at zero 

magnitude limit of 16.5 results in a limi- velocity to a maximum near 50 km s""^ 

tation on the lowest luminosity stars and then declines at higher velocities. 

likely to be so observed. Greenstein has The frequency of Hg]\In stars decreases 

been able to locate and observe numer- monotonically from 60% of the sample 

ous fainter red M 'stars discovered by for ?; < 10 km s"^ to zero at v ^ 100 

W. J. Luyten of the University of Min- km s~^. Thus slow rotation appears to 

nesota on the Luyten-Palomar Schmidt be a necessary but not sufficient condi- 

(LP) proper-motion survey. These ob- tion for the occurrence of the abundance 



134 



CARNEGIE INSTITUTION 



anomalies of the HgMn stars. A second 
parameter, vol to bo identified, must be 
involved. 

Red Giants in Globular Clusters 

Zinn and John Xorris of Mount Stromlo 
Observatory have completed a spectro- 
scopic search of the globular clusters 
M13. M15. M92. and NGC 6397 for red 
giant stiirs that have unusually strong 
or weak CH and CN bands. In a sepa- 
rate study. Zinn has completed a similar 
survey of ^15. 

These surveys have revealed that 
roughly 80*^ of the asymptotic branch 
stars in each of these clusters have un- 
usually weak G-bands (the CH band at 
4310 A I. which confirms the results of 
Zinn's earlier, less extensive survey of 
M92. In addition, a milder G-band vari- 
ation has been detected among the stars 
on the giant branch at roughly the mag- 
nitude of the horizontal branch. To see 
if these G-band variations are the result 
of a variation in metal abundance, Norris 
anrl Zinn obtained intermediate-band 



photometry of selected stars in M13, 
M15, and M92 with the 5-meter Hale 
telescope. These observations did not de- 
tect a dift'erence in metal-line blocking 
among stars of widely different G-band 
strengths, which suggests that the weak- 
G-band effect is produced by stellar evo- 
lution and not by primordial inhomo- 
goneities within the clusters. Norris and 
Zinn believe the weak-G-band effect is 
caused by a mixing process that mixes 
the outer parts of a star with its interior 
regions that have been depleted of car- 
bon by the CN cycle. To explain the G- 
band variations seen on both the giant 
branch and the asymptotic branch, it 
seems necessary to hypothesize that mix- 
ing occurs at least twice during a star's 
giant-branch evolution. Although none 
of the theoretical calculations of stellar 
evolution predict the weak-G-band effect, 
the observational data seem to suggest 
that mixing occurs first on the lower 
giant branch when a star's surface- 
convective zone attains its greatest in- 
ward extent and again at the tip of the 
giant branch during the helium-core flash. 



STELLAR CHROMOSPHERES 



Instrument for the Study of 
Stellar Chromospheres 

In June of 1975, Vaughan, Preston, 
and 0. C. Wilson as principal investiga- 
tors received a grant from the National 
Aeronautics and Space Administration 
for construction of an instrument de- 
signed specifically to measure stellar 
chromospheric H- and K-line fluxes. The 
instrument was successfully put into 
operation in April 1977 at the Cassegrain 
focus of the 1 .6-meter telescope on Mount 
Wil.<on. A single photomultiplier is used 
to measure sequentially, at a chopping 
frequency of about 30 Hz, the light flux 
in each of two bands of 1 A width at the 
wavelengths of Ca II H and K and in 
each of two bands of 20 A width in the 



continuum longward and shortward of 
H and K. This is accomplished by a 
dedicated third-order grating spectrom- 
eter of modified flat-field Ebert config- 
uration and an associated microprocessor- 
controlled data system. By offsetting the 
position of the entrance slit of the spec- 
trometer, whose dispersion is 4.35 A 
mm~^ and whose zero-point wavelength 
is known with reference to a hollow 
cathode source emitting Ca II H and K, 
the observer can introduce a precise 
Doppler-shift correction to the wave- 
length of each observed star. Simplicity, 
rugged construction, and the relatively 
specialized nature of the instrument are 
features intended to promote efficiency 
and long-term stability in measurements 
of stellar chromospheric activity. 



HALE OBSERVATORIES 



135 



The measured data from observations 
made at the 1.5-mctcr telescope, in col- 
laboration with Wilson at the 2.5-meter 
telescope, were transferred to the scale 
of mean H-K fluxes developed for main- 
sequence stars over the past decade by 
Wilson with a digital system at the 2.5- 
meter coude spectrograph. Extension of 
Wilson's long-term study of normal 
main-sequence chromospheric variability 
to the new instrument is thus assured. 



Flare Stars 

A faint dM4e star discovered by Bond 
on the University of Michigan objective- 
prism survey plates flared by nearly 8 
magnitudes. Greenstein has used the 
multichannel spectrophotometer and the 
SIT-Vidicon to study the outside flare. 
He finds evidence of substantial altera- 
tion of the energy distribution in the 



ultraviolet. The Balmer emission lines 
should be accompanied by a Balmer re- 
combination continuum, which was, in 
fact, observed as a flattening out of the 
stellar flux in the ultraviolet and possibly 
a veiling of the absorption lines. A model 
for this star's chromosphere suggests 
quite high density, a temperature of the 
order of 20,000°K, and probably con- 
tinuing activity between major flares. 

In the calibration of the lower main 
sequence by the multichannel spectro- 
photometer for parallax stars, it has been 
found that those known to be strong 
emission-line or flare stars give the 
largest dispersion in a luminosity-color 
diagram. It is possible that the overlying 
nonthermal continuum affects the ob- 
served stellar flux to a wavelength as long 
as 4500 A. This is consistent with older 
observations in which the broad-band 
colors U — B, B — V showed abnormal 
scatter among late M dwarfs. 



MILLIMETER-BAND PHOTOMETRY 



One-Millimeter Photometry of 
Extragalactic Objects 

For the past three years a program of 
photometry of extragalactic objects at A 
=1 1 mm has been conducted in twilight 
hours from the prime focus of the 5- 
meter Hale telescope by members of the 
infrared group. This is the most syste- 
matic study of extragalactic objects yet 
carried out at this wavelength and the 
first which permits a search for 1-mm 
variability. The results of the first three 
years of this work have been prepared 
for publication by graduate student J. 
Elias. 

A total of 23 extragalactic objects have 
been observed at 1 mm, and 9 have been 
detected. Those detected include two, the 
galaxies NGC 253 and NGC 1068, from 
which the 1-mm emission appears to be 
thermal radiation from dust. The other 



seven sources detected appear to be emit- 
ting nonthermal radiation at 1 mm. These 
objects are 3C84, 30111, 3C120, 3C273, 
3C274(M87), 3C279, and BL Lacertae. 

Thermal Sources 

The 1-mm fluxes for the thermal 
sources lie on an extrapolation of the 
strong far-infrared emission observed 
from these galaxies and attributed to 
thermal emission from dust. The 1-mm 
data have been used to produce estimates 
of the mass of dust and gas in the central 
regions of the galaxies. The mass of gas 
is in good agreement with that inde- 
pendently estimated by radio astronomers 
who have observed CO emission from 
the same sources. This agreement appears 
to support the assumption that the CO 
emission from these galaxies is not hea^^ly 
saturated. 



136 



CARNEGIE INSTITUTION 



2 
1.5 



I - 



0.5- 



-3 



05- 



o 



05 
1.5 



I- 



WAVELENGTH 
lOcm Icm Imm 100/J.m lOcm Icm Imm 100/j.m 



_ 


I 1 




I 




I 






O 






3C84 















- 










I- 


- 


• 








3CMI 




• a 


a 


1 




























3CI20 _ 




• • □ 


a 


^ 






- 


• • 

D 


D 






3C273 


- 


1 


1 


o 


1 


\ , 





1 1 




1 1 

M87 (3C274) 


2 


• 






15 


• 

A 




" 


1 


— 


▲ 


{ 


0.5 


- 




1 


• • □ 




3C279 






D 


i 


05 


- 




- 


1 


- 




BL Lac 


0.5 


• • ° 


D 


i 





1 1 


1 


1 1 



13 
LOG 1/ 



9 
HZ 



10 



Fig. 3. Spectra of nonthermal sources. The open circles are the 1-mm measurements made 
on the 5-meter telescope. The plotted jQuxes at each wavelength are those measured in January- 
Februarv 1976. 



Xonthermal Sources 

The energy distributions of the non- 
thermal sources are shown in Fig. 3; the 
1-mm flux measurement from the 5-meter 
telescope is given by the open circle. Note 
that for each source the 1-mm flux is 
consistent with what would be expected 
from a smooth extrapolation of the longer 
wavelength radio spectrum. Fig. 4 shows 
for several objects the measured 1-mm 
fluxes against time, and for comparison 
the 2.1 -cm radio fluxes as a function of 
time. Four of the sources, 3C84, 3C120, 
3C273, and BL Lac show formal evidence 
for variability. The evidence is most sig- 
nificant statistically for BL Lac; note 
also that this source varies by more than 
a factor of 2 in 1-mm flux and that the 
1-mm and 2.1-cm flux variations are well 
correlated. 



The principal result of the work on 
nonthermal sources at 1 mm is that there 
is no evidence in these objects for the 
common occurrence of very compact 
components that radiate chiefly at 1 mm 
and shortward. This conclusion follows 
from the good agreement of the 1-mm 
flux with the extrapolated radio spectrum 
(Fig. 4). It is supported by the fact 
that no strong variations are seen at 1 
mm that are not correlated with longer 
wavelength variations. A second major 
result is that although some variations 
occur, strong 1-mm variability is not 
invariably present in compact, nonther- 
mal extragalactic objects. For example, 
none of 18 separate measurements of 
3C273 over a period of three years shows 
convincing evidence for a value of the 
flux that deviates by more than 50% from 
the mean value for this time interval. 



HALE OBSERVATORIES 

~1 



137 



—;> 

X 

ZD 



60 
40 
20 

20 
10 

60 
40 
20 



20- 



10 







• •••••••• 



« •• • • 



U 



3C84 



I \ 



3CI20 



• • 



* • • • * • 

• • • • • 



3C273 



»• • 



• •••• • • . 



M 5^ J . 



3C279 



• • 



'd^ 



§ 



• • • 



•* - 1 •••'••••.^*^< 



^?^* 



§ 



BL Loc 



1975.0 



1976.0 
DATE 



1977.0 



Fig. 4. 1-mm fluxes plotted against time for selected objects (open circles). Also shown are 
2.1-cm observations (filled circles) kindly provided by Dr. H. Aller of the University of 
Michigan. 



Observing Procedures 

The absolute flux measurements de- 
scribed above were possible only because 
considerable effort was expended in es- 
tablishing a calibration system for these 
observations and verifying its reliability. 
For observations at 1 mm, this presents 
special difficulties because of the large 
fractional bandwidth (A/ A A ^ 1) used 
for the observations and the large and 
variable extinction due to atmospheric 



water vapor. However, it is believed that 
the uncertainties in the flux determina- 
tions due to possible systematic calibra- 
tion errors are no greater than 20% for 
1-mm observations on the 5-meter tele- 
scope. The sensitivity of the detector 
system now in use permits a lo- limiting 
flux of about 1 Jy (=10-26 W m-^ 
Hz-^) in one hour of observing under 
typical observing conditions, and most 
of the extragalactic objects detected have 
fluxes < 5 Jy at 1 mm. It is hoped that 



13S 



CARNEGIE INSTITUTION 



the sensitivity will be improved dramati- 
eally in the near future to permit l-nim 
observations of a niueh more extensive 
set oi extragalaetie objeets. 



Submillimctcr Heterodyne Spectroscopy 

A new proi^ram of heterodyne spec- 
troscopy at submillimeter wavelengths 
lias been begun at the 5-meter Hale tele- 
scope in a collaboration between Drs. 
T. Phillips and P. Hiiggins of the Bell 
Telephone Laboratories and Werner and 
Xeugebauer. It has resulted in the first 
detection in an astronomical source of 
the J = 3^.1 = 2 CO line at 345 GHz. 
The receiver, based on an InSb hot- 
electron bolometer mixer, is mounted at 
the prime focus of the telescope. Both 
twilight and nighttime observations have 
been made with this system. The 3^2 
CO line has been mapped over the central 



few arcminiites of the Orion Molecular 
Cloud. Broad ('-^40 km s~M velocity 
wings are seen on the line profile at the 
center of the soiu'ce; these wings are 
much more pronoimced than are the 
similar wrings seen in the 2->l and l->0 
lines, suggesting that the emission comes 
from a small, optically thin cloud of CO. 
The good beam profile and precise point- 
ing obtainable at this frequency with the 
5-meter telescope permitted us to demon- 
strate that the high-velocity CO emis- 
sion is confined to the central 30'' of the 
source and that the emission peak is 
within 10'' of the Becklin-Neugebauer 
and Kleinmann-Low infrared sources. 

In addition to the Orion observations, 
3-^2 CO line emission has been detected 
from Ml 7 and from the shell of molecular 
gas around the carbon star IRC4- 10216. 
Additionally, the J = 3-^2 emission 
lines of HCN and HCO+ at 270 GHz 
have been detected in the Orion region. 



GLOBULAR CLUSTERS 



Gunn and Dr. R. F. Griffin of Cam- 
bridge Observatories, England, have com- 
pleted their observations and analysis of 
M3. using 108 high-accuracy radial 
velocities of individual giants in the 
cluster obtained with their cross-correla- 
tion spectrometer. The cluster has been 
modeled with a multicomponent King- 
type distribution function w^ith anisot- 
ropy a la Michie. It is clear that the 
velocity dispersion falls off much more 
rapidly with radius than predicted by 
i.sotropic models, and the best fits have 
been obtained with models whose anisot- 
ropy radius is about 15 core radii, at 
which point the two-body relaxation 
time to deflections is roughly the Hubble 
time. The mass-to-light ratio is higher 
than generally suspected — about 3 in 
visual solar imits for the cluster as a 
whole. This high ^}/L must reside in 
part in dark remnants of mass compara- 
ble to the turnoff stars and giants, though 



much of it must be in an extended lower 
main sequence wdth a quite steep mass- 
function. One important result is that 
there is very little mass in remnants with 
individual masses much in excess of the 
turnoff mass, and there is some difficulty 
in accommodating even 1.2 WIq white 
dwarfs and neutron stars in their ex- 
pected numbers. The velocity dispersion 
"hole" in the center persists but is of 
marginal statistical significance. 



Infrared Studies of Red Giants in 
Globular Clusters 

Persson, Dr. J. Cohen of Kitt Peak 
National Observatory, and Dr. J. Frogel 
of Cerro Tololo Interamerican Observa- 
tory completed an infrared study of a 
selection of red giant stars in the globular 
clusters M92, M3, and M13, and in M67. 
The observational data, which consist of 



HALE OBSERVATORIES 



139 



narrow-band CO absorption indices and 
broad-band colors, were obtained with an 
InSb system on the 5-meter telescope. 
The broad-band colors were compared 
with a new set of model-atmosphere 
fluxes computed for metal-poor stars. An 
important result of this comparison is 
that V — K colors (i.e., V — [2.2 /x]) 
give a measure of stellar effective tem- 
perature that is essentially independent 
of metal abundance or surface gravity. 
(This is because the H~ opacity is domi- 
nant at both wavelengths.) The accuracy 
attainable by this technique is currently 
±100°K in Teff, and can be improved. 
The stellar energy distributions were in- 
tegrated to derive bolometric magnitudes 
directly from the data, and thus a theo- 
retical HR diagram (log L/L^ versus 
log Teff) was constructed and compared 
to the predictions of published models. 
The shape and location of the theoretical 
tracks, the dependence on metal/hydro- 



gen ratio, and the location of the red 
giant tip are in good agreement with the 
observational results. 

Because of the importance of Rayleigh 
scattering in the metal-poor atmospheres, 
B — V becomes sensitive to surface 
gravity and can be used to derive crude 
values for log g. With derived values of 
T'eff and L/Lq, one can then derive 
masses from the photometric data. These 
masses are consistent with turnoff masses. 
Refinement of the models and data could 
lead to substantial improvement in these 
determinations. 

The CO absorption data show clearly 
that the clusters are ordered in the se- 
quence M92, M13, M3 (toward increas- 
ing CO). This agrees with the ordering 
in the HR diagram. Metal-abundance 
determinations, however, give the order- 
ing as M92, M3, M13. The conclusion 
is that CNO abundance variations can 
be different from those in Fe. 



INTERSTELLAR MATTER AND GASEOUS NEBULAE 



The infrared source in the so-called 
Red Rectangle connected with HD 44179 
was observed with the multichannel 
spectrophotometer by Greenstein and 
Oke. Unlike all other reflection nebulae 
observed, the nebula is appreciably 
redder than the star. The other peculiar 
feature in the Red Rectangle is the 
presence of a very large increase in flux 
centered on A6500 and about 1500 A wide. 
Although this is near Ha, it is almost 
certainly not hydrogen but a feature of 
the reflectivity of the dust near that star. 
The usually accepted model, a torus in 
the line of sight that obscures light di- 
rectly from the star but lets it leak out 
to illuminate dust in the plane of the 
sky, has been analyzed in some detail 
with the radiative-transfer methods de- 
veloped by Chandrasekhar for the illumi- 
nation of atmospheres by an external 
source. Using the so-called exact solu- 
tions to this theoretical problem, Green- 



stein and Oke find that the high flux 
scattered in the red requires a large in- 
crease in the albedo of the dust. Since 
so many geometrical factors are un- 
known, for example, the distance from 
the star to the nearest point of the nebula 
we can see, a most favorable case can 
be constructed in which the albedo is in 
general near 0.4 but rises to 0.7 in the 
red. If on the other hand, the illumina- 
tion properties of the dust are less favor- 
able, that is, if the dust is at a greater 
distance from the star, a larger albedo 
is required. Quite modest changes in the 
assumed model result in an albedo in 
the red which exceeds unity and a gen- 
eral albedo in the rest of the spectral 
range 0.6 to 0.7. Four other observed 
reflection nebulae with stars showing 
infrared excesses fail to display this 
peculiar high red reflectivity. The min- 
erals in the dust cannot be identified 
from the single observation of high re- 



140 



CARNEGIE INSTITUTION 



flectivity in the rod; the redness would 
be that of a brilliant red paint but with 
higher reflectivity than most known ma- 
terials. One interesting but speculative 
{.x)ssibility. drawn from the literature on 
the reflectivities of minerals, is that some 
com{^ounds containing manganese have a 
peculiarly strong red fluorescence. 

Planctanj Xcbulae 

De Bruyn. in collaboration with G. 
Wouterloot and Dr. J. H. Oort of Leiden 
Observatory, used the 1.2-meter Schmidt 
to take plates through an Ha-interference 
filter of 80 A bandpass of several fields 
close to the galactic center. Matching 
short-exposure red continuum plates 
were also obtained. The plates will be 
used to search for planetary nebulae at 
the positions of weak radio sources de- 
tected in these fields with the Wester- 
bork radio telescope. There appears to 
be an excess of such weak radio sources, 
compared to the general field, and they 
have the flux density typical of planetary 
nebulae at the distance of the galactic 
center. It is expected that many new 
planetary nebulae, most of which will be 
heavily reddened, will be discovered 
down to distances as small as 30' from 
the galactic center. 

One-Millimeter Photometry of the 
Crab Xebula 

A study at 1 mm has been completed 
by Werner, Neugebauer, and associates. 



The nebula was mapped at this wave- 
length with 1' resolution in twilight ob- 
servations from the prime focus of the 
5-meter telescope. The peak 1-mm sur- 
face brightness, 15 ±: 3 Jy into the 1' 
beam, is seen in the center of the nebula 
at or near the position of the pulsar; the 
distribution of radiation around this peak 
is roughly elliptical, with half-power 
width ~2'5 X 4'5, and with the long axis 
lying northwest-southeast. This result is 
in agreement with the size and shape of 
the nebula as determined at longer wave- 
lengths. This agreement has been used 
to estimate the flux expected from the 
faint outer regions of the nebula. On this 
basis, the total 1-mm flux from the Crab 
Nebula is found to be 300 d= 80 Jy. 

At wavelengths longward of 1 cm, the 
total radiation from the Crab Nebula is 
well described by the power law Sv oc 
J,- 0.26 j^^ extrapolation of this spectrum 
to 1 mm predicts a total flux of 230 Jy; 
the value we have determined is in good 
agreement with this and does not agree 
with previous reports of millimeter-wave- 
length fluxes far in excess of the extrap- 
olated power law. We thus find that both 
the total 1-mm flux from the Crab 
Nebula and the spatial distribution of 
the 1-mm radiation are consistent with 
expectations from radio-wavelength ob- 
servations. These results, therefore, indi- 
cate that the emission from the Crab 
Nebula down to wavelengths as short as 
1 mm can be attributed to synchrotron 
emission from a single distribution of 
electrons. 



PULSARS 



Secular Decrease in the Visible 
Intensity of the Crab Pulsar 

A.- thf- rf'.<^ult of a long-term program 
of monitoring the visible intensity of the 
Crab pulsar, Kristian has found it to be 
slowly decreasing with time. The exact 
amount of this dimming should provide 



a test for several competing theoretical 
models of the pulsar emission mechanism 
which make quantitative predictions for 
such an effect. The data have not yet 
been completely analyzed, but prelimi- 
nary results indicate an intensity de- 
crease of 0.5% per year, which is about 
the 10th power of the rate at which the 



HALE OBSERVATORIES 141 

pulsar is slowing down. This appears to recent detection of the Vela pulsar at 

favor an emission mechanism proposed V > 25 mag by a group at the Anglo- 

by F. Pacini, and is consistent with a Australian Observatory. 



X-RAY SOURCES 

The transient x-ray source A0620-00, Lasker of Cerro Tololo Interamerican 

which appeared in the summer of 1975, Observatory, made a search for pulsa- 

has been followed since that time by Oke. tions of the He II A4686 emission line 

The most recent observations, made in in Sk 160 (SMC X-1). For one-hour ob- 

November 1976 and February 1977, show serving runs on each of three nights with 

the object only slightly brighter {V = the CTIO 1.5-meter telescope, upper lim- 

18.4) than before the outburst. A study its (95% confidence) of the pulsed frac- 

of the spectrum indicates the presence tion of line emission were approximately 

of a cool star of spectral type K5 to K7 30%. The presence of the He II A4686 

and probably of luminosity class V, line and its radial velocity behavior sug- 

which yields a distance for A0620-00 of gest a connection with the x-ray source, 

900 pc. In addition to the cool star spec- as is the case also for Cygnus X-1. The 

trum, there is a weak spectrum of the implications of this limit for the mecha- 

form fv = const, which can be modeled nism of He II A4686 emission are being 

by adding a 10,000°K blackbody of studied. 

radius (if spherical) of 1.7 X 10'^ cm With Shectman's photon-counting 

and a 4000°K blackbody of radius 13.4 linear-array detector and the Mount 

X 10^ cm. This is probably a small Wilson 2.5-meter coude, Petro has repeti- 

residual accretion disk. Since there is tively obtained 10-second spectra of X 

now strong evidence for a 7^8 binary Persei at Ha. Previous observations (by 

period, the cool star does not fill its Roche Campisi et al., Mon. Notic. Roy. Astron. 

lobe, and it is not obvious why mass Soc, 176, 225, 1976; Murdin et al., Mon. 

transfer occurs. One possibility is that Notic. Roy. Astron. Soc, 176, 233, 1976) 

the cool star is a giant, but this is un- had shown abrupt decreases in hydrogen 

likely. A second possibility is that the emission with a 10-100-second time scale. 

cool star is losing mass for reasons other Petro 's 24 hours of X Per Ha monitoring 

than its binary character. revealed no equivalent-width changes 

Wade and Oke have completed a study greater than 5%. The data are now being 

of the transient x-ray source A0535-|-26 analyzed for Ha variation on the 3U 

(= HDE 245770), using multichannel 0352+30 periods of 13.9 minutes and 

and SIT digital spectrograph data. The 22 hours. 

star, which did not change significantly An interesting new application of the 
when the x-rays turned on, is of spectral modern technologies available with the 
type BO and is probably of luminosity spectrographs of the Hale reflector has 
class III. The reddening Eb-v = 0.80 resulted from extensive studies of A^I 
and the distance 1.8 kpc. The x-ray flux, Herculis by Greenstein. This star had 
even at its peak, produces so little energy become brighter, was detected as an x-ray 
compared to that of the B-star itself that source by Drs. D. R. Hearn, J. A. Rich- 
one would not expect to see brightness ardson, and G. W. Clark of the ]Massa- 
variations correlated with the x-ray flux ; chusetts Institute of Technology, and 
no variation at the 104^ x-ray period has been extensively studied at many 
was found. observatories. The continuum shows 

Petro, in collaboration with Dr. Barry strong circular polarization, and there is 



142 CARNEGIE INSTITUTION 

also a high degree of linear polarization; have some persistent sharper compo- 

both are variable with phase in an orbit nents of velocity within itself. However, 

whose ^HM'iod is slightly over 3 hours. The the sharp line is very intense and moves 

light-curves are veiy complex, and the with only about one-tenth the amplitude 

minimum, if interpreted as an eclipsing of the broad line, 180° out of phase. If 

systom. is out of phase with the radial the velocity amplitudes indicated in this 

velocity and with the periodic variations diagram represented material attached 

of the linear and circular polarization, to the two stars in the system, the mass 

Observations by Greenstein and Rich- ratio would be 6 to 1, requiring that one 

stone with the Cassegrain SIT spectro- of the objects be a neutron star or black 

graph indicated that the lines had rela- hole! It is, however, not probable that 

tively sharp cores and some broad wings, these are genuine stellar velocities but 

The Balmer continuum is strong in emis- represent instead motions of gas in the 

sion. as observed with the multichannel intense magnetic field of the degenerate 

spectrophotometer by Greenstein. At star, as well as in the gravitational field 

Greenstein 's suggestion. Shectman made of the two stars (of which we have not 

observations over a fraction of the cycle yet seen any trace). A further conclusion 

at the coude spectrograph, using his to be drawn from the relative sharpness 

linear detector array at the 9 A mm~^ of the lines is that the material cannot 

dispersion. These immediately revealed, be too close to the highly magnetized 

for A4686 of He II. that the line had a white dwarf, whose surface field of over 

sharp peak and a very broad extended 10^ gauss would broaden and shift the 

wing, reaching velocities up to —1000 lines completely into invisibility. Arriv- 

km s~^ When the star reappeared, ob- ing at a convincing model of this fas- 

servations around a complete cycle and cinating system will be extremely difficult. 

parts of two other cycles w^ere made by Although not yet known to be x-ray 

Sargent and Dr. A. Boksenberg, using binaries, several other eruptive or cata- 

the University College London Image dysmic variables have been studied at 

Photon Counting System (IPCS) in the high galactic latitudes. Some may be 

coude spectrograph. These observations simply U Geminorum binaries, but it is 

are being analyzed by Greenstein and interesting that they occur at great 

T. A. Boroson, a former Caltech under- heights from the galactic plane. One 

graduate and now a student at the Uni- ^^^^^ ^y Arp is a faint blue object that 

versity of Arizona The raw data show j^ ^^j ^^^^ magnitude on the Palo7nar 

that A4471 of He I and A4686 of He II ^^ '^ J ^^^ ^^^^^^^ ^^ ^^^ 

both contam a rather sharp strong core * ^.u +• ^ i,u ^ ^ aat 

, . ., , ^ 1 Another magnetized w^hite dwari, AN 

whose intensitv may vary but whose tt iv/r-- ur-xii, ix 

. ^ , *^,. , , / J Ursae Maioris, much fainter than but 
position varies onlv slightly, and a very ^, . *■ ', ,. atvt tt t 

{ , • r u'^- I 1 -x J. • 1 otherwise resembling AM Herculis, may 

broad wing of high- velocity material , %^ , , i 

,, ^ ■ u 4.-L ^ ( I. }■ be an x-ray source. It has much weaker 

that moves in both stages of helium ^ , -^ ,. . . . , 

.• • -i. u 4. 4-u -L Balmer continuum emission and lower 

ionization m opposite phase to the sharp . . .... „ 

core. Figure 5 is a reproduction of a excitation emission-line spectrum from 

computer plot of the IPCS material from Greenstein s multichannel spectropho- 

one cvcle. It shows isophotes of the ^^"^^^ ^"^^ ^IT results. The star PG- 

A4686 line as a function of orbital phase. 2337+12, discovered by Caltech graduate 

It confirms in full Shectman's discovery student R. F. Green and already reported 

of the high-velocity gas and shows that on by Green, Greenstein, and Boksen- 

to the contour levels here plotted (about berg, has been followed by Greenstein, 

200 counts per channel above the con- who observed it at a very low luminosity, 

tinuumi, the broad helium line sweeps This erratic variable, which looked 

from —800 to -|-600 km s-^ and may originally like a white dwarf with weak 



HALE OBSERVATORIES 143 

VELOCITY km s"' 

-800 -400 400 800 

I n 

0.4 



0.3 



0.2 



0.1 



UJ 
if) 
< 

t 0.0 

o 

h- 

LjJ 



CD 
< 



0.9 



0.8 



0.7 



0.6 



AM HER 
X4686 



AFH E D ED C B A 




Fig. 5. The He II line X4686 in the x-ray magnetic binary AM HercuHs, observed 
at high resolution with the coude spectrograph of the Hale reflector at Palomar Mountain. 
The (vertical) phases are fractions of the 3-hour period measured from the phase of maximum 
linear polarization ; velocity is plotted horizontally. The drawn lines are isophotal contours 
of the emission line (with continuum subtracted). Counts for contours A to D are 200-500; 
E to J, 600-1600. Note the broad feature moving with about 300 km s"^ amplitude, arising 
in gas streams with a large velocity spread, and the sharp feature moving in a nearly opposite 
direction with 75 km s'^ amplitude. The x-ray eclipse occurs near phase 0.14 when the gases 
producing the sharp component are farthest from the observer. 

hydrogen emission lines, at minimum re- bright is concealed by an accretion disk, 

sembles a low-metal-abundance sdK star When space observations are possible to 

in energy distribution. At minimum it lower x-ray flux levels, many such ob- 

has the color and absorption lines of a jects may well prove to have x-ray 

quite cool object, which when the star is emission. 



144 



CARNEGIE INSTITUTION 



SUPERNOVAE 



The supernova search with the 46-cm 
Schmidt telescope was conducted by 
Kowal and Wade, under the supervision 
of Sargent. In August 1976, a 14th mag- 
nitude supernova was found by Wade in 
NGC 5427. This was onlv the second 



supernova to be found in any of the 
program's Sc I galaxies in the past six 
years. Forty Sc I galaxies are included 
in this search. 

A spectrum by Oke shows the super- 
nova to be of Type I. 



THE GALAXY: ITS HALO AND GLOBULAR CLUSTERS 



^fetal Abundances in Globular Clusters 

Searle and Zinn have completed their 
program of mapping the spatial distri- 
bution of globular clusters of different 
metal-abundance with the Galaxy (see 
Year Book 75, p. 299). They have ob- 
tained accurate metal abundances for 19 
clusters. The major result of this study 
is that some distant clusters such as 
Palomar 5, NGC 6229, and NGC 7006 
are not as metal deficient as had been 
thought and as would be expected if a 
gradient in metal abundance existed in 
the Galaxy's outer halo. 

Zinn and Searle have also found that 
the so-called second parameter effect (the 
fact that the morphology of a cluster's 
color-magnitude array depends on some 
factor in addition to metal abundance) 
is closely related to a cluster's location 
within the Galaxy. Among clusters of a 
particular metal abundance, those w^ith 
bluer horizontal branches are more 
tightly bound to the Galaxy than those 
with red horizontal branches. The second 
parameter is thought to be either an 
abundance effect or an age effect. Be- 
cause a gradient in the abundance of the 
hea\'y elements is not found in the halo, 
Zinn and Searle think it unlikely that 
there is a gradient in He, C, N, or 
(which are the relevant elements in this 
context!, and therefore lean toward the 
view that the second parameter must be 
the age of the clusters. 

Trying to understand these new results, 
Searle and Zinn have been led to a hypo- 



thetical model for the formation of the 
Galaxy's system of globular clusters. 
They imagine cluster formation proceed- 
ing before the Galaxy itself formed in 
an initially gaseous protogalaxy contain- 
ing large and growing density fluctu- 
ations. These fluctuations or fragments 
undergo independent chemical evolution. 
Cluster formation begins in massive frag- 
ments near the center of the protogalaxy 
where, initially, metal-poor clusters are 
formed. As the protogalactic gas in these 
central fragments becomes progressively 
enriched in metals (as the result of 
supernovae explosions), more and more 
metal-rich clusters form. All the clusters 
formed in these central massive frag- 
ments eventually collapse to form the 
tightly bound system of clusters of the 
Galaxy's central bulge. The outer parts 
of the protogalaxy take longer to collapse 
because of the general Hubble expansion 
of the LTniverse. Cluster formation even- 
tually occurs in the less massive frag- 
ments of the outer protogalaxy. The 
supernova explosions that occur in these 
disperse the gas before much enrichment 
can occur, so that only relatively metal- 
poor clusters form from them. Individual 
variations in the enrichment history of 
different fragments during this era of 
halo-cluster formation, together with 
their free-fall collapse, explain why an 
abundance gradient is not found in the 
loosely bound clusters of the Galactic 
halo. To explain the phenomena associ- 
ated with the second parameter, the time 
difference between formation of the bulge 



HALE OBSERVATORIES 14o 

and halo clusters must be roughly 10® <t(^Y) < ± 0.08 if (7) = 0.3, 

years. and 

As part of a continuation of these in- u{hZ/Z) < ± 0.16. 

vestigations, Zinn has developed a method These are very small limits. Hence, dif- 

of measuring the metal abundance of ferent parts of the Ml 5 protocloud could 

globular clusters from photometry of not have been enriched significantly 

their integrated light. Zinn's method, differently in metal or in helium abun- 

which is reddening-independent, yields a dance than other parts during the proto- 

difference of roughly 0.5 mag between cloud collapse and fragmentation in the 

the metal-poor cluster M92 and the formation process. 

metal-rich cluster M71. So far more than A secondary result of these faint pho- 

60 clusters in the Galaxy have been tometric studies is that lists of B and 

measured, primarily with the 1 -meter Y magnitudes to very faint limits are 

Swope Telescope at Las Campanas. available for large numbers of stars in a 

compact area (22 □' for the M15 fieldj 
for M15 and M92. These fields should 

M15 Main-Sequence Photometry .^^^ ^^^^.^^ ^l ^^'^ ^f f ^ ^,°^ ^^""fT'^'^l^^ 

television-type detectors oi the Ibli, 

Faint B and V photometry of many SIT, SEC, or CCD types where linearity 

stars in the globular clusters M15 and and homogeneity over the field require 

M92 has been completed by Sandage and calibration. 

Katem in an effort to determine the in- A by-product of the M15 photometry 
trinsic width of the main sequences. The is a catalog of very faint (V > 18), very 
photometry covers the range 18 < F < red (\_B — F] > 1.4) field stars in the 
22, 18 < B < 23 in both clusters and is 22 Q' area. These must be foreground 
based on photoelectrically calibrated se- red dwarfs. Their number per square 
quences and five photographic plates in degree per unit magnitude interval pro- 
each color. vides data necessary to model the density 

The result for M15, published during gradient perpendicular to the galactic 

the report year, show a well-defined main plane for such dwarf stars that are in 

sequence with a turnoff at 7 — 19.0; the the range +8 < M^ < +12. The num- 

observed width in the color-magnitude ber of stars in the M15 field is so small 

diagram can be entirely accounted for as to require a steep density gradient of 

by the known errors of measurement, d logD {z) / dz ^=z — 1.4 (^ in kpc), similar 

The errors were determined from the to that required to explain Becker's 

internal scatter of individual values for photometry of very faint stars in SA57 

the five plates in V and B for each star and similar to Weistrop's results in the 

in each color in each half-magnitude bin interval 300 < 2 < 2000 pc. This gradi- 

from F = 18 to F = 22. ent corresponds to an i folding scale 

Because the main-sequence position is height of 310 pc, showing that the fore- 

a function of the helium abundance (F), ground M stars are members of the old 

and because the subgiant-branch position disk population rather than the extended 

is a function of the metal abundance halo where the gradient is so much more 

(Z), intrinsic widths of these two se- shallow at d log D{z)/dz — —0.1 {z in 

quences put limits on permissible varia- kpc). A more extensive catalog of faint 

tions of Y and Z in M15 itself. Observed red stars is being prepared as a part of 

limits on the widths, together with the the faint Selected Area halo mapping 

equations that describe sequence position project begun during the report year and 

as functions of Y and Z, give the observa- described under ^^Quasars and Quasi- 

tional limits on any chemical inhomo- Stellar Objects." Analysis of the larger 

geneity in the M15 collapsing protocloud: material is expected to give better values 



146 



CARNEGIE INSTITUTION 



for the disk gradient and for the disk- 
halo popiihition ratio. 

Color Magnitude Diagram of 
Two Remote Halo Clusters 

Color-magnitude diagrams of globular 
clusters in the galactic halo give infor- 
mation on metal abundances, and hence 
data on details of the well-established 
systematic metal-abundance difference 
between the disk and halo of our Galaxy, 
Studies of metallicity as a function of 
distance from the plane can test for the 
presence or absence of a gradient in 
metallicity within the halo and/or the 
spottiness of the enrichment process dur- 
ing the halo collapse. 

NGC 5053 

With these problems in mind, Sandage, 
Katem. and Dr. Harold L. Johnson of 
the Steward Observatory prepared for 
publication their 1963 study of the dis- 
tant halo cluster XGC 5053. The color- 
magnitude diagram was obtained using 
a photoelectric sequence of 37 stars in 
the interval 9.7 < V < 17.1 and from 
photographic measurements of three 
plates in each color. The horizontal 
branch is at T^ = 16.63. The reddening is 
small for this verv high-latitude cluster 
(6 = + 79°) at EiB - V) = 0.01 ± 
0.02, which, with M.ARR) = + 0.6 
assumed, gives a distance of 15.8 kpc 
from the sun and a height above the 
plane of Z = 15.6 kpc. 

The intrinsic color of the subgiant 
branch at the level of the horizontal 
branch is (B — F)o.,, = 0.68 ± 0.02 
which is the bluest known value for any 
well-observed cluster. Because this color 
is strongly dependent on metal abun- 
dance, the blue value shows that NGC 
5053 is among the most metal-poor 
clusters known. 

The large linear diameter shows that 
the cluster has never been closer to the 
galactic center than ^15 kpc, since 
otherwise the galactic tidal field would 



have stripped the outer stars and reduced 
the linear diameter. Therefore, the very 
low metal abundance must be representa- 
tive of the halo material out of which this 
particular cluster was formed at this very 
large perigalactium distance or beyond. 
NGC 5053 is an intrinsically faint 
globular cluster in the Galaxy at M.^^ = 
—6.2. However, star counts show that 
the luminosity function is normal (com- 
pared with M3), and that the reported 
giant-poor nature of the cluster is due 
to the small number of stars rather than 
to any abnormality. 

The Remote Serpens Cluster Palomar 5 

A very faint globular cluster was first 
discovered at ^50 = 15^ IS'PS, 850 = 00°05' 
by Baade on 1.2-meter Schmidt plates 
before the National Geographic-Palomar 
Sky Survey began, and is like a dozen 
such new clusters discovered during the 
survey that are among the intrinsically 
faintest globular clusters known. The 
color-magnitude diagram for Palomar 5 
was obtained by Sandage and Hartwick 
in 1969 as part of their halo-mapping 
project, and was prepared for publication 
during this report year. 

The CM diagram is based on a UBV 
photoelectric sequence of 29 stars in the 
interval 13.4 < V < 18.6 and on two 
photographic plates in B and in V colors. 
The horizontal branch at V = 17.35, 
with E(B - V) = 0.03 and MARR) 
= -fO.6 assumed, gives a distance of 
21.5 kpc from the sun and a height of Z 
= 15 kpc above the plane (the same as 
NGC 5053). However, the metal abun- 
dance of Palomar 5 is not as low as that 
of NGC 5053. The unreddened color of 
the subgiant branch at the level of the 
horizontal branch is (B — V)o,g = 0.82 
it 0.02, which corresponds to an inter- 
mediate metal abundance of only a factor 
of 30 down from the sun rather than the 
factor of -200 for NGC 5053, M15, M92, 
etc. This surprising result is the same as 
obtained for Palomar 5 by Hesser, Hart- 
wick, and McClure and by Zinn and 



HALE OBSERVATORIES 147 

Searle using different methods, and hence stars in each of these systems were ob- 

appears to be well established. tained with Lynds' 'Tiold" spectrograph 

This is an indication that the metal equipped with a two-stage image tube. 

abundance is not uniformly low for re- The spectrograms, of dispersion 100 A 

mote halo objects, and therefore that the mm~^, were lightly exposed and 2 mm 

relation between metal abundance and wide. The sky was observed at the same 

height has a distribution. To judge from time as the object. Radial velocities were 

the results of Zinn and Searle, the distri- obtained for all these objects by digitiz- 

bution may not even be systematic. ing the spectra on the Kitt Peak PDS 

The work on Palomar 5 by Sandage microphotometer. The sky was then sub- 

and Hartwick suggests that the chemical tracted and the resulting spectra were 

enrichment of the halo was spotty, caused cross-correlated with spectra of K-giant 

rather by random enrichment events than stars in M15 and M92 whose velocities 

by a systematic uniform enrichment. The had been accurately determined by Gunn 

stirring of enrichment products within and Griffin. 

the halo must therefore have been quite The resulting velocities for the 12 sys- 

inefficient during the free-fall time of tems were then analyzed in conjunction 

the collapse, so that the halo was not with existing velocities for the globular 

mixed with much spatial uniformity clusters in the inner halo in order to esti- 

during its formation, and a wide distribu- mate the total mass of the Galaxy out 

tion (—2.3 < [Fe/H] < —1.0) of metal- to a radius of 100 kpc. A firm result is 

licites resulted at any given halo height, that the dispersion in radial velocity 

Palomar 5 has one of the faintest stays sensibly constant out to this large 

absolute magnitudes for any known radius. This leads to a mass distribution 

globular cluster in the Galaxy at M^ = for the outer parts of the Galaxy, which 

—5.0, as determined from star counts is W (r) oc r where Tl (r) is the mass in- 

and a fitting of the resulting luminosity side radius r. An accurate estimate of the 

function to that for M3. actual mass of the Galaxy depends on a 

knowledge of the shape of the velocity 

The Outer Globular Clusters ^^'"^f^ ^^^^^^ ^J^^ peculiar motions 

and Satellites ^J ^^^ systems^ This mass could be as 

high as 7 X 10^^ or as low as 4 X 10^^ 

In 1975, Sargent, together with Dr. 'j^fl^ out to 60 kpc. The velocity measure- 
David Hartwick of the University of ments also do not agree with Lynden- 
Victoria, began a program to determine Bell's hypothesis that several of the outer 
the radial velocities of the distant globu- systems belong to the ''Magellanic 
lar clusters in the halo of the Galaxy Stream" discovered by Mathewson and 
and of the dwarf spheroidal satellites of his collaborators at 21 cm. 
the Galaxy. These systems are very The spectrograms of the outer halo 
thinly populated with stars, so that it is systems were also studied by Dr. Anne 
necessary to determine velocities for in- Cowley of the University of Michigan, 
dividual stars of average brightness 18-19 together with Hartwick and Sargent, in 
mag rather than to use the integrated order to investigate the metal abundance 
light. To this end, observations of stars of the outer halo stars. The spectrograms 
in 12 systems were made at the Kitt were compared with those of K giants in 
Peak 4-meter telescope in October 1975 the metal-poor clusters M15 and ]M92 
and April 1976: the globular clusters and also with similar spectrograms of K 
NGC 7492, Palomar 1, 2, 3, 4, 11, 12, 13, giants in the metal-rich globular cluster 
and 14 (the Arp-van den Bergh cluster), M71. The surprising result was that the 
and the dwarf spheroidals Draco, Sculp- metal line strength is not correlated with 
tor, and Ursa Minor. Spectra of two distance from the galactic center for these 



1-iS 



CARNEGIE INSTITUTION 



outlying systems. Instead, the spectra 
show a range of metal deficiency with 
Mlo and M92 at the metal-weak end of 
the range. This result is in agreement 
with work by Searle and Zinn on the 
inner halo of the Galaxy; it has profound 
significance for theories of the formation 
of the Galaxy. 

Molecular Hydrogen in Galactic Sources 

The discovery of molecular hydrogen 
emission in Orion by T. N. Gautier III 
et al. [Astrophys. J. [Lett], 207, L129, 
1976), spurred intense activity. S. Beck- 
with. a graduate student at Caltech, has 
carried out observations of molecular 
hydrogen emission in the Orion Nebula 
since October 1976, in collaboration with 
Persson. Becklin. and Neugebauer. An 
Ebert-Fastie spectrometer has been 
adapted for use at 2 ixva with an InSb 
detector. Sensitivity is sufficient to make 
detailed spectral studies of H2 emission 
in two sources. Orion and NGC 7027. 
Maps have been made with 13" and 15" 
spatial resolution of emission from H2 
in the r = 1 -^ S(l) transition around 
the Kleinmann-Low Nebula. The low- 
resolution map shows emission extended 
by almost 1" with two regions of emis- 
sion maxima. From this map it has been 
determined that the luminosity in the one 
H2 line is 2.5 L©, with a total luminosity 
of ~50 Lq in all H2 lines. The emission 
is intense and the intensity places strong 
constraints on current models for its 
source. 

The map with 5" resolution shows a 
number of emission peaks as well as 
extended ridges and "holes" of emission. 
The high-resolution map locates the re- 
gions of maximum emission (presumably 
the result of density variations in the 
source) and displays the sizes very ac- 
curately. With more detailed modeling of 
the source, the interesting possibility 
exists that one may be able to determine 
accurately the densities in a region 
around the Kleinmann-Low Nebula and 
compare these w^th the densities needed 



for gravitational collapse. Measurements 
of various transitions other than f =: 1 
-» S(l) have been made at various 
positions selected from the 5" map. These 
measurements are the most accurate of 
any yet published and show that if the 
level populations are governed by a 
Boltzmann distribution, then the H2 
exists as a very hot {T - 2000°K), thin 
(A'ho '^ 10^^ cm-2) layer of gas. Such 
measurements can detect departures of 
the level populations from thermal equi- 
librium; they have already placed strong 
constraints on proposed models. 

Galactic Center Observations 

A study of compact sources near the 
center of the Galaxy was brought to 
fruition in a series of four papers by 
Becklin, Matthews, Neugebauer, Willner, 
and Wynn-Williams. In two of these 
studies, high-spatial-resolution measure- 
ments in the broadband filters from 1 to 
10 /tm, as well as in the [Ne II] line, 
were analyzed to elucidate the nature of 
the compact sources in the center; these 
results have been described in previous 
annual reports {Year Book 73, p. 140; 
Year Book 7^, p. 329; Year Book 75, 
p. 290). 

In a third paper, new spectroscopic 
measurements of the galactic center ob- 
tained with the 0.9- and 4-meter tele- 
scopes of Cerro Tololo Interamerican Ob- 
servatory are reported. The significant 
results of this study are: 

1. Ionized gas, which gives about 1/30 
of the total 2.2 /xm flux near the center, 
is concentrated with essentially the same 
distribution as the stellar content at the 
center. The Bracket y line was used to 
delineate the location of the ionized re- 
gion within a few parsecs of the center. 
The ionized gas does not show the same 
degree of dumpiness as does the 10 /^m 
radiation. Also, it is apparently more 
restricted in spatial extent than is the 
radio-continuum emission. 

2. The composition of the extended 2.2- 
/xm background is confirmed as consisting 



HALE OBSERVATORIES 149 

of stars through the presence of the CO quatcly reproduced by a model of local 

absorption beyond 2.3 fxm. star formation combined with whit^i 

3. Finally, the absolute extinction at dwarf cooling theory. The subdwarf B 
2.2 fim was determined by a comparison stars are found to represent less than 
of radio and Brackett y data to be 3.3 0.0005 of the number density of halo 
mag. This is the first measurement of horizontal-branch stars, thus accounting 
the absolute value of the 2.2-fim extinc- for their observed rarity in globular 
tion. Combined with a knowledge of the clusters. The mean local density of sub- 
extinction curve, it puts well-defined dwarf stars of (3.4 it 1.2) X 10"® 
bounds on the amount of gray extinction pc~'^ makes unlikely the possibility that 
in the interstellar medium. these stars have any direct evolutionary 

The fourth paper of the series discussed connection with the observed Population 

the interstellar extinction curve as derived I white dwarfs or planetary nebulae. 
from the compact sources at the galactic 

center. In particular, observations of tj ^ tz r^u- 4.- d- c 
-TT^r.^ ^^ ^ , i , i , i H and K Ooiective-Frism buvvev 
IRS7, which can be shown to be a late- 
type supergiant, at both 2 and 10 ycm Shectman and Preston have begun an 
have related the 2-jLtm extinction to the objective-prism survey for very low- 
galactic center with that in the silicate metal-abundance stars in the galactic 
band near 10 fxm. The ratio of the visual halo. A 16 X 16 cm interference filter 
to silicate extinction was found to be in the focal plane of the 46-cm Schmidt 
8 ± 3, which is less than previous deter- telescope at Palomar limits the extent 
minations (13 and 22) found for other of each spectrum to ^100 A around the 
samples of the interstellar material. From H and K lines at 3933, 3968 A. Because 
the colors of individual sources and the the bandpass is so narrow, very long 
background, it is concluded that of the exposures can be made and the problem 
30 magnitudes of visual extinction ob- of confusion at a dispersion of 250 A 
served to the galactic center no more mm~^ is avoided. The survey limit is 
than six originate within 3 parsecs of the between B = 13.5 and 14.0 mag. The 
center. vast majority of images on each film 

show H and K of typical strength for 

T ' u T? /• j-TT/i,-* 7-k ^ Gr- and K-type stars and are passed 

Luminosity r unction of White Dwarfs .^.i^ • ^ ■, k 

and Hot Subdwarfs °^«'"- ^^°f ^ ^^ conspicuously show A- 

type spectra and are presumably non- 
Richard Green, a Caltech graduate zontal-branch stars. A similar number of 
student, continued work on a survey of F-type spectra may contain the hotter 
blue stellar objects at high galactic lati- members of the moderately metal-de- 
tude. A complete sample was selected, ficient subdwarf population. A very few 
consisting of 115 objects with U — 5 < spectra (^1/1000) fall into none of these 
— 0.5 and covering 1434 sq deg of the categories and so far have turned out 
sky down to a mean limiting magnitude to be white dwarfs or nuclei of planetary 
of B = 15.7. This list includes 81 white nebulae. The object of the search is the 
dwarfs, 17 hot subdwarfs, and 4 quasars, occasional star in this last group which 
Absolute magnitudes were determined is in fact a giant but is so metal deficient 
for the white dwarfs from Stromgren that the H and K lines of Ca II, normally 
photometry, from which the luminosity the strongest lines in the spectrum, are 
function was derived for hot white conspicuously weak. The discovery of 
dwarfs in the solar neighborhood. The such objects would place important con- 
local space density is 1.43 it 0.28 per straints on the early history of nucleo- 
1000 cubic parsecs for M^ < 12.75. The synthesis during the formation of the 
observed luminosity function is ade- galaxy. 



150 



CARNEGIE INSTITUTION 



GALAXIES 



Coftiposition Gradients Aa'oss 
Spiral Galaxies 

Following Searle's discovery of com- 
position gradients across the disks of 
spiral galaxies, which was reported in 
Year Book 69 (p. 100). much work — 
both theoretical and observational — has 
been devoted to this subject by many 
independent, investigators. The original 
conclusions have been sustained, and at- 
tention has turned to the origin of the 
gradients and to the detailed physics of 
the ionized regions whose spectra provide 
the evidence of these gradients. 

In this report year, Searle has col- 
laborated with Dr. G. A. Shields of the 
University of Texas at Austin in an 
analysis of new and highly accurate ob- 
servations of emission regions in MlOl. 
Searle and Shields find that in addition 
to the well-established abundance gradi- 
ent there is a gradient in temperature of 
the ionizing stars, the hottest stars oc- 
curring far from the center of the Galaxy. 
They suppose that the ionizing stars 
share the abundance gradient of the gas 
and show that this has important effects 
on the character of the ionizing radiation 
emitted by these stars. When both these 
effects are taken into account, detailed 
models produce an excellent fit to the 
new observations, and Searle and Shields 
find that the 0/H abundance ratio falls 
off as r~"^/2 when r, the distance from 
the center of the galaxy, lies between 5 
and 25 kpc. The origin of this simple 
dependence is not yet understood. Simple 
theories had predicted that the abundance 
would fall linearly with radius, but the 
observations rule this out. 



Binary Galaxies 

In October 1976. Sargent shared four 
nights on the Hale Telescope with Dr. 
Igor Karachentsev of the Special Astro- 
physical Observatory, U.S.S.R. They car- 
ried out a program of spectroscopic 



observations of binary galaxies from a 
catalogue prepared by Karachentsev 
(Comm. Sp. Astrophys. Obs. U.S.S.R. 
Astron. Soc, 7, 3, 1972). Sargent and 
Karachentsev obtained 100 observations 
with the Cassegrain digital spectrograph 
of galaxies in 48 binary systems. Many 
of the pairs show signs of interactions, 
and many of the spectra show strong 
emission lines. A preliminary analysis of 
the data, carried out by Dr. Karachent- 
sev, gives a mean mass-to-light ratio 
(M/L) = 8.7 d= 2.8 solar units. There 
is a slight difference in (M/L) between 
the spiral-spiral and elliptical-elliptical 
pairs, namely, {M/L)s8 = 6.7 ± 3.5 (20 
systems) and {M/L)ee = 19.5 it 8.0 
(4 systems). Work is proceeding on a 
more extensive analysis of the data. 



Compact Galaxies 

Oke and Caltech undergraduate stu- 
dent Tod R. Lauer have completed a de- 
tailed study of the "iron" galaxy Zw 
0051 + 12, using data obtained with the 
cooled SIT-Vidicon on the digital spec- 
trograph. Between 3700 and 6600 A, more 
than 100 emission lines have been identi- 
fied and measured. In addition to the 
normal lines found in gaseous nebulae, 
there are a great many lines of Fe II and 
probably faint [Fe II] as well. A syn- 
thesis of the spectrum shows that the Fe 
II lines have the same profile as the 
Balmer lines but different from the for- 
bidden lines of [0 III], indicating that 
the Balmer lines come from the high- 
density region that produces the Fe II 
lines. 

Some years ago, Sargent {Astrophys. J., 
160, 45, 1970) carried out an extensive 
spectroscopic survey of the ''compact" 
galaxies listed by Zwicky. This work 
yielded many objects of great interest, 
including the proto-typical "iron galaxy" 
I Zw 1 and the "isolated extragalactic 
H II regions" I Zw 118 and II Zw 40, 



HALE OBSERVATORIES 151 

which were studied later in great detail galaxies from the Zwicky lists, I Zw 

by Searle and Sargent. These latter ob- 1439+53 and II Zw 1622+41. 
jects are members of a small class of 

dwarf, gas-rich metal-poor systems that Globular Clusters in M31 
are important tor two reasons, r irst, they 

provide unique information on the chemi- Sargent and Kowal, together with Drs. 

cal evolution of galaxies and on the pro- Hartwick of the University of Victoria 

portion of interstellar helium that is and Sidney van den Bergh of the Uni- 

primordial in origin. Second, they are versity of Toronto, completed the first 

probably extreme examples of bursts of part of a long-term program to find 

star formation in galaxies. Searle and globular clusters out to large radii (^100 

Sargent invoked the idea of such bursts kpc) in the halo of M31. The ultimate 

in order to explain the properties of ab- aim is to use the virial motions of such 

normally blue galaxies in general. clusters to determine the mass of M31 ; 

During 1976-77, Sargent was joined however, the clusters will also be used 

by Dr. Daniel Kunth, on leave of absence by Searle in his studies of the chemical 

from the European Southern Observa- constitution of the M31 halo, 

tory, in carrying out a second spectro- The observations for this program 

scopic survey of the Zwicky galaxies, consist of wide-field direct photographs 

Their primary intention was to find obtained at the prime focus of the Kitt 

more objects like I Zw 118 and II Zw Peak 4-meter reflector. Twenty-nine 

40, and possibly objects exhibiting even fields covering the disk and regions along 

more extreme properties than these arche- the minor axis of M31 were photographed 

types. Accordingly, Kunth and Sargent in 1974. During the present year, the 

obtained low-dispersion spectra of 130 investigators prepared for publication a 

Zwicky galaxies with the P60 Cassegrain list of 355 M31 globular clusters found 

spectrograph and with the Cassegrain on these plates; 124 of these clusters are 

digital spectrograph on the Hale Tele- newly discovered. The distribution of 

scope (these latter observations were clusters in the inner halo of M31 is 

made in poor conditions as a backup to found to fall off with radius, according 

more demanding work). Only 20% of to the law <^(r) ^ r~^-^, identical to that 

the galaxies turned out to have emission found in the Galaxy. It is estimated that 

lines despite the fact that they were the halo of M31 contains about 200 

selected from Zwicky 's lists for their globular clusters beyond a radius of 1° 

blue colors. Ten of them have medium (11 kpc) from the center, 
to high excitation emission spectra and 

are being studied in more detail. Spectro- m u i m j. • i\/rofv 

, ^ ^ . , ,. , ^ , G Lobular Clusters in M 87 
photometric observations were also made 

of several objects similar to II Zw 40 Oke, Searle, and Dr. Rene Racine of 
that had been found in other surveys, David Dunlap Observatory, Ontario, 
particularly those of the Markarian have obtained absolute spectral-energy 
galaxies. In the course of the Zwicky distributions of four globular clusters in 
survey, three new Seyfert galaxies were M87. These clusters have visual mag- 
found. Two of these have intense emis- nitudes between 19.6 and 20.6. A com- 
sion lines of Fe II, together with very parison of energy distributions shows 
weak forbidden emission lines. Detailed that within the accuracy of the data they 
astrophysical analyses are being made are identical. It is found that the cluster 
of the spectra of these objects. In addi- energy distributions can be matched ac- 
tion, such analyses are being made of curately with individual stars in galactic 
digital spectrograph and multichannel globular clusters. This leads to the con- 
scanner observations of two other Seyfert elusion that the four ]\I87 globular 



152 



CARNEGIE INSTITUTION 



clusters are nuich more metal deficient 
than the metal-rich chister M71. about 
the same as M13, and less metal deficient 
than the extremely metal-deficient cluster 
M92. This conclusion must be taken with 
caution, since a comparison is being made 
between a star system and an individual 
star. A more valid result comes by com- 
pariui:: the M87 clusters with globular 
clusters in M31. A detailed comparison 
shows an excellent match with I\131 
globular clusters of type L = 7 (van den 
Bergh. Astrophi/s. J., Suppl. Ser., 19, 
145. 1969 >, which corresponds to a metal 
deficiency of a factor 10 with respect to 
the sun. Fits at L = 1 or L = 12 are 
intolerablv bad. 



creases outward substantially; the light 
of the galaxy has a Hubble-law shape 
to at least 60 kpc radius; and the only 
simple dynamical models that fit the H I 
rotation law, the central velocity disper- 
sion, and the extremely smooth power- 
law light distribution are two-component 
models with a substantial dark halo. 
The resulting M/L ratios are in the 
neighborhood of 100, the same value sug- 
gested by the virial analysis of small 
groups by Gott and Turner and Kirshner, 
and of the Local Group by the ''timing" 
argument. 



Velocity Dispersions in Galaxies 



Dynamical Studies 



Sargent, with former graduate student 
Paul Schechter and A. Boksenberg and 
K. Shortridge of University College Lon- 

Dynamical studies of elliptical galaxies don, completed work on the velocity dis- 
with the SIT spectrograph have contin- persions of 13 galaxies. Observations 
ued this year by Gunn in collaboration made with Boksenberg's system at the 
with Thuan and with P. Schechter of the coude spectrograph of the Hale Tele- 
University of Arizona. The program with scope in previous years were analyzed 
Thuan is a continuation of the one begun by a Fourier method that gives both the 
last year to investigate the velocity dis- radial velocity and the velocity disper- 
persion in cD galaxies; the one with sion of each galaxy. The new measure- 
Schechter is to investigate the dispersion ments confirm a relation between the 
and rotation in flattened ellipticals. There luminosity of a galaxy and its velocity 
is by now impressive evidence that rota- dispersion L ^ ct^, which was found 
tion and flattening do not have the ex- earlier by Drs. Faber and Jackson of 
pected simple relationship one to the the Lick Observatory. 
other, and that some third integral is During an unsuccessful attempt in 1976 
playing an important role in the dy- to obtain radial velocities of globular 
namics of these systems. A scheme for clusters in the halo of M87, a team com- 
constructing models with a simple third posed of Boksenberg, Sargent, Hartwick, 
integral has been devised. and Dr. Roger Lynds of the Kitt Peak 

An especially interesting elliptical gal- National Observatory made extensive ob- 

axy for dynamical studies is NGC 4278, servations of the spectrum of M87 itself 

which was discovered recently by Faber, out to a radius of 150". These data were 

Gallagher, and Knapp to have neutral obtained with the Boksenberg detector 

hydrogen, and has since been shown by at the Cassegrain focus of the KPNO 4- 

Knapp. Kerr, and Williams to have a meter telescope. They are now being 

neutral hydrogen disk. High-resolution analyzed by graduate student Peter 

SIT spectroscopy and surface photom- Young. It appears that the velocity dis- 

etr\' of this system have been obtained, persion ar in M87 falls off radically, as 

and dynamical models have been con- predicted by a King model. However, o-^ 

structed. The results indicate that the rises sharply in the central few arcsec- 

mass-to-light ratio of this sysi^em in- onds of the galaxy. This behavior implies 



HALE OBSERVATORIES 15 



Q 



that M87 contains a tight central mass })y other Westerbork observers. An ex- 
concentration of about 10^^ solar masses tensive halo, present in both the radio 
— which may be a black hole. continuum and neutral hydrogen, has 

also been discovered around the small 

Bright Spiral Galaxies irregular galaxy NGC 1569. The halo 

may be related to an extensive system ot 

De Bruyn has discussed radio con- Ha filaments in which the galaxy appears 

tinuum observations of nearby active to be embedded. The properties of the 

spiral galaxies. The observations were halos and disks are used to set constraints 

obtained with the Westerbork Synthesis on the possible models for the origin, 

Radio Telescope at continuum wave- propagation, and confinement of cosmic 

lengths of 6, 21, and 49 cm. The high rays in galaxies, 
angular resolution at 6 cm (about 7'') 

and the excellent sensitivity to faint ex- ^ 4 i r i 
tended emission at 49 cm have provided 

for the first time a complete picture of In collaboration with Dr. A. S. Wilson 

the fine structure, large-scale structure, of the University of Sussex, de Bruyn 

and spectral properties of the radio con- has completed a statistical discussion of 

tinuum emission of about 10 nearby the radio continuum properties of a large 

spiral galaxies. sample of Seyfert galaxies observed at 

The galaxies NGC 2146 and NGC Westerbork. The most important results 

3079 were found to have a very bright, of this study may be summarized as 

peculiar radio structure reminiscent of follows: 

that observed in NGC 4258 (van der 1. The radio emission generally comes 

Kruit, Oort, and Mathewson, Astron. from a region of about 1 kpc diameter 

Astrophys., 21, 169, 1972). The radio centered at the optical nucleus. The radio 

spectra of these galaxies show no steep- luminosity is intermediate between that 

ening at the highest frequencies, indi- of normal spiral galaxies and radio 

eating that the radio structures must be galaxies. 

less than about 10"^ years old. This and 2. None of the galaxies shows the 

other observed features are used to argue double radio structure characteristic of 

that the radio structures are related to most extragalactic radio sources and, in 

nuclear activity. De Bruyn is using the particular, quasars to which Seyfert 

SIT digital spectrograph at the Casse- galaxies have been likened, 

grain focus of the 5-meter Hale Tele- 3. The radio luminosity of type 2 Sey- 

scope to investigate optical features that ferts (those having equally wide forbid- 

may be related to the anomalous radio den and permitted lines) is, on the 

structures. Other galaxies that may ex- average, stronger by a factor of 5 than 

hibit signs of nuclear activity in the that of type 1 Seyferts (those having 

radio domain, although less conclusively, very broad permitted lines and narrow 

are NGC 4631 and NGC 4736. forbidden lines) . This is a surprising 

In collaboration with E. Hummel of result in view of the fact that the optical 

the Kapteyn Astronomical Institute at nonthermal activity is stronger in the 

Groningen, de Bruyn completed the dis- type 1 objects. 

cussion of the radio continuum properties 4. No correlation exists between the 
of the nearby edge-on galaxy NGC 3556. radio emission and the Ha luminosity or 
The most interesting feature of this nuclear ultraviolet magnitude within each 
galaxy is a radio continuum halo that type group. A weak correlation was 
reaches to almost 5 kpc above the plane, found between the radio luminosity and 
The halo has properties similar to those the [0 III] A5007 A emission line in- 
detected around NGC 4631 and NGC 891 tensity. This result is taken to support a 



154 



CARNEGIE INSTITUTION 



model in which the radio emission and 
the forbidden Hnes both originate in an 
extended region in which approximate 
pressure bahmce exists between the rela- 
tivistic electrons and magnetic fields on 
the one hand and. on the other hand, a 
thermal filamentary gas. The correlation 
between the 21 -cm luminosity and 10-ju 
luminosity, first discovered by van der 
Kruit. seems to be mainly confined to the 
type 1 Seyferts but is weaker than previ- 
ously believed. 

To pursue the study of Seyfert gal- 
axies, de Bruyn and Sargent are using 
the SIT digital spectrograph at the 
Cassegrain focus of the 5-meter Hale 
Telescope to obtain information on the 
spatial extent, ionization state, and 
kinematics of the gas surrounding the 
active Seyfert nucleus. A long, narrow^ slit 
is used and several positions offset from 
the nucleus are observed. Preliminary 
results for XGC 3516, obtained in good 
seeing, indicate that the region emitting 
strongly in the [0 III] A4959, 5007 A 
lines measures nearly 10" in diameter, 
which corresponds to about 2.5 kpc 
linear size. 

Dc Bruyn and Sargent have almost 
completed the reduction of a large set of 
multichannel scans of Seyfert galaxies 
taken in 1974 and 1975 with the 5-meter 
Hale Telescope. In total nearly 70 gal- 
axies have been observed at a resolution 
of 20 A in the blue and 40 A in the red. 
The data are ideally suited for a study 
of the optical continua and the relation 
between emission-line strength and opti- 
cal colors. They have also begun a pro- 
gram to monitor the spectra of a subset 
of the.se 70 galaxies to collect informa- 
tion on the continuum and emission-line 
variability observed by Osterbrock and 
others in several of these galaxies. 

De Bruyn is also using the S20 pho- 
tometer attachefl to the 1.5-meter tele- 
scope at Palomar to obtain UBV mag- 
nitudes of the nuclei anrl the extranuclear 
regions of a well-defined sample of 
Seyfert galaxies from Alarkarian's lists 
of objects with ultraviolet excess. Many 



of these objects are too faint for accurate 
centering in the smallest apertures; they 
will be observed with the SIT area 
photometer. 

Grouping Galaxies 

Sulentic and Arp have collaborated 
with Dr. G. A. di Tullio of Padova Ob- 
servatory in a survey to identify inter- 
acting double and multiple galaxies 
within 1° of 99 bright (10.0 < m^g < 
12.0) spiral galaxies. A total of 96 inter- 
acting systems were found in the galaxy 
fields compared to 49 in control fields. 
The interacting systems were found to 
be concentrated along the minor axis of 
the average edge-on spiral, confirming an 
original result of Holmberg. The second 
phase of this project, now in progress, 
involves spectroscopy and photometry of 
the entire sample of interacting systems. 

Extragalactic Observations at 
1 to 10 Microns 

The nucleus of the spiral galaxy IC 
342 has been mapped by Becklin, 
Matthews, and Neugebauer at 1.65, 2.2, 
and 10 /xm with an angular resolution of 
3" (80 pc) on the 5-meter Hale Tele- 
scope. At 1.65 /xm and 2.2 ^m an extended 
distribution of radiation is seen which is 
similar in color surface brightness to that 
seen in the Galaxy and nearby spiral 
galaxies such as M31. This radiation is 
known in the Galaxy and in M31 to 
originate from late-type giant stars. At 
10 /xm the nucleus of IC 342 is also 
extended and is quite bright. Although 
the source of the 10-/xm radiation is 
unknown, it is definitely not centered at 
the position of maximum stellar density. 
It most likely is associated with giant 
regions of ionized gas similar to the giant 
H II regions such as Sagittarius B2 in 
the nucleus of the Galaxy. Thus it ap- 
pears that the 10-/xm radiation originates 
from dust heated by young, bright early- 
type stars. The spatial distributions of 
these early-type stars do not follow the 



HALE OBSERVATORIES 



155 



distributions of the late-type stars which 
define the dynamical center of IC 342. 
A similar situation is seen in the galactic 
nucleus. The total far-infrared flux from 
IC 342 has been measured on the C-141 
airborne telescope with a V beam (1.5 
kpc). The total luminosity observed is 
about 3 X 10^ Lq, again very similar 
to that observed in the same region 
within the galactic nucleus. Thus the 
nucleus of the galaxy IC 342 is similar 
to the nucleus of the Galaxy in the distri- 
bution of late-type stars, the distribution 
of the regions of star formation, and the 
total luminosity observed at wavelengths 
longer than 50 /xm. 

Persson, Dr. J. Frogel of Cerro Tololo 
Interamerican Observatory, and Dr. M. 
Aaronson of Harvard College Observa- 
tory have continued several observa- 
tional programs designed to study stellar 
populations in early-type galaxies. Pho- 
tometric measurements of the CO and 
H2O absorption features near 2 /x in a 
number of galaxies and calibrating stars 
show that the light at this wavelength 
is dominated by giant stars of spectral 
type near M5. This result is based on 
the fact that all the galaxies observed so 
far display strong H2O absorption. Giant 
stars, whose presence is indicated by the 
CO data, must be of late type to show 
strong H2O. A proper synthesis of galaxy 
populations would now seem to depend 
on a more complete calibration of the 
indices by using late-type stars of higher- 
than-solar metal abundance. 

The V — K colors for a large number 
of field and cluster galaxies were ob- 
tained and analyzed. A basic result of 
this is that the U — V and V — K colors 
correlate well for E and SO galaxies. This 
arises from the dependence of both colors 
on several effects of metal-abundance 
variations. In comparing galaxies of dif- 
ferent absolute magnitude, the known 
color dependence (of U — V, for ex- 
ample) can thus be doubled by using U 
— K. Photometric relative distance 
moduli of galaxy clusters can therefore 
be obtained with somewhat less sensi- 



tivity to cosmic scatter and observational 
errors. Tidally stripped objects, which 
are too red for their absolute magnitude, 
show up easily in a plot oiU — K versus 
magnitude. 

NGC 4151 

A five-year study of the well-known 
Seyfert galaxy, NGC 4151, has been 
completed by Arp. This spiral is a radio 
source and an x-ray source, and it has 
a pointlike nucleus that varies in bright- 
ness with time. Photographs of 1972 
showed possible connections of NGC 
4151 to companion galaxies nearby in the 
field. More recently, "deep" photographs 
have been acquired with the Palomar 
1.2-meter Schmidt and 5-meter reflector 
and the Kitt Peak 4-meter reflector. 

Intercomparison and analysis of these 
plates gives evidence, in Arp's opinion, 
for connections and interactions between 
the central galaxy and several nearby 
companions. Comparison with recent 
neutral-hydrogen radio maps made at 
Westerbork suggests an effect of the 
nearby companion galaxy NGC 4156 on 
the hydrogen distribution in NGC 4151. 
The companion, NGC 4156, appears to 
be a peculiar spiral and has a plume of 
material associated with it. Spectroscopic 
study of objects in the vicinity of NGC 
4151 shows a number of redshifts near 
cz = 6400 to 6700 km s-^. 

NGC 1199 

In 1966, Arp obtained with the 5- 
meter reflector a photograph of the group 
of galaxies centered on the bright E 
galaxy NGC 1199. An almost starlike 
object about 1' from NGC 1199 was 
discovered. Spectroscopic observation 
showed the compact object to have a 
blue emission-rich spectrum with a red- 
shift of cz — 13,300 km s-^. The E 
galaxy has an absorption redshift of cz 
= 2600 km s~^. The original photograph, 
however, suggested that the light of the 
E galaxy might be absorbed by a ring 



156 



CARNEGIE INSTITUTION 



of material around the eompaet object. 
If tliis were true, it would be proof that 
tile compact object is in front of the E 
galaxy; this analysis again suggested to 
Arp the existence of an anomalous (not 
distance-related) redshift. 

In the nexi 11 years, additional plates 
were accumulated, including a series of 
six deep Illa-J exposures with the CTIO 
4-meter telescope in Chile in 1977. From 
superposition printing of this series of 
plates. Arp concluded that the dark ring 
surrounding the compact object was real, 
and that the ring was obscuring the light 
of the E galaxy behind it. 

In the past year at Palomar the new^ 
SIT spectrograph constructed by Gunn, 
S. Knapp, and Oke was used to observe 
the supposed dark ring around the com- 
pact object. The spectrophotometric 
measures suggested that the light of the 
E galaxy was both reddened and ab- 
sorbed by this dark ring. Associated with 
this apparent dust reddening in the com- 
pact object appears to be an interstellar 



/v-line absorption line at the redshift 
expected for a cz = 13,300 km s~^ red- 
shift. Arp's interpretation is that the 
high-redshift compact object lies between 
the observer and the bright E galaxy 
NGC 1199. 

Multiplicity of Nuclei of Ellipticals 

Caltech graduate student J. Hoessel, 
Gunn, and J. Knapp are undertaking an 
observational investigation into dynami- 
cal friction processes in the brightest 
ellipticals in clusters by taking short- 
exposure direct red plates with the Palo- 
mar 1.5-meter telescope. The clusters 
being photographed are the Gunn-Thuan- 
Hoessel sample of 107 nearby rich Abell 
clusters for which redshifts and pho- 
tometry are available. They are studying 
the light distribution in the center of the 
brightest ellipticals and, in particular, 
are looking for multiple nuclei as evi- 
dence of recent capture. So far, photo- 
graphs of 42 clusters have been obtained. 



CLUSTERS OF GALAXIES 



''Missing Mass^' in Clusters the velocities. This technique is capable 

of an accuracy of 5-15 km s~^ for the 
For the past 40 years, one of the out- velocity of a galaxy that contains hydro- 
standing questions in astrophysics has gen. Observations were made during the 
been that of the ''missing mass" in groups report year of 294 galaxies in 18 Turner- 
and clusters of galaxies. The problem Gott groups; of these, 171 galaxies were 
was clearly stated by Sinclair Smith detected at 21 cm. The measurements 
(Astrophys. J., 83, 23, 1936) in connec- were made with the radio telescopes at 
tion with the Virgo cluster. As part of a Arecibo, Bonn, and the National Radio 
large-scale attack on this problem, Sar- Astronomy Observatory, 
gent collaborated with Dr. Gillian Knapp Analysis of the data is just beginning, 
of the Owens Valley Radio Observatory However, it appears that most of 'the 
in an extensive study of the radial veloci- groups are well-defined dynamical sys- 
ties of the galaxies in the loose groups tems; for these groups the velocity dis- 
defined by Turner and Gott (Astrophys. persions are about 100 km s"^. Some 
J.,. Sr/7>p^ .Ser., .3^,409, 1976). The velocity groups are chance superpositions of gal- 
dispersions of these groups are expected axies at radically different distances. 
to be small (< 100 km s~^) and, ac- Some groups are hydrogen-rich (that is, 
cordingly, Knapp and Sargent used the they contain a very high proportion of 
21-cm neutral hydrogen line to determine detectable galaxies) relative to others. 



HALE OBSERVATORIES 



157 



Velocity Field Near Rich Clusters 
of Galaxies 

Shectman has calculated the expected 
distribution of galaxy radial velocities 
near rich clusters under the Gunn-Gott 
infall hypothesis. The perturbing mass 
concentrated in the cluster slows the sur- 
rounding Hubble expansion. Objects on 
the near side of the cluster are systemat- 
ically accelerated away from the ob- 
server, while objects on the far side are 
systematically accelerated toward the 
observer. The result is an excess of gal- 
axies near the cluster velocity, even at 
angular distances from the cluster center 
where true cluster membership is unlikely. 

In the models, as the medium in which 
the cluster and its surroundings evolve 
is made more and more tenuous, the per- 
turbation required to form the cluster 
grows, and the excess of nonmember 
galaxies near the cluster velocity becomes 
more and more conspicuous. This effect 
is unusual in that an observable param- 
eter becomes more and more sensitive to 
the density of the universe as the density 
decreases. 

Published data on the distribution of 
velocities near the Coma cluster of gal- 
axies indicate a low value of the cosmo- 
logical density parameter, Q ^ 0.1. 
Shectman is pursuing a program to meas- 
ure this effect around three other rich 
clusters: Abell 1904, 2065, and 2607. 
More than 200 radial velocities have 
already been obtained with the Palomar 
5-meter telescope and the Gunn-Oke SIT 
spectrograph. A preliminary analysis 
again indicates low values of the density 
parameter. 



Velocity Anoinalies in the Virgo Cluster 

A reexamination by Sulentic of all 
available redshift data in the Virgo I 
cluster has revealed several anomalies. 
A surprising difference was found in the 
radial distribution of E-SO and S velocity 
dispersions. The elliptical galaxies possess 
a well-defined distribution of velocities 



about the mean cluster redshift at all 
radii while the spiral velocities appear 
to be distributfjd bimodally within 2° 
of the cluster center, and similarly to the 
ellipticals farther out. This suggests the 
possible existence of a radial component 
to the motions of the spirals with respect 
to the ellipticals that might also explain 
the larger velocity dispersion of the spiral 
sample. It was also found that the mean 
redshift of the radio-emitting spirals is 
higher than for the complete spiral 
sample. 

Search for Evolutionary Changes 

Wilkinson and Oke have completed a 
study of the absolute spectral-energy 
distributions of 54 brightest galaxies in 
faint clusters to search for evidence of 
evolutionary changes. About 15 objects 
have redshifts between 2; := 0.10 and 0.21 
and constitute the sample with short 
look-back time. The remaining 39 clusters 
have redshifts between 0.21 and 0.47. 
Over the range in time corresponding to 
^ = 0.10 to 0.46, B — V is not found 
to change by more than 0.03 mag. Other 
effects of size comparable to or greater 
than any color evolution are present, and 
a comparative analysis of the individual 
spectral-energy distributions suggests 
that one cause of this may be a disper- 
sion in metallicity by a factor 4 among 
the galaxies in the sample. 

Search for Intergalactic Hydrogen 

A systematic search for the 21-cm 
hydrogen-emission line from intergalactic 
hydrogen clouds in nearby groups of 
galaxies has been conducted by Sargent 
and Dr. K. Y. Lo of the University of 
California at Berkeley. The automated 
40-meter telescope of the Owens Valley 
Radio Observatory and the 26-meter 
telescope of the Berkeley Radio Astron- 
omy Laboratory w^ere used in the search. 
Extensive observations of large areas of 
the M81 group, the Canes Venatici I 
group, and the NGC 1023 group, cover- 



Cluster Models 



15S CARNEGIE INSTITUTION 

ing several luiiuired square degrees of Extended low-surface-brightness images, 

sky, have been made. not discernible on the Sky Survey plates, 

The upper liniit^? for the parameters are found quite frequently; they could 

of the intergalactic liydrogen clouds, be nearby objects, 
achieved at the Owens Valley 40-meter 
t-elescope. are: the hvdrogen mass 
aii^ (HI) < 5 X 10^' Wo Mpc-2 if the 
clouds are < 25 kpc in size; the column 

density A'(H) < 1 X 10^'^ cm~- if the Dressier has completed an analysis of 

clouds are > 25 kpc — if we assume 40 the recently available Leir and van den 

km s~^ to be the expected line width. Bergh catalog of 1889 rich clusters of 

These results should be compared to the galaxies. By comparing the distribution 

parameters of the int<^rgalactic hydrogen of Bautz-Morgan types in this sample 

clouds report^^ni by Mathewson and his with predictions of Monte Carlo com- 

co-workers {Astrophys. J. [Lett.'\, 195, puter simulations, he was able to show 

L97, 1975). They detected near NGC 55 that the distribution of the luminosities 

and NGC 300 hydrogen clouds with mass of the brightest cluster galaxies is incon- 

ranging from 3 X 10" Tl q Mpc"^ to sistent with a model of statistical selec- 

10^** iVo Mpc~2, and iV(H) > 2 X 10^^ tion from a universal function. Specifi- 

cm~-, with observed line widths of 35-40 cally, any luminosity function steep 

km s~^. enough at the bright end to reproduce 

Observations of selected areas in M81, the observed small scatter in the magni- 

CVn I, and the NGC 1023 groups were tude of the first-ranked cluster members 

also made with the Effelsberg 100-meter will not reproduce the observed distri- 

telescope of the Max Planck Institute bution of Bautz-Morgan types in clusters, 

for Radio Astronomy in Germany. A few and vice versa. 

hydrogen clouds of mass ranging from Dressier completed a substantial part 

5 X 10^ to 3 X 10^ Wq Mpc~2 were of the observations for a study of rich 

detected. Some of them correspond to clusters of galaxies containing cD gal- 

uncatalogued small but extended faint axies. Plates of 24 clusters taken with 

unagosonthe Palomar Sky Survey plsites. the 1.2-meter Schmidt are now being 

Further observations will be made with analyzed from the standpoint of the 
the more sensitive maser receiver, re- spatial distributions of the cluster mem- 
assembled by K. Y. Lo, using the Owens bers. Effects of equipartition and/or 
Valley 40-meter telescope. However, our dynamical friction in the cD versus non- 
results and the evidence in the literature cD clusters, as well as possible correla- 
indicate that while neutral hydrogen tions between average cluster density 
companions of mass W ?J?o or more are and cluster type, are being investigated 
often found near individual galaxies, or with the aim of discriminating among 
pairs of triplets of galaxies, truly isolated cD galaxy formation mechanisms. The 
hydrogen clouds ( > 300 kpc from any dynamical friction mechanism of build- 
galaxy) of mass > 10^ '^q are scarce, ing a cD would result, for example, in a 

An optical survey of the same groups depletion of bright galaxies in the core 
studied at 21 cm was begun by Sargent of the cluster, something not to be ex- 
and Lo. Broad-band IllaJ plates, cov- pected if the cD is merely a result of 
ering the whole extent of the groups, are special creation. The plate material will 
beingobtaincfl with the 1.2-meter Schmidt eventually be scanned with the JPL- 
telescope by Kowal. The plates obtained PDS system to obtain luminosity func- 
are typically 2 mag deeper than the tions for these clusters. 
Palomar Sky Survey plates. A large frac- Some preliminary observations of rela- 
tion of the M81 group has been observed, tively nearby (z < 0.06) clusters of 



HALE OBSERVATORIES 



159 



galaxies have been completed with the 
Palomar 1.5-meter reflector. Approxi- 
mately 15 clusters have been photo- 
graphed, using hypersensitized 103a-O 
emulsions. These limiting exposures of 
1-1.5 hours with a plate scale of 15.5" 
mm~^ are now being used to determine 
the relative populations of different 
galaxy types in the clusters and their 
spatial distributions. The aim is to dis- 



criminate between models of SO forma- 
tion that rely exclusively on external 
stripping of spiral galaxies and models 
containing a combination of factors, in- 
cluding external stripping, self-stripping, 
and initial conditions. Higher quality 
plate material for this project is antici- 
pated with the forthcoming availability 
of the du Pont 2.5-meter reflector at Las 
Campanas. 



RADIO SOURCES 



SCR Identification Program 

Kristian, Sandage, and Katem have 
published the second in a series of papers 
intended to contribute to the eventual 
optical identification of all radio sources 
in the SCR catalog of bright sources. 
Data obtained with the Palomar 5- and 
1.2-meter telescopes provide candidates 
or likely identifications for 14 sources 
(3C34, 169.1, 177A, 266, 274.1, 303.1, 
325, 327.1, 390, 410, 435.1A,B,C, and 
437). Previous identifications by others 
are confirmed or new data on redshifts, 
SIT photometry, or optical positions are 
given for 24 sources (3C6.1, 13, 20, 43, 
61.1, 68.1, 84, 123, 169.1, 173.1, 256, 265, 
268.2, 268.4, 274.1, 295, 323.1, 330, 411, 
427.1, 434, 437, 438, and 460). 

Accurate (< 1") optical positions 
were measured for a number of field stars 
near each of 40 sources, and detailed 
descriptions were given of each field to 
facilitate further optical work. Improved 
optical or radio positions have been used 
to remove some previous discrepancies. 
Most of the new faint identifications are 
galaxies, a finding which bolsters earlier 
suggestions that most optically faint 
radio sources are galaxies. The only new 



quasar candidates are 3C34, 3C325, and 
3C435.1C. 



Identifications of Radio Sources 

De Bruyn, working in collaboration 
with Drs. P. Katgert and A. G. Willis 
of Leiden Observatory, used the 1.2- 
meter telescope at Palomar to obtain a 
series of deep, 14" X 14" plates of the 
5C2 region (centered at 11^, +50°). This 
area has recently been observed with the 
Westerbork Synthesis Radio Telescope 
at a frequency of 1415 MHz. More than 
200 radio sources with second-of-arc 
accurate positions have been catalogued 
down to a limiting flux density of 6 mJy 
(Katgert, Astron. Astrophys., 38, 87, 
1975; 49, 221, 1976). To obtain identifi- 
cations, plates were taken in the combi- 
nations Illa-J + Wratten 2C, 127 — 
04 + Wratten 23A, and 127 — 04 + 
Red Plexiglas (no. 76-1). The plates 
were calibrated with a wedge sensitom- 
eter. Some of the plates are very deep and 
most have good image quality. They will 
be measured with the Astroscan plate- 
measuring machine of Leiden Observa- 
tory. 



QUASARS AND QUASI-STELLAR OBJECTS 

Oke and Richstone used the Multi- spatially the quasar 3C249.1 (previously 
channel Spectrometer and the SIT- thought to be stellar). These observations 
Vidicon digital spectrograph to resolve revealed narrow emission lines of [0 II] , 



160 CARNEGIE INSTITUTION 

[0 III], and [Ne III] from a region PJwtometry and Spectroscopy in the 

about 2" away from the quasar, at a 8^ and 15^ Survey Fields 
redshift consistent with that of the 

quasar. This is the third case of such a Radio-quiet quasars (QSOs) outnum- 

phenomenon. It appears to rule out a ber radio quasars (QSS) by a very large 

gravitational model for the quasar red- factor, but the statistics of the surface 

shift. Simple photoionization models for density distribution of QSOs are still 

the nebula — in which it is assumed that rudimentary. 

"cosmic" abundance gas is exposed to In 1967, Sandage and Luyten (Astro- 

the unattenuated Lyman continuum of phys. J., I4S, 767, 1967; 155, 913, 1969) 

tlie quasar — fail by a large margin to began a systematic survey of QSOs in 

produce the observed line strengths, six survey fields, using the 1.2-meter 

Time-dependent ionization of the nebular Schmidt and the three-image technique 

gas, caused either by variations of the of Haro and Luyten to attempt an im- 

central quasar intensity or by shadows provement in the statistics. Catalogs of 

cast on the gas by clouds near the blue objects were produced for four of 

quasar, may produce a satisfactory the fields (8:48+18; 10:244-18; 11:16 

model. +30; and 15:10+24), and systematic 

Oke has used the multichannel spec- photoelectric and spectroscopic observa- 
trometer to measure the UV flux from tions were begun to determine the nature 
quasars of sufficient redshift so that the of the blue objects and the surface 
Lyman jump can be measured. Of the density of the QSOs to a photoelectric 
six objects so far observed, two show magnitude limit of B = 18.5. 
large decreases of intensity at and below The two fields most completely studied 
the Lyman jump; the remaining four to date are those at 8^ and 15^. Photo- 
show no change whatsoever. The equiv- electric UBV photometry has been com- 
alent width of Ly-a is approximately the pleted for about 200 objects in these 
same in all these objects. These results areas. Schmidt began a spectroscopic 
suggest that quasar nuclei are sur- survey for QSOs, white dwarfs, and sub- 
rounded by optically thick clouds that dwarfs in 1969, based on the photometry, 
are in the line of sight to the quasar only and has published the results obtained 
about a third of the time. They also in 1973 in Astrophy. J., 193, 509, 1974. 
suggest that two-thirds of the Lyman The original catalog positions were ac- 
continuum radiation escapes from the curate to V in each coordinate, which 
quasar complex, which explains the ab- although adequate for optical studies 
normally low equivalent width of Ly-a was insufficient for radio searches of the 
in quasars. candidates. Sandage and Katem have 

A. Boksenberg and R. F. Carswell of measured optical positions of the 176 

L'niversity College London and Oke used bluest (color class I) objects in the 8^ 

the IPCS on the digital spectrograph field with accuracies of ±1" of arc in 

attached to the 5-meter Hale telescope to each coordinate. Finding charts have 

measure the energy distribution of the also been prepared for both areas, 

quasar 3C68.1. The observations give a Sandage has continued the spectros- 

redshift z = 1.238 and indicate that the copy in both fields to obtain as complete 

object is much redder than any other an unbiased sample as possible from 

quasar yet studied. More recent observa- which to estimate the surface density of 

tions by Neugebauer and Oke confirm the the emission-line QSOs. The 8^ field is 

very red color in the visual range, but the the most complete. Combining the 

color is normal in the infrared. Work is Schmidt and Sandage statistics in this 

now under way to see if interstellar red- field gives a total of 39 definite QSOs 

dening within the object is important. observed, out of a total spectroscopic 



HALE OBSERVATORIES 161 

sample of 143 objects tried. From the by spectroscopy have been found to be 

statistics on variables among the 176 emission-line QSOs. The statistics on sur- 

color class I objects using the independent face density to B = 18.5, although poorer 

study by Dr. P. D. Usher (see section on than the 8^ field, give closely the same 

Guest Investigators), at least four more values. 

objects with continuous spectra are al- The new material on the positions, 

most certainly QSOs. Furthermore, among charts, spectroscopy, and photometry in 

the 45 color class I objects with no both fields has been prepared for publi- 

spectra to date, 11 are almost certainly cation. 

QSOs, based on the statistics of optical Studies have been started in collabora- 
variation. Hence, in the 42.70° area, tion with Dr. A. A. Hoag of the Lowell 
there are 54 objects that are definite or Observatory to carry the systematic 
almost certain QSOs brighter than B = search to much fainter limits of B = 22, 
18.5. Dr. Usher has determined the pho- using his converging-beam prism spec- 
tometric limit relative to the photoelec- trometer at the Kitt Peak 4-meter tele- 
trie values of 90 objects measured so far scope in several Selected Areas where 
by Sandage in the 8^ field. standard magnitudes to this limit are 
Hence, a very conservative lower limit being determined as part of a larger 
to the radio-quiet QSO surface density program of mapping the galactic halo. 
is 1.3 n° brighter than B = 18.5. It is 

known from the spectroscopy that redder d • i,*/n o 

,. , . , ; TT J TTT • XT- Bright Quasar Survey 
objects of color classes II and III m the 

8^ field are also QSOs. There are ^600 Caltech graduate student Richard 

catalogued objects in these classes, so Green is continuing work on the Palomar 

the number of QSO candidates is sub- 46-cm Schmidt survey designed to find 

stantial. Furthermore, there is a pro- bright quasars over a sky area of about 

nounced incompleteness effect in the edge 10,000 \Zi°- The list of ultraviolet-excess 

zones of the 8^ 1.2-meter Schmidt plate, candidates generated by computer proc- 

Usher's evaluation of the incompleteness essing of the survey films at the Jet 

is a factor of 1.3, which gives a lower Propulsion Laboratory has led to the 

limit of 70 QSOs brighter than B = 18.5 discovery of 9 new bright quasars, as 

in the area, or 1.6 per square degree. well as the detection of 8 previously 

Recent studies of the increase of QSO known, in an area comprising approxi- 

numbers with magnitude are consistent mately 20% of the total survey coverage. 

with the early estimate of ^-^6 times The final sample is expected to provide 

increase per magnitude interval. If so, new insight into the form and possible 

the 8^ field density suggests a growth luminosity dependence of quasar density 

curve of numbers per square degree evolution, as w^ell as an excellent source 

brighter than magnitude B of log N{B) of quasars for spectroscopic study from 

= 0.75-13.7, which is larger by a factor space. 

of 2 than the first estimate by Sandage 

and Luyten in 1967. Sandage empha- Spectroscopic Observations 
Sizes agam that this density is still a 

lower limit because of the large bias Schmidt and Helmut Kuhr, a graduate 

against detection of red QSOs by the student at Bonn University, have essen- 

three-color method. tially completed spectroscopic observa- 

Spectroscopy and photoelectric pho- tions of quasars with inverted radio 

tometry have progressed more slowly in spectra in the S4 part of the 5000 ^IHz 

the 15^ field, but a large number of survey, compiled at the National Radio 

variable QSO candidates have been Astronomy Observatory and at Bonn 

found by Usher, and 80% of those tested University, covering the declination range 



162 



CARNEGIE INSTITUTION 



35 ^"^ to 70'\ Rodshift:? wore obtained for 
all but two of the 29 object* that are 
brighter than magnitude 20 and that 
have a spectral index hirger than -|-0.2 
between 6 and 1 1 cm. The average value 
of T' r^,, is around 0.58 ± 0.05. This is 
lower than the typical value of 0.67 
found previously for quasars with steep 
radio spectra, qualitatively confirming 
a similar finding reported last year. 
Quasars with flat and inverted radio 
spectra appear to show much less evolu- 
tion (a smaller density increase toward 
large redshifts) than those with steep 
radio spectra. 



Infrared Photometry of QSS 

A significant fraction of a program of 
observations from 0.3 to 10 /xm of all 
QSS brighter than T^ = 17 has been 
completed by Becklin, Matthews, and 
Neugebauer using the infrared photom- 
eter at the 5-meter telescope and by Oke 
using the multichannel spectrometer. Al- 
though the observations are just now 
being analyzed, several aspects of the 
infrared-continuum energy distribution 
of quasistellar objects are clear. 

1. Even within the limited sample 
there is clear evidence for several types 
of continua. 

2. In a very general sense, the flux 
density Sv rises with decreasing fre- 
quency; i.e., Sv oc v~^ The energy distri- 
bution cannot, however, be characterized 
by simple power laws even within the 
range 1 to 10 /xm. 

3. Although some quasars emit most of 
their energy in the infrared at wave- 
lengths equal to or greater than 10/xm, not 
all do. In particular, a significant frac- 
tion emit their maximum energy around 
3 fxm (see Fig. 6). The data are being 
studied with a view to understanding the 
nature of the infrared radiation and, in 
particular, whether there is any evidence 
for thermal radiation (e.g., arising from 
heated dust) as well as nonthermal radi- 
ation. 



2.0 - 



3C66A 




0.5 



BL LAC (X 1/2) 



3.5 2.2 1.6 1.25 
X {^) 



Fig. 6. Infrared energy distributions of quasars, 



Absorption-Line Spectra 

Since 1973, Sargent has collaborated 
with Dr. A. Boksenberg of University 
College London on extensive studies of 
the absorption spectra of QSOs, using 
Boksenberg's Image Photon Counting 
System (IPCS) on the Hale Telescope. 
In November 1976, a ''people's" version 
of the IPCS was installed on the Anglo- 
Australian 3.8-meter telescope at Siding 
Spring, NSW. Sargent joined Boksenberg 
and Dr. R. F. Carswell for 11 nights, 
which were devoted to commissioning the 
instrument. During this period, they ob- 
served several bright, high-redshift QSOs 
at a resolution of 1 A. These included 
PKS 2126-158 iz,m = 3.4), Q0002-422 
(z,m = 2.76), Q0130-403 (^em = 3.0), 
Q0329-385 (^em = 2.2), Q0453-423 
(2,„, = 2.66), and Q0046— 315 (^em = 
2.72). About 1500 A of spectrum in the 
earth's frame were observed in each case. 
These observations represent the best 
high-resolution material that has been 
accumulated on QSOs with redshifts 



HALE OBSERVATORIES 



163 



above z^^ = 2.5. They will lead to im- 
portant information on the behavior of 
QSO absorption spectra below the Ly- 
man-a emission line. 

In general, it has not yet proved pos- 
sible to decide where QSO absorption 
lines originate — whether in material 
ejected at high speeds from the QSOs or 
in unrelated intervening objects such 
as galactic halos. Boksenberg and Sar- 
gent used the IPCS at the coude spec- 
trograph of the Hale Telescope in April 
1977 to demonstrate that absorption 
lines are produced in the spectrum of at 
least one QSO, 3C232 with z^^ — 0.53, 
by material in the outer parts of a gal- 
axy, NGC 3067. The sources 3C232 and 
NGC 3067 form one of the QSO-galaxy 
pairs whose existence was pointed out by 
Burbidge, Burbidge, Solomon, and Stritt- 
matter in 1971 {Astrophys. J., 170, 233). 
The QSO lies 1.9' away from the galaxy, 
whose redshift is 2; = 0.005. Haschick and 
Burke (Astrophys. J. [Lett.], 200, L1S7, 
1975) showed that the 21 -cm line is ob- 
served in absorption at a velocity of 
1418 ± 2 km s~^ in the radio spectrum 
of 3C232, despite the fact that the line 
of sight to 3C232 passes 17 kpc away 
from the center of NGC 3067 (an Sa 
galaxy) on the plane of the sky. Boksen- 
berg and Sargent observed the optical 
spectrum of 3C232 in the vicinity of the 
Ca II H and K lines and at a solution 
of 1 A. They found absorption lines cor- 
responding to Ca II H and K at a red- 



shift of 1406 ± 11 km s-^ The lines 
are quite strong — K has an equivalent 
width of 0.4 A. A line of this strength 
would require a typical path length of 
about 1.3 kpc in the Galactic plane near 
the sun ; however, it has been shown that 
interstellar lines of comparable strength 
can be found in the spectra of globular- 
cluster horizontal-branch stars in the 
halo of our Galaxy. 

The observations by Boksenberg and 
Sargent establish that heavy elements 
are present in the interstellar gas far 
out in the halo of the disk of a spiral 
galaxy which could produce QSO absorp- 
tion lines. Furthermore, the line of sight 
to 3C232 lies well beyond the Holmberg 
radius of NGC 3067, so that this galaxy 
presents a much larger cross section for 
the production of absorption lines than 
would be expected from its optical size. 
Other cases of QSO-galaxy pairs will 
be examined during the next observing 
season. 

Peculiar Quasars 

Observations of the peculiar quasar 
0846+51W1 were continued by Arp and 
Sargent. Its brightness increased by 
about 4 mag in less than one month. Sub- 
sequent observations have shown low- 
contrast emission lines w^hen its magni- 
tude is about 20. The suspected redshift 
is being confirmed and the history of its 
light variations is being prepared. 



OBSERVATIONAL COSMOLOGY 



The Velocity Field of Nearby Galaxies 

Velocities for all but 15 galaxies in the 
Shapley-Ames catalog of 1249 bright 
galaxies are now known and have been 
collected, together with new galaxy types, 
into a revised catalog by Tammann and 
Sandage. The purpose is to provide a 
sample to a given magnitude limit whose 
biases are known, so as to permit deter- 



mination of the solar motion relative to 
the inner metagalaxy. 

Analysis of the revised Shapley-Ames 
catalog, with its nearly complete velocity 
coverage, was begun by Dr. Amos Yahil 
of Tel Aviv University and Tammann 
in an effort to measure perturbations of 
the local velocity field in the presence of 
density contrasts. The aim is to assess 
the role of gravity in determining the 



164 



CARNEGIE INSTITUTION 



global world model (cf. Sandage. Tam- 
inann. and Hardy. Astrophys. J., 172, 
253. 1972) by iisiiii:!; the velocity per- 
turbations as a measure of the local 
ratio of kinetic energy to gravitational 
potential energy. 

But. as a first step, the solar motion 
relative to the centroid of the Local 
Group of galaxies must be known so as 
to reduce measured velocities of all other 
galaxies to a kinematic frame that has 
relevance to the Universe itself, rather 
than to the frame tied to the sun that 
is rotating about the galactic center and 
translating with the Galaxy. 

Solar Motion Relative to the 
Local Group 

New. very accurate 21 -cm radial ve- 
locities for a number of candidates for 
Local Group membership were collected 
from the literature and averaged by 
Tammann. A solution for the solar mo- 
tion relative to the complete list of pos- 
sible members was made by Yahil. The 
results are discussed in a paper prepared 
for publication (Astrophys. J. 225, 1977 
November 1 issue) by Yahil, Tammann, 
and Sandage. 

The best-fit solar motion relative to 
the centroid of the Local Group is v{0) 
=: 308 ±: 23 km s~^ toward the galactic 
coordinates I = 105° ± 5° and b = 
— 7° zt 4°. The solution is very well 
defined by those galaxies that are un- 
questionablv Local Group members 
rM31. M33. IC 1613, NGC 6822, and 
Fornax; the Large and Small Magellanic 
Clouds were not used, as they are satel- 
lites of our Galaxy and hence do not 
define the solar motion relative to the 
Local Group itself). With a preliminary 
solution for the apex and motion from 
these five certain members, it became 
apparent that other candidates are con- 
sistent with the solution and are almost 
certainly members on the basis of kine- 
matics alone. They are IC 10, the Pega- 
sus dwarf (DDO 216 or A 2326), the 
Wolf-Lundmark-Mellott dwarf (DDO 



221, A 2359), Leo A (DDO 69, A 0956), 
and IC 5152. These, together with the 
original five, define the final solution 
quoted above. 

The dispersion about the adopted 
ridge-line solution is very small at o- := 
±45 km s~^ for the radial velocities. If 
the membership is defined by the 11 
positive members listed here, this dis- 
persion specifies the mean random mo- 
tion within the Local Group to within a 
factor of ^ V3. 

A few objects sometimes mentioned as 
candidate members of the Local Group, 
namely, IC 342, NGC 6946, NGC 404, 
and Maffei 1 and 2, are certainly not 
members. They fall 300 km s~^ above 
the ridge-line solution and are clearly 
expanding away from the Local Group 
w^th the Hubble flow. 

Possible but unlikely members, again 
based on kinematics alone, are DDO 187, 
GR 8, Sextans A, Sextans B, and NGC 
3109. All five have positive residuals 
relative to the adopted solution of about 
125 km s~^ and may be the nearest 
galaxies that show the cosmological ex- 
pansion. It is important to test this by 
determining precise distances to these 
highly resolved dwarfs from detailed 
studies of their stellar content (Cepheids, 
brightest stars, etc.). Most are accessible 
from Chile with the du Pont 2.5-meter 
telescope, and a special long-range search 
for Cepheids in these systems, together 
with Wolf-Lundmark-Mellott and IC 
5152, will be started during the 1978 
observing season. 

Evidence for a Positive Curvature 
of the Hubble Diagram for 
Brightest Cluster Galaxies 

Kristian, Sandage, and Westphal are 
continuing their program of redshifts 
and magnitudes for brightest cluster 
galaxies to extend the Hubble diagram 
to large redshifts. In the second paper 
of a series, they present new photometry 
for 33 clusters and new redshifts for 50 
clusters, extending to z = 0.75. The new 



HALE OBSERVATORIES 



165 



data, combined with earlier samples, 
show evidence for a positive curvature 
of the Hubble diagram with a formal 
value of ^0 (uncorrected for evolution) 
of 1.6. 

The change of measured colors with 
redshift agrees with Whitford's standard 
galaxy predictions as far as 2 = 0.25 
for 5 — y and z = 0.5 for Y — R. For 
larger redshifts, the B and F pass bands 
move to ultraviolet wavelengths in the 
galaxy rest frame that are below the 
atmospheric cutoff; for such wavelengths, 
data for nearby galaxies must be ob- 
tained from above the earth's atmosphere. 
A. D. Code and G. A. Welch have 
recently given results (preprint) from 
the Orbiting Astrophysical Observatory 
which indicate that the energy distribu- 
tions of ellipticals show a spread from 
galaxy to galaxy that increases toward 
shorter ultraviolet wavelengths. If uni- 
versally true, this would mean that K- 
corrections at very large redshifts would 
be expected to show a similar spread. 
The Kristian-Sandage-Westphal data 
are neither very numerous nor very ac- 
curate at large redshifts, but both the 
B — V and V — R data suggest that the 
brightest clusters lie near to the Code 
and Welch results for NGC 4486, which 
are at one extreme of the spread in the 
OAO data. The measured cluster colors, 
which at first become systematically 
redder with redshift, eventually turn over 
(at z ^ 0.25 for B — 7 and z -- 0.5 for 
V — R) and become bluer with increas- 
ing z. This strengthens the suggestion 
by R. Kron that extremely distant 
clusters may appear to be relatively blue. 

To avoid possible difficulties with the 
K-correction and with possible selection 
effects for the largest redshift clusters, 
Kristian, Sandage, and Westphal re- 
stricted the analysis of their sample to 
clusters with z < 0.4. The data in the V 
and R pass bands were analyzed inde- 
pendently; they give the same results. 
The currently available data samples 
show, for the first time, a significant de- 
parture of the Hubble diagram from a 



straight line, with persistent indication 
of a positive curvature. 

If no evolutionary corrections are ap- 
plied, the formal best-fit value for q^ 
is 1.6 ± 0.35. The dispersion in the abso- 
lute magnitudes of the brightest cluster 
galaxies continues to be strikingly .small: 
the best-fit values are Mv = —23.28 and 
Mu = —24.09, with a standard devi- 
ation of 0.04 mag and a dispersion of 
0.28 mag in each pass band. 

The effects of the standard corrections 
on the value of Qo were also investigated 
for this datum sample. The color data, 
as discussed above, support the use of 
the standard Whitford X-corrections to 
V and R magnitudes at least as far as 
z ^ 0.5. Earlier discussions of the cor- 
rections for cluster richness and Bautz- 
Morgan contrast class are essentially un- 
changed by the new data. The effect of 
the richness and B-M corrections is to 
decrease both the dispersion in absolute 
magnitude and the computed value for 
Qo'. if the corrections are not applied, the 
best-fit value for Qo increases to 2.2. 

The aperture correction, which reduces 
measurements at different z's to the same 
intrinsic size at the galaxies, involves a 
dilemma in principle. To apply the cor- 
rection properly, one should know the 
true value of ^0 in advance in order to 
compute the correction. Detailed investi- 
gation showed, however, that the sensi- 
tivity to Qo is sufficiently small so that 
an iterative procedure may be used to 
converge quickly to a self-consistent 
single best value of Qq. The basic reason 
for the relative insensitivity of the aper- 
ture correction to Qo is that the standard 
metric size chosen is so large that the 
change of total magnitude with aperture 
is slow; i.e., the growth curve is rather 
flat. 

After a lapse of nearly fifty years since 
Hubble's original discovery of the red- 
shift-distance relation, and its extension 
by a factor of 200 in distance, the data 
appear to be near to fulfilling their 
original promise as a possible test for 
cosmological models. The viability of 



166 CARNEGIE INSTITUTION 

this approach for finding (jo is now en- ciple. Plate material for the sample has 

tirely dependent on the outcome of efforts been obtained by John G. Hoessel, a 

to understand the nature and size of Caltech graduate student, and will be 

gahixy evokition eftVcts ^luring the look- used for surface photometry of the 

back time. To consider two opposite brightest ellipticals to study the effects 

cases, the present data show that if the of dynamical friction and the universality 

universe is nearly empty (^o ^ 0), then of the ^'growth curve" for such systems, 

gah^xies nuist have been about 1 mag The evolutionary changes brought 

brighter at z = 0.4. On the other hand, about by dynamical friction are of very 

if there has been no net brightness evolu- great interest for observational cosmol- 

tion since z =: 4, then the data show that ogy, but observational tests are difficult, 

the universe is firmly closed, finite, and One such test is the observation of the 

oscillating. structure and frequency of binary gal- 
axies in clusters. It is predicted that such 
systems should arise from frictional in- 

The Hubble Diaqram teractions but should be short-lived; the 

end result is a merger to form one larger 
The survey by Gunn and Oke for faint system. A study has been undertaken 
clusters of galaxies has continued this by Gunn, graduate student John Hoessel, 
year with somewhat reduced effort, the and Dr. Gillian Knapp to obtain surface 
emphasis having been on spectroscopy photometry and velocity data on all the 
with the SIT spectrograph. The format binary central galaxies in the Gunn- 
of the survey has been changed some- Thuan sample. The plate material is 
what owing to improvement in plate ma- roughly half complete, and the spec- 
terials. Nitrogen-baked and hydrogen- troscopic observations barely begun, al- 
soaked 098-04 plates made with the though some material exists from the 
Wynne field-corrector at the prime focus Gunn-Thuan redshift program, 
of the 0-meter Hale Telescope reach It has been speculated that the giant and 
about as deep in a 20-min exposure as do supergiant galaxies found as the central 
image-tube plates. The direct plates are members of great clusters arise through 
also of much higher astrometric quality, frictional accumulation of small galaxies 
and it is expected that the survey will be in the cluster. A graphic example of this 
conducted with them henceforth. Thirteen process may be evident in the central 
such plates have been obtained this year galaxy in Zw 01 0257+35, in which many 
under conditions of good to excellent tidally stripped nuclei of high surface 
seeing, with the discovery of four distant, brightness are circulating in a common 
rich clusters. The SIT spectrograph has envelope. The predicted frictional life- 
been used to obtain redshifts for eight time of this system is very short under 
additional clusters in the sample. reasonable dynamical conditions. Gunn 
Acquisition of redshift data for the and Caltech graduate student Donald 
Gunn-Thuan complete' Abell cluster sam- Schneider have undertaken a dynamical 
pie (all Abell clusters with />) < 4, i? > study of the system. Preliminary results 
1, and I 6 I > 30°, 102 in all) was fin- indicate that the light and mass of the 
ished this spring. Photometry for a large central object are about the same as 
part of the sample will be redone in the those of central galaxies in clusters, sug- 
coming year. With these data, the low- gesting that such objects may well be the 
redshift end of the Hubble diagram will progenitors of some or all supergiant 
be defined as well as it can be in prin- systems. 



HALE OBSERVATORIES 



167 



THEORETICAL STUDIES 



The Abundance Distribution in the 
Galactic Halo 

Searle has developed a model for the 
chemical evolution of the halo. He pro- 
poses that initially the protohalo con- 
sisted of a number of chemically isolated 
gaseous fragments. Within each of these, 
before the Galaxy's collapse, a small 
number of globular clusters formed. In 
this phase globular cluster formation is 
supposed to be the main process of star 



formation and chemical enrichment; the 
metal abundance in each fragment, at a 
particular time, is simply proportional 
to the number of clusters that have, up 
to that time, formed within it. Eventually 
the clusters formed in these fragments 
tumble together to form the present halo. 
Searle has shown that random cluster 
formation within these fragments leads 
to a distribution over metal abundance 
that is in good agreement with that ob- 
served in the system of halo clusters. 



INSTRUMENTATION 



''Charge-Coupled^^ Detectors 

With the aid of a President's Fund 
grant, a collaborative program between 
the Jet Propulsion Laboratory and the 
Observatories to build a charge-coupled 
detector (CCD) camera for direct imag- 



13 A should become a nearly ideal de- 
tector. 

In connection with a proposal for the 
Wide Field Camera on the Space Tele- 
scope, Westphal and Kristian have con- 
ducted a number of laboratory and 
telescope tests on some experimental 
ing and low-resolution spectroscopy has CCD area detectors produced in a joint 



continued. This work is being done by F. 
Landauer and R. Locke at the Jet Pro- 
pulsion Laboratory and by Oke. The 
original camera was rebuilt to (1) ac- 
commodate CCDs of the latest type, (2) 
put the critical electronics adjacent to 
the CCD, and (3) use dry ice as the 
refrigerant. The camera has been used 
very successfully with the digital spec- 



development program by the Jet Pro- 
pulsion Laboratory and the Texas Instru- 
ments Corporation. The targeted pho- 
tometric and noise properties of the 
detectors promise a substantial improve- 
ment over previous devices. The tele- 
scope tests produced excellent images of 
extended objects; photometric tests of 
stars agreed with photoelectric measure- 



trograph in the range 6000-9000 A. The ments by Sandage to better than 2% 

rms readout noise was about 250 elec- over a range of 11 mag. 

trons, which is still slightly higher than 

the noise introduced by the background 

sky brightness when a resolution of 13 

A per pixel is used. Notwithstanding this, 

good spectra of quasars were obtained, 

and the effective quantum efficiency was 



Photon-Counting Spectrometers 

A gift from Mr. Francis L. Moseley 
permitted the establishment of an elec- 
tronics laboratory at the Santa Barbara 



over 30% between 8000 and 9000 A. If Street offices, in which Shectman is con- 

the readout noise can be decreased by tinning the development of photon- 

about a factor 3, which should be achiev- counting image-intensifier spectrometers, 

able, the system noise will become negli- A system for the Cassegrain spectrograph 

gible compared with the incoming light of the Las Campanas 2.5-meter telescope 

signal, and the CCD at a pixel width of is being developed under a grant from 



168 



CARNEGIE INSTITUTION 



the National Science Foundation. A full- 
time engineer. Mr. Gary Yanik, is sup- 
ported by this project. 

A consortium of astronomers organized 
by Shectman obtained XSF support for 
the development by Reticon Corporation 
of a special dual array of photodiodes 
particularly suited for astronomical spec- 
trometers. The two rows, each of 936 
diodes, permit simultaneous measure- 
ment of star and sky spectra with a 
large number of resolution elements. A 
dual array of this type is being adapted 
to the photon-counting system described 
in Year Book 75 (p. 319). 

Infrared Photometer 

The infrared photometer for the du 
Pont telescope was completed by Persson 
and Matthews. The device allows arbi- 
trary placement of "signal" and ''refer- 
ence" beams on the plane of the sky up 
to a separation of 6'. The chopping 
frequency can be higher than 40 Hz, with 
an acceptable duty cycle. Two detector 
systems are being tested. One is a 1.2 to 
5 /x InSb system that has two filter wheels 
and interchangeable detectors. The other 
is a liquid nitrogen-cooled GaAs system 
for use from 3300 to 8900 A. These can 
be operated separately or simultaneously 
or with a lO-yiA system. 

Under the supervision of Gunn, work 
on the coldbox for a large-format prime- 
focus silicon Vidicon camera tube is near- 
ing completion, and work has begun on 
the construction of the electronics for 
the system. It is, as of this writing, un- 
clear whether the system will be sup- 
planted by large CCDs as soon as it is 
finished, but in either case a detector of 
very large dynamic range and very high 
quantum efficiency will be available 
shortly for direct imaging at the Hale 
Telescope. Accurate photometry to the 
25th magnitude and detection deeper than 
26 mag should be available in reasonable 
(less than 1 hour) exposures. The elec- 
tronics will also be used for the blue 
detector on the tandem spectrograph 



under construction ^or the Cassegrain 
focus, which will presumably be a large 
SIT vidicon. 

A new data system for the Griffin- 
Gunn radial velocity spectrometer of the 
5-meter telescope has been built by S. 
Knapp. The machine is now under direct 
control of the PDP 11/40 computer, 
which does real-time reduction of radial 
velocities and displays the cross-correla- 
tion traces. The software development is 
being done by Zimmerman. 

A data system for the Caltech 2-axis 
Mann measuring engine has been de- 
signed by Gunn, S. Knapp, and Hoessel. 
The machine will make use of a linear 
512-element Reticon array to record and 
digitize 512 strips across a plate at once, 
resulting in considerably faster data ac- 
quisition than is possible with current 
machines. The control and recording 
functions will be performed by a PDP 
11/34 minicomputer. The device should 
be fully operational soon. 

A versatile SIT system for both spec- 
troscopy and direct imaging at the Palo- 
mar 1.5-meter telescope is under con- 
struction under Gunn's general direction, 
though most of the work is being done 
by the Caltech graduate students led by 
S. Kent and advised by S. Knapp. The 
system, which is essentially a copy of 
the Gunn-Oke-Schmidt system for the 
Hale Telescope, can operate in either a 
256 X 256-element imaging mode or a 
128 X 512 spectroscopic mode. The con- 
trol system is significantly more com- 
plex and sophisticated than the one at 
the 5-meter telescope in order to meet 
computer limitations. 

Palomar Aluminizing Program 

In 1976, a program was initiated to 
make it possible to aluminize all mirrors 
of the Palomar telescopes approximately 
every two years, or more often if neces- 
sary. This required many improvements. 
The first step was a complete rebuilding 
of the vacuum system for the 5-meter 
aluminizing tank. After this was com- 



HALE OBSERVATORIES 



169 



pleted, the 5-meter mirror was aluminized 
successfully. More recently, a large crane 
was added to the coude spectrograph 
room to permit safe removal of the 1.2- 
meter mirror of the 3.7-meter camera. 
Finally, handling fixtures for various 
other mirrors were manufactured. For 
removal of the 1.2-meter Schmidt pri- 
mary mirror, a handling truck will be 
especially designed and built. 

5-Meter Telescope Control Room 

A new control console for the 5-meter 
Hale Telescope is being assembled in 



the data room on the observing floor. 
This console will integrate analog and 
computer functions and al.so encompass 
the new control computer and the TV 
guider system. All the electronic wiring 
between the telescope and the computer 
room, and the computer room and com- 
puters and the data room, has been re- 
organized in such a way that the various 
cable connections become available to 
any user who needs them, and the elec- 
tronic setups become much easier and 
obvious. A new electronics servicing room 
was built next to the computer room on 
the mezzanine floor. 



ASTROELECTRONICS LABORATORY 



With about 12 specialists headed by 
J. T. Fridenberg, the Laboratory de- 
signed, constructed, and installed several 
systems or devices. 

A new control system is being engi- 
neered for the 5-meter Hale Telescope. 
This system is patterned after the suc- 
cessful Microprocessor Automatic Con- 
trol System (MACS) developed for the 
2.5-meter du Pont Telescope at Las 
Campanas. Designed to offer greatly im- 
proved convenience and precision of 
control, it will provide for raster scan- 
ning, blind offsets, variable set and guide 
rates, automatic increase in the RA set 
and guide rates in approaching the pole, 
user-selectable epoch, and 64 user- 
selected input-output functions. 

Final installation of the control system 
of the 2.5-meter du Pont Telescope was 
completed by Laboratory personnel prior 
to the telescope dedication in October 
1976. Microprocessors continually up- 
date the telescope position and provide 
other information. The refraction cor- 
rections and necessary tracking-rate cor- 
rections are continuously generated. An 
appropriate algorithm was incorporated 
for automatic dome rotation. 

The Astroelectronics Laboratory 
(AEL) designed and built the basic con- 



trol systems and the multiplexed control 
systems for the family of auxiliary in- 
struments used with the du Pont Tele- 
scope. Each of these auxiliary instruments 
has completely self-contained electronics 
and may be operated and tested sepa- 
rately. When mounted on the telescope, 
auxiliary instruments can be remotely 
controlled from the data room. Among 
the instruments for which the Laboratory 
completed new electronic systems are the 
auxiliary instrument mounting base, off- 
set guiders, the Cassegrain plate camera, 
and the Cassegrain spectrograph. 

Two projects for the Mount Wilson 
Observatory received attention during 
the year. The first was an electronic sys- 
tem for the stellar chromosphere spectro- 
graph designed by Vaughan. Essentially 
a four-channel spectrometer that meas- 
ures H and K line emission, together 
with continuum reference intensities, the 
instrument operates and prints out data 
under the control of a microprocessor. 

With the gift of two high-resolution 
single-turn encoders from Hewlett-Pack- 
ard, AEL is building a system to provide 
accurate digital display of telescope 
coordinates of the 2.5-meter Hooker tele- 
scope on Mount Wilson. The new system 
will correct the coordinates for atmos- 



170 



CARNEGIE INSTITUTION 



pheric refraction and will also provide 
readout of universal time, sidereal time, 
and the calculated air mass. This system 
uses a new digital clock designed at AEL 
in wliich a microprocessor calculates the 
sidereal time continuously from the uni- 
versal time and the date. The new system 
is not only less expensive than others 
but has the primary advantage that one 
need only set the universal time with a 
standard such as WAVV; the sidereal time 



is automatically calculated and con- 
tinuously updated. A similar clock is 
being provided for the du Pont Telescope. 
AEL constructed and installed an im- 
proved data system for the Oke multi- 
channel spectrometer on the 5-meter 
telescope. The "Multichannel II" is a 
self-contained 64-channel pulse-counting 
system that can be operated separately 
or can be used with a PDP-11 computer 
to permit real-time data reduction. 



GUEST INVESTIGATORS 



Dr. Saul J. Adelman of Boston Uni- 
versity continued the reduction of coude 
plates and spectrophotometric data taken 
during previous years. He has completed 
an analysis of r Herculis, B4 IV {Mon. 
Xotic. Roy. Astron. Soc, in press), and 
worked on o Pegasi, Al V, and Aquilae, 
B9.5 III as part of a program to analyze 
a number of sharp-lined normal and near 
normal mid-B to F stars in a consistent 
manner. Line identification studies of 
several Ap stars are in progress. Study 
of the energy distributions shows that 
the broad continuum feature near A5200 
is found in at least 90% of the Ap stars, 
while it is almost absent in the normal 
and HgMn stars. The feature near A4200 
occurs with almost the same frequency, 
while that near A6300 is rather rare. 

Mr. Gonzalo Alcaino of Santiago used 
the 1 -meter Swope Telescope at Las 
Campanas for nine nights in June and 
November to obtain direct plates for his 
work on the color-magnitude diagrams 
of globular clusters. 

Dr. L. H. Aller of the University of 
California at Los Angeles and Dr. Stanley 
Czyzak of Ohio State University con- 
tinued their collaborative program on 
planetary nebulae. They obtained photo- 
electric scanner tracings of objects such 
as .1320 and NGC 2440. With the image- 
tube camera built by Holland Ford of 
L'.C.L.A,, they obtained excellent plates 
of NGC 1535, 2022, 2371-72, 2440, and 



3242 at the Cassegrain focus of the 1.5- 
meter reflector in February 1977. They 
also obtained high-dispersion spectro- 
grams of the bright ring in NGC 7009. 
They wTre able to supplement earlier 
plates secured on the minor axis with a 
three-night exposure on the major axis 
and were able to observe a number of 
faint lines with excellent resolution. 
These spectroscopic observations are 
supplemented by plates secured with the 
image-tube camera, photelectric scans 
obtained with the Oke scanner (in previ- 
ous years), and some data obtained at 
Lick with the image-tube scanner. A 
paper on the spectrum of NGC 7009 
calling attention to some of the difficul- 
ties in deriving elemental abundances 
was presented at the Pomona meeting of 
the Astronomical Society of the Pacific. 

Mr. P. Bastiaansen of Leiden Observa- 
tory used the 1 -meter Swope Telescope 
of the Las Campanas Observatory in 
February and April 1977 in a survey for 
interstellar circular polarization for a de- 
tailed study. He used the Leiden three- 
channel polarimeter, with pass bands of 
500 to 1000 A in the visible and near in- 
frared. Three stars with a high probabil- 
ity (at the 3cr level) of circular polariza- 
tion were found: HD 93873, 112364, and 
152246. 

With the 5-meter Hale Telescope at 
Palomar and the 2.5-meter Hooker tele- 
scope at Mount Wilson, Dr. Howard E. 



HALE OBSERVATORIES 



171 



Bond of Louisiana State University pur- 
sued a program of coude spectroscopy 
of objects, most of which were originally 
noted on objective-prism plates obtained 
at Cerro Tololo: 

1. Subgiant CH stars. These are F- 
and G-type stars that appear to have 
returned to the vicinity of the main se- 
quence in the H-R diagram, following a 
violent mixing event that occurred when 
they were red giants. The high-dispersion 
spectrograms confirm the enhancement of 
CH and the s-process elements in their 
spectra and indicate high surface gravi- 
ties. Adequate material for abundance 
analyses is now available for HD 88446, 
HD 89948, HD 182274, and HD 216219. 

2. Extremely metal-deficient red giants. 
Bond's objective-prism plates have pro- 
vided several new stars of this type 
bright enough for coude spectroscopy. 
Sufficient high-dispersion material for 
abundance analysis exists for HD 2796, 
HD 4306, HD 6268, HD 110184, HD 
184266, HD 216143, and HD 218857. 
Very preliminary indications are that 
HD 4306 and HD 110184 are the most 
metal-deficient stars now known, having 
only about 1/1000 solar heavy-element 
content. HD 184266 is also of interest as 
a probable F- or G-type field horizontal- 
branch star. 

3. Miscellaneous. During periods of 
poor seeing, high-dispersion spectrograms 
of various bright stars of interest were 
obtained. These included the carbon- 
deficient red giants HR 885, HR 1023, 
HR 6467, and HR 6766; a spectroscopic 
binary that Bond is studying in collabo- 
ration with G. Wallerstein, HD 214686; 
and three possible RS Canum Vena- 
ticorum-type binaries, HR 1099, HR 
1362, and 39 Ceti. 

All of the spectrograms have been 
traced and measured for radial velocity, 
and the abundance analyses are under 
way in collaboration with an NSF-sup- 
ported postdoctoral fellow at Louisiana 
State L^niversity, R. Earle Luck. 

Dr. A. Boksenberg and Dr. R. F. Cars- 
well of University College London, col- 



laborated with staff astronomers in the 
use of the image photon-counting spec- 
trometer. R^eferences will be found in the 
sections on x-ray sources and on quasars. 

During the past year, Dr. E. F. Borra 
of Universite Laval, Quebec, and Dr. J. 
D. Landstreet of the University of West- 
ern Ontario continued to use the L5- 
meter telescope at Palomar Mountain to 
search for and measure magnetic fields 
in Ap stars and other upper-main-se- 
quence stars. This work has been done 
using the University of Western Ontario 
Pockels cell polarimeter with narrow- 
band interference filters to measure the 
circular polarization induced in the wrings 
of stellar Balmer lines by the longitudinal 
Zeeman effect. Magnetic curves have 
been obtained by this method for the 
known magnetic stars 53 Camelopardalis 
and o? Canum Venaticorum (Astrophys. 
J., 212, 141, 1977), HD 32633, 78 Vir- 
ginis, HD 133029, ^ Coronae Borealis, 
and HD 215441. Fields have been de- 
tected in the Ap stars CU Virginis, (f 
Draconis, and 6 Aurigae (Astrophys. J. 
[Lett.'], 212, L43, 1977), and also in y 
Aurigae S, 3 Scorpii, 52 Herculis, HD 
170397, and HD 196178. A survey of all 
northern Ap stars brighter than V := 5.0 
is almost complete to a level of o-h < 
300 gauss. 

Drs. D. G. Currie, K. M. Liewer, R. 
Braunstein, and J. Johnson of the L^ni- 
versity of Maryland, and S. L. Knapp 
of the California Institute of Technology 
have continued the program of amplitude 
interferometry observations that have 
been conducted on the 5-meter and 1.5- 
meter telescopes on Palomar ^Mountain 
and the 2.5-meter and 1.5-meter tele- 
scopes at Mount Wilson. The primary 
emphasis of this program has been on 
stellar diameter measurements. Recent 
observations have been made on « Ceti 
(which has a diameter of 0.011"), a 
Tauri (0.018'0, « Orionis (0.052'0, ^t 
Geminorum (0.015") , as well as o- Librae 
and 8^ Lyrae and T Cephei for which 
the data have not yet been analyzed. 
These observations were typically con- 



172 



CARNEGIE INSTITUTION 



ducted in two or throe wavelength re- 
gions (most of which had a width of 
about 100 A) to explore the general 
wavelength dependence of the "hmb 
darkening" and the effects of molecuhir 
band structure. Most of these measure- 
ments have liad an internal precision 
between one and four thousandths of an 
arcsecond. This precision has been em- 
pirically determined by repeated observa- 
tions made on succeeding nights; it has 
been confirmed by comparing the value 
of the diameter for stable stars measured 
during different years and on different 
telescopes. 

A spectroscopic study of Southern H 
II regions was carried out by Drs, A. C. 
Danks and J. ^lanfroid of Kapteyn 
Sterrewacht, Holland, using the 1-meter 
Swojie Telescope with the Carnegie 
image-tube spectrograph. Many of the 
objects chosen were from the Rodgers- 
Campbell-Whiteoak catalog. It is hoped 
to obtain detailed information from these 
spectra on T^, N^, ionization, and abun- 
dance. Many of the objects were selected 
because they are known to exhibit IR 
emission. From the Balmer decrement, 
an estimate of extinction can be made 
from which it is hoped to obtain better 
information of the gas-to-dust ratio in 
these objects. 

Furthermore, several prominent SO 
galaxies were observed, chosen from 21- 
cm observations because of their large 
H I content. A .search for emission lines 
was made in the nuclear region for evi- 
dence of H II. None was found. The SO, 
NGC 5102, was of particular interest 
because dust lanes have been observed 
in its nucleus. However, no emission lines 
were detected. 

Dr. Neal J. Evans II of the University 
of Texas was unable to obtain new ob- 
servations because of bad weather. How- 
ever, he made progress on interpretation 
and publication of results obtained 
earlier. The work on infrared sources in 
Monoceros R2 and on new infrared 
sources associated with OH masers was 
prepared for publication. This represents 



the culmination of work directed at es- 
tablishing the nature of a class of un- 
identified OH masers emitting principally 
at 1612 MHz. Sources w^ere found at 10 
microns for each of 6 OH masers with 
accurate positions. The variability, 
energy distributions, and luminosities of 
these infrared sources support the con- 
tention that they are evolved stars, such 
as Mira variables, with extremely thick 
circumstellar shells. It is from these shells 
that the infrared and maser emission 
arises. 

Another series of papers has the aim 
of presenting a clearer picture of the 
cloud conditions (temperature, density, 
molecular abundances) and energetics 
(heating and cooling rates for the gas 
and dust). Five to six clouds have been 
selected for this detailed analysis, and 
work on two (S255 and SI 40) has been 
completed. The other clouds are lacking 
primarily the 10-20 fx data. This project 
is being done in cooperation with S. Beck- 
with and D. Nadeau of Caltech. 

Dr. Jay A. Frogel of Cerro Tololo 
Interamerican Observatory has collabo- 
rated with Persson on several projects 
involving infrared observations: 

1. Photometric studies of composite 
stellar systems. JHK magnitudes and CO 
and H2O indices were measured in 50 
early-type galaxies and 5 globular clus- 
ters. They found that (a) the brighter 
galaxies are characterized by giant- 
dominated stellar synthesis models; {h) 
at 2.2 /A nearly 40% of the light comes 
from giants at least as late as M5; (c) 
the galaxian broad-band colors tend to 
redden with increasing luminosity and 
decreasing aperture size; (d) in bright 
galaxies the relative changes oi U — F, 
V — y, and J — K as functions of radius 
differ from the relative changes as func- 
tions of luminosity at a fixed radius; and 
ie) the integrated colors of globular 
clusters are sensitive to metallicity. 

2. In collaboration with Dr. Judith 
Cohen of Kitt Peak National Observa- 
tory, the first part of the study of giants 
in globular clusters was finished; detailed 



HALE OBSERVATORIES 



173 



results will be submitted for publication 
soon. Briefly, JHK magnitudes and CO 
indices for more than 60 stars in M3, 
M13, M92, and M 67 were observed. The 
principal findings are: (a) the infrared 
magnitudes yield very accurate values 
for the bolometric corrections; (6) these 
bolometric corrections and V — K colors 
yield effective temperatures with an ac- 
curacy of ±100°K independent of sur- 
face gravity or metallicity; (c) the CO 
index is very metal-sensitive for metal- 
poor stars and has revealed a CNO 
abundance anomaly in the M3 stars; (d) 
a comparison with theoretical evolution- 
ary tracks results in masses near 0.6 9J? © 
and ages on the order of 10-15 X 10^; 
and (e) there is a serious error in the ef- 
fective temperature calibration of Schle- 
singer's photometry amounting to 250 °K. 

3. IR data for 25 globular clusters in 
M31 has now been obtained. It has been 
found that V — iv is nearly twice as sen- 
sitive to metallicity changes as is t/ — V , 
and also that most metal-rich clusters 
tend to have the brightest K magnitudes. 
Observing runs in September 1977 should 
bring this program to completion. 

4. At Hale and at CTIO, multiaperture 
UBVRJHK data for about 170 early- 
type galaxies in the field and in the Virgo 
and Coma clusters have now been ob- 
tained. These cover a range of 10 in 
absolute magnitude. We are now analyz- 
ing these data and, in particular, are 
examining the dependence of various 
photometric indices on M^ and trying to 
decide which index will be the most use- 
ful distance indicator. Also, galaxies of 
different types and locations are being 
examined for differences. 

Dr. T. Gehrels of the University of 
Arizona continued his survey of solar 
system objects with the 1.2-meter Schmidt 
telescope at Palomar. The plates are be- 
ing used by him and by Drs. C. J. and 
I. van Houten of the Leiden Observatory. 
They report that Trojans of Jupiter 
occur in a peculiar distribution with 
many more in the preceding Lagrangian 
Point (L5) than in the following point 



(JA). No evidence is found for the 
existence of Trojans of Neptune (detec- 
tion limit 240 kilometers radius), Saturn 
(25 kilometers), and Earth (1 kilo- 
meter). 

Drs. R.E.M. Griffin, R. F. Griffin, and 
J. Mitton of the Cambridge Observa- 
tories, England, used the Mount Wilson 
2.5-meter telescope and its coude spec- 
trograph to obtain some of the spectro- 
grams needed for a detailed comparative 
study of Sirius and Vega. The study, 
which is being carried out in its initial 
stages by Mrs. Mitton, promises to be 
of substantial interest because these two 
bright stars, with nominally very similar 
spectral types ( Al V and AO V, respec- 
tively), have very different spectra, 
Sirius being a mild Am star. The new 
Mount Wilson spectra, 3 mm wide at 
dispersions around 1 A mm~^ and mostly 
exposed on the fine-grain emulsions 
Illa-J or 127-04, allow absorption lines 
as weak as 1-2 mA to be detected and 
should provide a broader observational 
base for the study than has been avail- 
able previously. 

The Griffins have begun a similar ob- 
servational program to obtain high- 
quality spectroscopic material on /? 
Geminorum, which appears from a pre- 
liminary reconnaissance to be a very 
normal K giant with strictly solar abun- 
dances. The analysis is to be conducted 
by Mrs. Griffin in collaboration with Dr. 
H. Holweger of Kiel. 

R. F. Griffin, in conjunction with Dr. 
G. A. Radford (also from Cambridge) , 
used the 5-meter telescope to obtain a 
coude spectrogram of a ninth-magnitude 
star, identified in the course of a radial- 
velocity survey of North Galactic Cap 
stars, which is expected to prove to be 
more metal-deficient than any object yet 
documented. 

For the second successive season, bad 
weather largely frustrated the efforts of 
Gunn and Griffin in their work on the 
Hyades w^ith the radial-velocity spec- 
trometer on the 5-meter telescope. Never- 
theless, some progress was made on cer- 



174 



CARNEGIE INSTITUTION 



tain bright Hyades spectroscopic binaries, 
and periods have now been assigned to 
van Biieren 62. 121. and 162. 

Drs. 0. Hanson. D. Matson. and G. 
Veedor of the Jot Propulsion Laboratory 
have oonipleted the manufacture and 
check-out of a now three-channel in- 
frared photonioter, to take full advantage 
of tho rocking secondary on the Mount 
Wilson 1.60-moter telescope. With this 
photometer, they have obtained simul- 
taneous infrared (10 /i) and visual data 
on the rotational variability of a few 
selected asteroids. Preliminary analysis 
indicates that rotational variability is 
caused more by aspherical shapes than 
by albedo variations. Further analysis 
will permit placing limits on the thermo- 
physical parameters relating to asteroidal 
surfaces and their infrared emission. 

Dr. Eduardo Hardy of the Universite 
Laval, Quebec, has continued his studies 
of the age and chemical composition of 
stars in the body of the Magellanic 
Clouds, concentrating on a region 56 □' 
in area, about 6° southeast of the center 
of the Large Magellanic Cloud, and close 
to the LMC populous cluster NGC 2209. 
He has constructed a deep color-magni- 
tude diagram down to T^ ^ 21.5. He used 
photoelectric sequences in that cluster 
published by Walker for calibrating the 
plates, which were obtained at the prime 
focus of the 4-meter telescope at Cerro 
Tololo Interamcrican Observatory. 

Hardy's color-magnitude diagram fails 
to .^how any .substantial number of globu- 
lar clusterlike giants. Rather, the color- 
magnitude array resembles that of the 
intermediate-age clusters in the Galaxy 
in that it contains a distinctive feature 
commonly associated with them — a well- 
populated clump at M, = 0.5. In par- 
ticular, the red-giant branch to which 
the clump belongs is similar to that of 
the intermcrliate-age galactic cluster 
XGC 2158 and the LMC cluster NGC 
2209. It is important to mention that 
NGC 2158 is the only galactic cluster 
whose color-magnitude diagram is simi- 



lar to the intermediate-age populous 
clusters in the LMC. 

Hardy postulates that a strong burst 
of star formation took place in the area 
studied about 2 X 10^ years ago, and 
that this burst was responsible for most 
of the bright LMC members observed 
there. There is also evidence for the 
existence of older stars that form a 
second, less-populated giant branch that 
is fainter and redder than the main one. 

To assess in a more direct way the 
chemical composition of the red giants in 
the field, several K giants distributed 
over the surface of the clouds were ob- 
served spectroscopically. Observations 
were made at CTIO with the Vidicon 
system on the 4-meter telescope. The 
dispersion was 100 A mm~^ and the 
spectrograms covered the region 3900- 
5000 A. Giants in a number of clusters 
of known age and metallicity were in- 
cluded in the program to generate an 
interpolation scheme. The qualitative 
results from the interpolation show that 
the field stars are not of the very metal- 
poor globular cluster variety but resem- 
ble giants of the same spectral type in 
47 Tucanae. Significant differences across 
the LMC or even between the two clouds 
are not seen. 

The combined photometric and spec- 
troscopic data are then consistent with 
an intermediate-age stellar population 
of the nearly normal chemical abundance 
in the peripheral regions of the LMC. In 
the central regions, the interpretation is 
less unambiguous due to the more diffi- 
cult photometric problem of obtaining 
deep C-M diagrams. The qualitative 
spectroscopic results are not in contra- 
diction with an older population of the 
type discussed in Year Book 75 (p. 303). 

In March 1977, Saturn was observed 
by Dr. A. W. Harris of the Jet Propul- 
sion Laboratory. He used direct pho- 
tography through the 1.5-meter telescope 
at Palomar (with a two-channel photom- 
eter) to make preparations for observa- 
tions of two forthcoming eclipses of 
lapetus by Saturn's rings. Background 



HALE OBSERVATORIES 



175 



sky-brightness measurements were ob- 
tained near the planet over the range of 
positions where the eclipse will occur, and 
astrometric plates were obtained for 
ephemeris improvement. 

Mr. Frank Holden of San Jose, Cali- 
fornia, used the 1 -meter Swope Telescope 
at Las Campanas for 15 nights in meas- 
uring visual double stars with a bifilar 
micrometer. 

Dr. J. P. Huchra of the Harvard Cen- 
ter for Astrophysics continued studies of 
the photometric properties of galaxies, 
using the Mount Wilson reflectors to 
obtain UBVR photometry of galaxies. 
This is part of a project in collaboration 
with T. X. Thuan and G. R. Knapp 
aimed at obtaining redshifts and pho- 
tometry for a complete well-defined 
sample of galaxies (the Turner-Gott 
sample) in the Northern Galactic Cap. 

Huchra, with J. Hoessel and J. Elias 
of Caltech, continued work on a near- 
infrared photographic survey of the 
galactic plane, using the Palomar 1.2- 
meter Schmidt. A special hypersensitiza- 
tion technique allows uniform, sky-back- 
ground-limited EV-N plates to be 
obtained in 90 minutes or less, in a 
bandpass free from nebular emission and 
with greater penetration through galactic 
obscuration. A nearby cluster of galaxies 
has been found within 4° of the galactic 
plane. 

Dr. Robert P. Kirshner of the Univer- 
sity of Michigan used the SIT spectrome- 
ter on the 5-meter telescope to obtain 
spectra of six galaxies in the compact 
cluster of galaxies Shakbazian 1. The re- 
sulting radial velocities should provide an 
improved estimate of the velocity disper- 
sion of the cluster (for which there is, at 
present, only an upper limit). In addi- 
tion, the spectra have sufficient resolution 
and signal-to-noise that an estimate of 
the internal velocity dispersion of the 
galaxies themselves will be derived, at 
least for the brightest galaxies. This 
should provide an interesting clue to the 
nature of the galaxies in the cluster and 



the dynamical effect of the cluster on the 
individual galaxies. 

Dr. John B. Irwin of Kean College, 
New Jersey, using the 1 -meter Swope 
Telescope at Las Campanas, has com- 
pleted his first-epoch direct photographic 
observations on 127-04 plates of about 
55 nearby stars. The long exposures in 
the red, typically four hours or more, 
will be duplicated in 1977-78, and the 
pairs of plates will be blinked to discover 
stars of very faint absolute magnitude 
that are companions of these nearby 
stars. 

Drs. T. Johnson, D. Matson, and G. 
Veeder of the Jet Propulsion Laboratory 
have continued their study of the surface 
compositions of selected asteroids and 
satellites, using simultaneous photometry 
at 0.56, 1.65, and 2.2 /xm. Results for 30 
asteroids are in press (Astron. J.). The 
relative reflectances at 2.2 /xm found for 
asteroids in this sample range from 0.9 
to 1.7 (scaled to a value of 1.0 at 0.56 
/xm). This large range and the spread 
seen in the data for so-called S asteroids 
indicate that the classification scheme 
based on 0.3 to 1.1 /xm is not adequate. 
In particular, relatively bright infrared 
reflectances, Rx (2.2 /xm) ^ 7, are sug- 
gestive of an optically significant metal- 
lic component in the surface regolith 
layers of several asteroids. The authors 
have concluded that space weathering 
has not significantly affected the optical 
properties of asteroids; they see no evi- 
dence for the production of glass or 
glassy agglutinates on asteroid surfaces. 

Dr. Gillian Knapp of the Owens Val- 
ley Radio Observatory, with Dr. R. K. 
Ulrich of the University of California at 
Los Angeles, has been using Shectman's 
pulse-counting spectrometer at the coude 
focus of the Mount Wilson 2.5-meter and 
the Hale 5-meter telescopes to measure 
Ha and H^ emission-line profiles of about 
20 T Tauri stars with resolutions of 5 A 
mm~^ and higher. Observations of eight 
stars have been obtained. By comparing 
the emission profiles, it is hoped to de- 
termine whether the ionized matter asso- 



176 



CARNEGIE INSTITUTION 



ciated with these stars is due to mass 
infall or outflow. 

Dr. Jolin Korinendy of the University 
of California at Berkeley has continued 
a study of the distinct components in gal- 
axy-brightness distributions {Year Book 
76, p. 327 1. Altogether. 240 plates for 
surface photometry have been accumu- 
lated for this and related work. The 
photometric data are now complete ex- 
cept for a few photoelectric zero-point 
measurements. Rapid scanning with the 
PDS microphotometer and reduction of 
the plates are planned for the winter of 
1977. 

Kormendy also began a survey pro- 
gram to study the interaction of bars and 
their related components: lenses, inner 
rings (e.g.. NGC 2523 in the Hubble 
Atlas), outer rings (e.g., NGC 2859), and 
the nature of the spiral structure. The 
121 brightest SB galaxies north of —30° 
declination were examined on the Sky 
Survey copy plates, supplemented by 
Schmidt Illa-J plates and 2.5-meter tele- 
scope plates when available. The fre- 
quency of occurrence and size distribu- 
tions of the various components w^ere 
measured, with the following main re- 
sults: 

1. Of all SBO-SBa galaxies, 54% have 
both a bar and a lens. There is an inti- 
mate connection between these com- 
ponents: in 17 of 20 cases, the bar ex- 
actly fills the lens in one dimension. In 
contrast, no survey galaxies of type 
SBab-SBc had lenses, but 76% had inner 
rings. Clearly lenses are an important 
component in early-type barred galaxies, 
comparable in frequency to the rings 
occurring in later types. 

2. These and other observations sug- 
gest, but do not prove, that there is a 
process that makes some bars evolve 
fairly rapidly into nearly axially sym- 
metric objects. The result is a lens. Since 
half of all early-type SB galaxies are 
transition cases, the process is secular. 
If there is evolution, the more likely 
direction is from bar to lens, because 
bars are generally believed to form by 



dynamical instabilities in the violent 
phase of galaxy formation. It is suggested 
that processes of internal secular evolu- 
tion can dramatically alter galaxy struc- 
ture. 

3. The distribution of apparent axial 
ratios suggests that inner rings are round. 
Lenses are slightly tri-axial, with a pre- 
ferred equatorial axis ratio of ^0.9 ± 
0.05. Outer rings can be circular, but are 
usually prolate, the shortest dimension 
being the one filled by the bar. 

4. The sizes of rings and lenses are 
well correlated with the absolute magni- 
tude of the galaxy, such that the mean 
surface brightness is constant for each 
morphological type. Bars and lenses have 
the same size distributions. 

5. The disk structure was examined to 
see whether bars are associated with 
global spiral patterns, usually interpreted 
as density waves, or with NGC 2841-type 
disks, which have many short spiral fila- 
ments but no global patter. Of 61 survey 
plates with spiral structure, 55 have 
global patterns. The rest are transition 
cases; none is purely filamentary-armed. 
However, even the incomplete sample in 
the Hubble Atlas shows many nonbarred 
galaxies with pure NGC 2841-type struc- 
ture. This supports the well-known sug- 
gestion that bars strongly help to drive 
a density wave. 

Kormendy and Dr. T. X. Thuan of 
the University of Virginia completed a 
study of the diffuse background light in 
the Coma cluster. The measurements 
were made on isodensity tracings of 13 
B,G,V, and R calibrated plates taken 
with the 1.2-meter Schmidt telescope. 
Vignetting produced by the vanes that 
hold the plateholder was eliminated. 
They report that the brightness of the 
background light between 4' and 14' 
radius decreases from 25.7 to 27.8 G 
mag arcsec"^, and that the total light in 
the annulus is G = 11.22 mag (i.e., 1.7 
X 10^1 Lao for Ho = 100 km s-i 
Mpc~^), which is ---'45% of the light in 
galaxies alone, or ^30% of the total. 
This does little to alleviate the missing 



HALE OBSERVATORIES 



177 



mass problem. Their results suggested 
that both the isodensity contours and 
the equivalent profile of the diffuse light 
closely parallel the distribution of light 
in galaxies, implying no strong mass 
segregation. However, the background 
appears to be bluer than the galaxies. 
This is consistent with the hypothesis 
that it consists of stars tidally stripped 
from galaxies, which generally become 
bluer at larger radii. 

Dr. W. Krzeminski of the N. Coper- 
nicus Astronomical Center, Warsaw, used 
both 1.5-meter telescopes at the Mount 
Wilson Observatory and at the Palomar 
Observatory during the period May 28- 
August 8, 1976. The research was done 
in close cooperation with William C. 
Priedhorsky, Caltech graduate student. 
They carried out multicolor {UBVR) 
photometry of the x-ray binary AM 
Herculis. The results suggest that the 
red component of the optical flux is 
closely related to the source of optical 
circular polarization in the system. They 
conclude from the periodic modulation 
of flux in the U through R bands, which 
is particularly well defined when plotted 
as color curves, that the primary and 
secondary minima are neither eclipses by 
a secondary star nor by a hot spot. They 
suggest that the primary minimum in 
the visual light curve is the eclipse of a 
region of intense optical emission in the 
magnetic field near the surface of a 
degenerate dwarf by that dwarf itself. 
Results of this work are in press in the 
Astrophysical Journal. 

Krzeminski and Priedhorsky found 
{Int. Astron. Union Circ, 2974, 1976) 
that the central star of the planetary 
nebula Abell 63 = IJU Sagittae is an 
eclipsing binary with period 1P09™6. 
The eclipse, -^4.3 mag deep, lasts 70 
minutes with a flat-bottomed minimum 
of about 16 minutes. Absence of light 
flickering, the depth (and totality) of 
the eclipse, and the spectrum (studied 
by J. S. Miller, Lick Observatory, and 
J. L. Greenstein) make it unlikely that 
the object is an old nova. 



Mr. Howard H. Lanning of Mount 
Wilson Observatory continued his UBVr 
[)hotometric study of seasonal variations 
and the variable HZ22. Poor weather 
conditions hampered the work. 

Lanning also obtained spectroscopic 
observations of the newly discovered 
eclipsing 08 III OB subdwarf BD- 
3°5357 (Dworetsky, Lanning, Etzel, 
Patenaude, Inform. Bull. Var. Stars, 1284, 
1977; Mon. Notic. Roy. Astron. Soc, in 
press). TD-1 satellite observations show 
this unique binary to be a moderately 
bright UV source (38,000°K). This dis- 
cordant SAO K-type classification, ob- 
served UBV colors, strong Ca II, H and 
K, and Ha emission lines suggested the 
possible binary nature. A period of ^9.2 
days was determined from the photom- 
etry obtained at San Diego State Uni- 
versity Mt. Laguna Observatory. The 
light curve is characterized by a deep 
UV eclipse of 13 hours' duration with 
an ingress/egress time of only 24 minutes ; 
large variations outside eclipse indicate 
a strong heating effect. A preliminary 
value of K = 27 ±: 3 km s"^ w^as found 
from 15 plates taken with the X-spectro- 
graph at a dispersion of 42 A mm~^. No 
lines of the subdwarf are visible, though 
continuum dilution of the G star is con- 
siderable. Preliminary values for the 
masses and radii of the components are: 

m,a = 0.6 Wq, Esd = 0.15 Rq, mGs 

= 2.5 TIq, Rg» = ^Rq, with a separa- 
tion of the two stars of ^27 Rq. 

A systematic search for the 21-cm 
hydrogen emission line from intergalactic 
hydrogen clouds in nearby groups of 
galaxies has been conducted by Dr. K. 
Y. Lo of the University of California at 
Berkeley in collaboration with Sargent. 
The automated 40-meter telescope of the 
Owens Valley Radio Observatory and 
the 26-meter telescope of the Berkeley 
Radio Astronomy Laboratory were used 
in the search. Extensive observations of 
large areas of the M81 group, the Canes 
Venatici I group and the NGC 1023 
group, covering several hundred square 
degrees of sky, have been made. 



17S 



CARNEGIE INSTITUTION 



The upper limits for the parameters 
of the intergahictic hydrogen clouds, 
achieved at the Owens Valley 40-meter 
telescope, are: the hydrogen mass ^iV 
(HI I < 5 \ 10''O.Vc) Mpc-- if the clouds 
are < 25 kpc in size; the column density 
.V(H) < 1 X 10^^ cm-- if the clouds 
are ?^ kpc. if one assumes a 40 km s"^ 
line width. These results may be com- 
pared to the parameters of the inter- 
galactic hydrogen clouds reported by 
Mathewson and his co-workers {Astro- 
phys. J. [Lett.]. 195, L97, 1975). Thev 
detected near XGC 55 and NGC 300 
hydrogen clouds with mass ranging from 
3*X 10" a^^o Mpc-- to 10^^ d)}Q Mpc--, 
and A'(H) > 2 X 10^^ cm-2, with ob- 
served line widths of 35-40 km s"^. 

Observations of selected areas in the 
M81. CVn I, and the NGC 1023 groups 
were also made with the Effelsberg 100- 
meter telescope of the Max Planck In- 
stitute for Radio Astronomy in Germany. 
A few hydrogen clouds of mass ranging 
from 5 X 10^ to 3 X 10^ WiQ Mpc-^ 
were detected. Some of them correspond 
to uncatalogued, small but extended 
faint images on the Palomar Sky Survey 
plates. 

Further observations will be made with 
the more sensitive maser receiver, re- 
assembled by Lo, using the Owens Valley 
40-meter telescope. However, these re- 
sults and the currently available evidence 
in the literature indicate that while 
neutral hydrogen companions of mass 
10* Wq or more are often found near 
individual galaxies, or pairs or triplets of 
galaxies, truly isolated hydrogen clouds 
( > 300 kpc from any galaxy) of mass 
> 10* ^Q are scarce. 

An optical survey of the same groups 
studicfj at 21 cm was begun by Sargent 
anrl Lo. Broarl-band Illa-.J plates, cov- 
ering the whole extent of the groups, are 
being obtained with the 1.2-meter Schmidt 
telescope by Kowal. The plates obtained 
are typically 2 mag deeper than the 
Palomar Sky Survey plates. A large frac- 
tion of the M81 group has been observed. 
Extended low-surface-brightness images, 



not discernible on the Sky Survey plates, 
that could be nearby objects are found 
quite frequently. An attempt will be 
made to obtain redshifts of these objects 
by searching for 21-cm hydrogen-line 
emission and to resolve the stars in some 
of these systems with large-scale photo- 
graphic plates. 

The joint radio and optical surveys 
should eventually help to define the en- 
vironments of galaxies in the nearby 
groups. 

Dr. B. F. Madore of the Institute of 
Astronomy, University of Cambridge, 
England, used the Swope 1-meter re- 
flector at Las Campanas, Chile, for pho- 
toelectric photometry during two dark 
runs in November and December 1976. 
Photoelectric sequences were completed 
for 12 southern quasar fields to be 
studied at the Anglo-Australian Tele- 
scope. Also, a test of the amplitude 
mapping of the Cepheid instability strip 
was begun; ten 6-day Cepheids in the 
Large Magellanic Cloud were monitored. 
These Cepheids were chosen to have 
periods within a few percent of each other 
but with widely differing amplitudes. 
Time-average colors and magnitudes are 
being sought in order to define the slope 
of the lines of constant period directly, 
to determine the sense of the run of am- 
plitude with intrinsic color, and even- 
tually to compare these results with 
similar studies in the Small Magellanic 
Cloud and the Galaxy. 

Dr. Bruce Margon of the University of 
California at Los Angeles used the Palo- 
mar 1.5-meter telescope to obtain pho- 
tometry of the visible companions of two 
binary x-ray pulsars, Hercules X-1 and 
GX 1+4; data were successfully acquired 
on each of two nights. For Her X-1, 
narrow-band interference filters were 
used in an attempt to map the binary 
phase dependence of the A4686 emission 
in the companion star, HZ Herculis, and 
thus understand the origin of this emis- 
sion. For GX 1+4, the objective is to 
search for optical variability correlated 
with the 122-sec x-ray periodicity. Since 



HALE OBSERVATORIES 179 

both effects are expected to be binary- in the mean velocity. The new data indi- 

phase dependent, further observations cate that the center-of-mass velocity has 

will be required. increased by 21 km s~^ since the observa- 

Dr. D. H. McNamara of the Brigham tions by Miller and Preston were made. 

Young University has pursued three spec- The orbital period of the binary must 

troscopic investigations during the report be very long, certainly exceeding 20 years, 

year: Prof. Edward P. Ney of the University 

1. NGC 2264. A radial velocity study of Minnesota reports, in the course of 
of the A- and F-type stars in the star work conducted with the 1.2-meter 
cluster NGC 2264 has been completed. Schmidt telescope at Palomar, that the 
These objects have been considered to discovery that the "egg nebula" (TV 
be members in a state of gravitational Zwicky 67) has very highly polarized 
contraction to the main sequence. The nebulosities (>50% in the visual) and 
brighter objects in the cluster, mainly that these nebulosities are associated 
B-type stars, have radial velocities in with a cold, central infrared source moti- 
the interval of +20 to +30 km s~^. The vated a search of selected fields for 
A and F stars have velocities as low as polarized objects. In August 1976 pairs 
km s~^ to as high as 60 km s~^. The of plates were obtained with orthogonal 
radial-velocity data indicate that many, polarizations. In all, 18 separate 4° X 
if not all, of these objects are simply 4° fields were photographed; most of 
foreground stars, a conclusion corrobo- these plates have been studied with a 
rated by narrow-band photometry and blink microscope. Eight highly polarized 
star-count data in the vicinity of the objects were discovered (in addition to 
cluster. the egg nebula). The most interesting of 

2. Dwarf Cepheids. An attempt was these seem to be: (1) M-2-9, an emis- 
made at Palomar to investigate by con- sion-line nebulosity discovered by Min- 
tinuous-trail techniques the radial veloc- kowski to have an emission spectrum 
ities of CY Aquarii and XX Cygni. The like rj Carinae, is highly polarized in red 
spectra obtained indicate that XX Cyg and blue light and in Ha, and has an 
is the longest-period metal-poor dwarf embedded cold infrared source; (2) 
Cepheid known. Because of poor observ- Parsemyan21; (3) Parsemyan 22; (4) 
ing conditions, the program was changed LKHa 233; (5) IRC+10420, a star dis- 
to observe the variable SS Piscium. This covered in the Caltech infrared survey, 
proved to be a very useful study because which has an F supergiant spectrum in 
it is clear that SS Psc is not an RRc the visible and an infrared excess like rj 
variable but instead is an RRs variable Carinae. The image is almost stellar but 
or dwarf Cepheid. Apparently it has the is polarized in the blue by about 40%. 
longest period of any star of the dwarf Ney believes that these objects are 
Cepheid group. It now appears that the stars embedded in optically thick dust 
variables that have been classified as shells and that the polarization is due 
RRc variables are really a mix of normal to scattering of light by dust grains. 
RRc variables with masses of the order Models of preplanetary systems and of 
of 0.5 5D?o and dwarf Cepheids with preplanetary nebulae suggest geometries 
masses of the order of 2 SDI©- of this kind. 

3. AW Persei. A series of spectrograms Dr. Valdar Oinas of Indiana Univer- 
of AW Per was obtained in January at sity in June of 1976 used the Cassegrain 
the 2.5-meter telescope on Mount Wilson, scanner at the Mount Wilson 1.5-meter 
AW Per is a classical Cepheid with a telescope to obtain energy distributions 
blue companion. Early radial velocity of 8 Scuti stars as part of a program on 
data obtained by Miller "and Preston abundances. 

from 1960 to 1963 had shown no change Dr. Peter Pesch, Director of the 



ISO CARNEGIE INSTITUTION 

Warner and Swasey Observatoiy, used major axis less than 1 A and a period of 

the Mount Wilson 1.5-meter telescope in less than a year. With our Apollo asteroid 

March and May 1977. As part of a con- discovery, 1977 HA, the total number of 

tinning program of systematic observa- known Apollo asteroids has grown to 23. 

tions of a comj^lote and kinematically This now increases by a factor of 2 the 

unbiased sample of late-type M dwarfs, number of Apollos known in 1973. An- 

he obtained photoelectric VJ photometry other unusual asteroid, 1977 CA, has 

of 40 stars from Sanduleak's catalog. orbital characteristics similar to those 

Dr. Gibson Reaves of the University objects found in the Phocaea region, but 

of Southern California examined several with an unusually high inclination of 31°. 

hundred faint dwarf galaxies, — 12 > Dr. Susan M. Simkin of Michigan 

M^B > —15. in the Virgo cluster on a State University used the 1.2-meter 

series of eleven long-exposure Illa-J Schmidt for measuring colors of the faint 

plates taken by Sandage with the 1.2- extended regions of double radio galaxies; 

met^r Schmidt. They appear to be gen- the program is nearing completion. Satis- 

erally similar to the dwarf ellipticals in factory U,G,R plate material has been 

the Local Group, but a significant frac- obtained for 3C33, 3C98, 3C390.3, and 

tion of them have nuclei. A rough de- 3C405. These data are being analyzed for 

scription of the areal distribution of pairs of galaxies: 3C33 paired with 3C- 

these faint dwarfs may be made by 405 and 3C98 with 3C390.3. The analysis 

representing the (projected) density in compares objects of similar redshift and 

dwarfs per square degree, /(r), at dis- nuclear excitation. 

tance r from the Sandage-Tammann Results for 3C33 and 3C405 show that 
center of the cluster, by an exponential: both objects have blue ''jets" (5-30 kpc 
f(r) ^ exp i—r^R). For the IC 3475- in length) emerging from their nuclei at 
type dwarfs, R = 1?6; for the Sculptor directions ^^20° to the radio axes. In- 
types, R = 2?2; and for the "pure" spection of Cassegrain spectra taken at 
dwarf ellipticals. R = 3?5. For compari- Kitt Peak National Observatory by Sim- 
son, the projected density of the normal kin and at the 5-meter telescope by 
early galaxies suffers an e-fold decrease Schmidt show that these ''jets" display a 
at /? = 2?9, the normal spirals at i? = normal nebular emission-line spectrum. 
4:4. The significance of these results is In addition, superimposed on the outer 
not yet apparent. regions of the parent cD galaxies are 

The systematic search program for broad, faint (^25 mag Q'O, blue {B 

new planet-crossing asteroids, using the — V ^^ 0.2) spirallike features that 

46-cm Schmidt telescope, was continued coincide with the radio bridges observed 

by Dr. Eugene M. Shoemaker and Mrs. in both galaxies. Finally, a diffuse patch 

Eleanor F. Helin of the Division of Geo- of optical emission {B ^ 26 mag □"? 

logical and Planetary Sciences. Two size 3" X 5" or 5 X 8 kpc at 344 mpc) 

hundred and fifteen independent program has been found in the southwest radio 

fields were photographed, plus another lobe of 3C33. The peak intensity in this 

75 follow-up fields of new discoveries, optical feature lies within 0.5" of the 

Sky coverage this year has led to the peak in the radio emission. Since this 

disoovery of eight new asteroids: 1976 particular radio lobe is one of the strong- 

QA. 1976 QB, 1976 QD, 1976 SO, 1976 est and most compact known, and since 

SD. 1976 I'A. 1977 CA, and 1977 HA. it has a scintillating component at 3.7 

In addition, a new comet was discovered, GHz, there is a good chance that the 

Comet 1977e, Helin. Of particular note diffuse optical emission is truly associ- 

was the independent discovery of 1976 ated with the radio emission. 

UA, the second member of a new orbital The data for 3C390.3 and 3C98 are 

class (1976 AA type), which has a semi- in the preliminary stages of reduction. 



HALE OBSERVATORIES 



181 



The 1.2-meter Schmidt survey of Sey- 
fert galaxies has only begun. Eventually 
it will lead to G and R intensity maps 
for all of the Seyferts in Adams' (1976) 
survey with z < 0.07. This will permit a 
quantitative classification of the faint 
disk structures in these objects. Material 
has been obtained for four objects. One 
of these is NGC 4151, for which the 
intensity maps show (1) that the faint 
outer spiral arms are discernible in the 
red as well as the blue but are broader 
in the red, and (2) the object's mass-to- 
light ratio increases as a function of 
radius. The latter work has been done in 
collaboration with A. Bosma of the 
Kapteyn Institute. 

Dr. Trinh X. Thuan of the University 
of Virginia has used the 1.2-meter Schmidt 
to obtain calibrated fine-grain plates of 
the poor clusterings apparently contain- 
ing supergiant CD galaxies identified 
from the Palomar Sky Survey by Morgan 
and his collaborators (Morgan, Kayser, 
and White, Astrophys. J., 199, 545, 1975; 
and Albert, White, and Morgan, Astro- 
phys. J., 211, 309, 1977). Surface pho- 
tometry of these giant ellipticals is 
planned in order to investigate whether 
they are "genuine" cDs, i.e., of the same 
kind as those that occur in richer clusters. 
The fine-grain emulsions will also pro- 
vide reliable morphological classification 
for the cluster members. Redshift data 
are also being obtained (in collaboration 
with Gunn) to determine cluster mem- 
bership. All these data assembled should 
give clues to dynamical processes (such 
as dynamical friction) operating in 
clusters of galaxies. 

The Mount Wilson 1.2-meter telescope 
time (shared with Dr. J. P. Huchra from 
Harvard University) has been used to 
obtain more photoelectric UBV photom- 
etry for galaxies in the complete statisti- 
cal sample of 1100 Zwicky galaxies, such 
that I 6^1 I > 40, 8 > 0°, and m^w < 14. 
Thuan plans to use the data: (1) to study 
any systematic differences in properties, 
such as color between cluster and non- 
cluster galaxies; (2) to study the distri- 



butions of color and absolute magnitude 
of galaxies and to compare them with 
simple models of star formation in gal- 
axies; and (3) to provide independent 
distance indicators (the color-magnitude 
relation for early-type galaxies and the 
H I width for the late-type galaxies) in 
order to study grouping of galaxies, to 
map the deviation from the Hubble flow, 
and to deduce a local mean density. 

The Palomar 1.5-meter telescope was 
used to obtain surface photometry of the 
inner parts of the same sample of gal- 
axies. These data will be related to dy- 
namical models. 

Dr. Charles H. Townes of the Uni- 
versity of California, Berkeley, in col- 
laboration with F. Baas and J. Lacy 
made observations in April of the 12.8 
fi line of Ne II in the galactic center and 
in a number of planetary nebulae. They 
used the new 2.5-meter du Pont Tele- 
scope of the Las Campanas Observatory 
in Chile. The primary objective was to 
obtain velocity and spatial distribution 
of the ionized gas component of material 
in the galactic center. Ne II provides 
one of the most convenient probes into 
this region. Spectra were taken in 24 
fields of view near the galactic center, 
each of diameter 7'' and with a spectral 
resolution corresponding to a velocity 
spread of about 40 km s~^. In addition, 
the distribution of Ne within three nar- 
row ranges of velocities was measured in 
a number of spatial traces through the 
region of the galactic center. The Doppler 
velocities for these spatial distributions 
were about +10, —160, and —240 km 
s~^. Tracking controls of the telescope 
worked very satisfactorily for both the 
discrete fields of view and for the spatial 
traces. 

The spectrometer used was a tandem 
Fabry-Perot grating system with com- 
pletely cooled optics so that sensitivity 
was limited primarily by photon noise 
of radiation emitted in the path between 
the spectrometer and the object observed, 
and with the narrow bandwidth being 
detected. Transparency of the telescope 



182 



CARNEGIE INSTITUTION 



and atmosphere at Las Campanas was 
good enough to reduce this noise fluctu- 
ation substantially below the value ob- 
tained when the spectrometer was look- 
ing at room temperature radiation. 

Radiation from the Ne II line was also 
measured in a number of planetary 
nebulae. However, most of the work was 
directed toward exploring the galactic 
center. 

The spectra obtained from the galactic 
center showed remarkable variations in 
intensity of the Xe line and in its velocity 
distribution between fields of view sepa- 
rated on the relatively small scale of 5", 
or about i,; pc. The majority of the Ne 
is redshifted by amounts varying up to 
several hundred kilometers per second. 
However, there are also substantial 
amounts of blueshifted Ne with equally 
large Doppler shifts. In some regions, 
several velocity peaks were found, indi- 
cating several individual clouds within 
a given field of view. Further work on 
Ne II in this region is planned, as well 
as somewhat similar examination of the 
galactic center region in the infrared 
spectra of other ions. 

Drs. J. T. Trauger of the University 
of Wisconsin, ]\Iadison, and M. E. 
Mickelson of Denison University have 
extended the original work on the meas- 
urement of the HD abundance on Jupiter 
(Trauger, Roesler, Carleton, and Traub, 
Astrophys. J. [Lett.], 184, L137, 1973), 
from which an HD/H2 and ultimately a 
D H ratio insensitive to details in the 
Jovian atmospheric structure can be de- 
rived. Jupiter was observed during the 
pfTiod 2-11 December 1976 at the Mount 
Wilson 1.5-meter telescope with a 60-mm 
PEP.SIOS spectrometer. The originally 
observed HD (4, 0) PI feature was re- 
measured to somewhat greater accuracy, 
yielding a value of 0.28 ± 0.04 mA for 
the integrated Jovian disk; and a search 
was made for adflitional features (spe- 
cifically the [4, 0] P2 and [5, 0] Rl 
lines) to confirm the original HD identi- 
fication. During the nights of 1-4 March 
1977, the spectra of Saturn and Uranus 



in the vicinity of the HD (4, 0) PI line 
were observed with the 5-meter telescope 
at Palomar Mountain with a 150 mm 
PEPSI OS spectrometer. Laboratory stud- 
ies in support of these observations have 
been carried out with a PEPSIOS spec- 
trometer in association with both a 2- 
meter White cell and the Denison 22- 
meter White cell, yielding accurate 
absorption strengths for the HD (4, 0) 
RO, PI, P2, and (5, 0) Rl lines, and 
the first laboratory measurement of the 
H2 (4, 0) SI line needed for comparison 
in the computation of the D/H ratio. 
The theoretical absorption strengths for 
both the HD and H2 lines as used in 
previous work were found to be signifi- 
cantly in error. Background spectra in 
the vicinity of the HD lines have also 
been obtained for CH4 and NH3 for use 
in data reduction. Preliminary analysis 
of these astronomical and laboratory 
data yield a Jovian D/H ratio near 4 X 
10~^, somewhat greater than independ- 
ently estimated values for the primitive 
solar nebula. Similar results are obtained 
for Saturn, while only an upper limit on 
D/H is possible from the Uranian data, 
owing to greater photon noise and diffi- 
culties with atmospheric seeing and a 
strong CH4 background. Refinements in 
the analysis of the planetary and labora- 
tory data are in progress; an improved 
D/H ratio for Jupiter and the first esti- 
mate of the D/H ratio on Saturn should 
be forthcoming. 

The two-stage image-tube spectro- 
graph of the Palomar 1.5-meter telescope 
was used by Dr. Barry E. Turnrose of 
the NASA Johnson Space Center to ob- 
tain calibrated photographic spectra of 
a number of galaxies at dispersions of 
140 and 60 A mm~^ Five members of 
the relatively nearby compact cluster 
Shakhbazian 30 were observed in the 
blue spectral region at low dispersion for 
the purpose of determining radial veloc- 
ities. An extensive series of spectra at 
position angles of 10°, 55°, 90°, and 135° 
were obtained of the nucleus of the 
peculiar spiral NGC 1614 (= Arp 186). 



HALE OBSERVATORIES 183 

These spectra were taken primarily at of Alabama conducted a search for com- 

60 A mm~^, with emphasis on the spec- pact galaxies on long-exposure Illa-J 

tral region near Ha. Their purpose is to Schmidt plates taken by Arp and Sulentic, 

define more closely the internal kinemat- together with short-exposure plaU-s taken 

ics of this unusual system. by Kowal and the late F. Zwicky. About 

The object Pegasus 112, an apparent 200 compact or possibly compact galaxies 

Seyfert galaxy discovered by G. Chin- brighter than 19th magnitude were cata- 

carini, was observed in three separate logued in fields of 1° radius surrounding 

spectral ranges between 3700 A and 7000 nine edge-on nearby spiral galaxies. Corn- 

A at 60 A mm"^. The spectra clearly pact galaxies fainter than 18th magni- 

delineate the profiles of the strong emis- tude show a marked anisotropy relative 

sion lines whose blue wings exhibit widths to the major axis of the central spiral, 

of several thousand km s~^. such that fewer compacts are found 

Spectra of the galaxies NGC 1073, within 30° of the minor axis direction 

NGC 1637, and NGC 3521 were also than in other directions (the deficiency 

obtained, as were widened spectra of the is significant above the 3(7 level). The 

spectrophotometric standard star HD result agrees with previous work about 

84937 (for calibration purposes). distribution of brighter compacts near 

Dr. P. D. Usher from the Pennsylvania edge-on spirals and indicates possible 
State University was a guest investi- connection between the two classes, 
gator during the summer 1976. He con- Dr. Sidney van den Bergh of the Uni- 
tinued research on faint blue objects in versity of Toronto made use of the 5- 
the Sandage-Luyten survey fields of the meter Hale Telescope. He photographed 
North Galactic Polar Cap. Work com- the parent galaxy of the radio source 
menced with the location of LB objects Cygnus A with various plate-filter com- 
and their identification on finder charts, binations at the prime focus, showing 
using the original three-color plates and that this object consists of a diffuse 
related material. The objects were also source of continuous light on which a 
identified and marked on a master 103a- huge boomerang-shaped emission region 
plate. About 1200 objects of all three is superimposed. An astrometric investi- 
color classes in both the 8-hour and 15- gation undertaken in collaboration with 
hour fields were located and examined Kronberg and Button shows that the 
for morphological characteristics. A central component of the radio source 
master list relating LB and provisional Cygnus A lies halfway between the 
numbers for the 15^ field was compiled, brightest part of the continuum source 
A survey for completeness of objects with and the emission region. Photometric 
U — V ^ 0.0 was completed in both observations and the fact that the radio 
fields, and an additional list of faint blue source is located at the center of sym- 
objects was compiled, along with their metry of the cD envelope of this galaxy 
finding charts and estimated UBV color suggest that the true nucleus, in which 
indices and magnitudes. A preliminary the central source of Cygnus A is em- 
estimate of the degree of completeness bedded, is hidden from view by absorp- 
was carried out for both fields. The posi- tion. Limiting Illa-J plates show that 
tions of the supplementary objects and any optical object associated with the 
standard stars in the 8^ field were meas- brighter radio components of the bright 
ured on the X-Y machine in Pasadena, outer radio source must be fainter than 
Measurements were reduced with the Mj ^ —14 + ^ log (H/lOO). 
help of a program written by Kristian to Photographic and photometric obser- 
give positions to 0.6" (rms) in both vations of two highly reddened galaxies 
coordinates. that have recently been discovered in 

Dr. Mauri Valtonen of the University Cygnus by Weinberger et al. show that 



1S4 CARNEGIE INSTITUTION 

these objects are not. as had previously were found to have strong Ha in emis- 

been suspected, members of the Local sion. This is a much lower percentage 

Group. than was anticipated. The presence (or 

In coHaboration with deRoux, van den absence) of Ha in emission does not cor- 

Bergh has analyzed the galactic stellar relate strongly with any other observable 

population in a field surrounding the parameter. Follow-up photoelectric mon- 

globular cluster XGC 6528. The redden- itoring of one of the M dwarfs with Ha 

ing in this field is found to be somewhat in emission resulted in the detection of 

higher than it is near XGC 6522. A two strong flares. This result follows the 

fragmentary color-magnitude diagram of general correlation between the presence 

the very compact cluster XGC 6528 itself of hydrogen lines in emission and flare 

suggests that this object is quite metal activity. Dr. 0. Hansen agreed to monitor 

rich. the star GL 569 and detected a strong 

Proper-motion observations covering flare followed by a strong secondary 

the period 1942-1976 (the earlier ma- flare. 

terial having been obtained by Baade) Dr. George Wallerstein of the Uni- 

show that the expansion time scale for versity of Washington has used the 2.5- 

the optical remnant of SN 1604 is > meter coude with the Varo image tube 

1 X ICH years. This indicates that the as well as the 5-meter coude spectro- 

remnant consists of circumstellar ma- graph with the 90-mm image tube to 

terial that was excited by the supernova investigate the abundances of the light 

shell. The optical remnant is found to elements, especially oxygen, in stars that 

have a tangential velocity of 525 it 117 show various composition anomalies, 

km s~^ This suggests that Kepler's With the 2.5-meter, several stars with 

supernova (which was of type 1) was abnormally strong or weak CH were 

produced by a star with a Population observed in the near infrared for the I 

Il-type orbit. This work was done by lines as well as for ON and NG in the 

van den Bergh in collaboration with Dr. ultraviolet. The 5-meter was used to ob- 

Karl Kamper. A few emission flocculi in serve extremely metal-poor stars for I 

the remnant of the supernova have absorption at A6300. The variables SX 

brightened significantly during the last Herculis, TY Virginis, and CK Virginis 

35 years. X^o flocculi, however, have faded were included. The variable carbon stars 

during the same period. According to AC Herculis and V553 Centauri were 

van den Bergh, color observations as well also observed. All the spectrograms have 

as photometry of field stars give a fore- been traced and are being measured 

ground reddening Eb - v =^ 0.7 ± 0.2. during the summer of 1977. 

This reddening value and the assumption Wallerstein continued to monitor two 

that SX' 1604 occurred in the nuclear maser stars: CY Canis Majoris in Oc- 

bulge of the Galaxy yield Mv (max) = tober 1976 and VX Sagittarii in October 

-19.3. 1976 and April 1977. 

Dr. G. Veeder of the Jet Propulsion Dr. Richard M. West of the European 
Laboratory has initiated a photometric Southern Observatory carried out spec- 
and ."spectral survey of intrinsically faint troscopic observations of southern gal- 
M dwarf.s. This program concentrates on axies during observation runs at Las 
identifying late M dwarfs that show Campanas in October 1976 and March 
chromospheric activity either by hydro- 1977. He used the 1-meter Swope Tele- 
gen lines in emission or by flares. Ap- scope and image-tube spectrograph. Ap- 
proximately 30 candidate stars have been proximately 200 galaxies were observed, 
included in the program. Image-tube most at dispersion 284 A mm~^ but 
spectra (~ 144 A mm~^) have been several also at 135 A mm~^. A majority 
obtained for 15 stars. Three candidates of the galaxies were recent discoveries 



HALE OBSERVATORIES 



185 



on ESO Schmidt plates. About half 
showed emission lines, and several new 
Seyfert galaxies were identified. A few 
dubious objects could be confirmed as 
planetary nebula. The results are being 
published in Astronomy and Astrophysics. 



As a result of this continuing investiga- 
tion, West expects to carry out a detailed 
astrophysical study of the galaxies with 
particularly active nuclei by means of 
high-dispersion spectra from the ESO 
3.6-meter telescope. 



BIBLIOGRAPHY 



Aaronson, Marc, see Frogel, Jay A.; Persson, 
S. Eric. 

Adams, W. M., Differential rotation of pho- 
tospheric magnetic fields associated with 
coronal holes, Sol Phys., 47, 601-605, 1976. 

Allen, D. A., see Boksenberg, A. 

Arp, Halton, Ejection from the spiral galaxy 
NGC 1097. Astrophys. J, (Lett.), 207, L147- 
L150, 1976. 

Arp, Halton, A quasar near a companion gal- 
axy, NGC 5296. Astrophys. J. (Lett.), 210, 
L59-L61, 1976. 

Arp, Halton, Photography of faint surface 
brightness features in galaxies, in Proc, lAU 
Working Group on Photographic Problems 
(Commission 9), pp.- 83-84, J. L. Heudier, 
ed., Observatoire de Nice, 1976. 

Arp, Halton, Anomalous redshifts in galaxies 
and quasars, in Redshifts and the Expansion 
of the Universe, Int. Astron. Union Colloq., 
37-Centre Nat. Recherche Sci. Colloq., 263, 
pp. 377-398, C. Balkowski and B. E. Wester- 
lund, eds.. Centre National Recherche Scien- 
tifique, Paris, 1976. 

Arp, Halton, and Jean Lorre, Image processing 
of galaxy photographs, Astrophys. Jr., 210, 
58-64, 1976. 

Arp, Halton, and Barry F. Madore, Preliminary 
results from the catalogue of southern peculiar 
galaxies and associations, Quart. J. Roy. 
Astron. Soc, 18, 234-241, 1977. 

Arp, Halton, Jack W. Sulentic, A. G. Willis, 
and H. R. de Ruiter, A BL Lac object near 
the spiral galaxy NGC 6503, Astrophys. J. 
(Lett.), 207, L13-L16, 1976. 

Arp, Halton, see also de Ruiter, H. R.; Kirsh- 
ner, Robert P. 

Barbieri, C, and Jack W. Sulentic, The plane- 
tary nebula 146+31 ?1, Publ. Astron. Soc. 
Pacific, 89, 261-263, 1977. 

Baschek, B., and Anneila I. Sargent, The chem- 
ical composition of the horizontal-branch star 
Feige 86, Astron. Astrophys., 63, 47-52, 1976. 

Becklin, Eric E., K. Matthews, G. Neugebauer, 
and C. G. Wynn-WiUiams, On the infrared 
emission from Sgr B2, Astron. Astrophys., 55, 
19-21, 1977. 

Becklin, Eric E., S. Beckwith, I. Gatley, K. 
Matthews, G. Neugebauer, C. Sarazin, and 
M. W. Werner, Infrared studies of an ioniza- 



tion front region in the Orion Nebula, 
Astrophys. J., 207, 770-779, 1976. 

Becklin, Eric E., see also Beckwith, S.; Ennis, 
D.; Frogel, Jay A.; Mason, K. 0.; Wynn- 
Wilhams, C. G. 

Beckwith, S., N. J. Evans II, E. E. Becklin, 
and G. Neugebauer, Infrared observations of 
Mon R2, Astrophys. J., 208, 390-395, 1976. 

Beckwith, S., see also Becklin, Eric E. ; Ennis, D. 

Berghstralh, Jay T., see Miinch, Guido. 

Blankenship, L., see Mason, K. O. 

Boksenberg, A., S. A. Briggs, R. F. Carswell, 
M. Schmidt, and D. Walsh, 2005+403— A 
QSO near the galactic plane, Mon. Notic. 
Roy. Astron. Soc, 177, 43P-45P, 1976. 

Boksenberg, A., R. F. Carswell, D. A. Allen, 
R.A.E. Fosbury, M. V. Penston, and W.L.W. 
Sargent, The remarkable Seyfert galaxj' 
Markarian 231, Mon. Notic. Roy. Astron. 
Soc, 178, 451^66, 1977. 

Boksenberg, A., see also Green, Richard F.; 
Greenstein, Jesse L.; Sargent, Wallace L. W. 

Bond, Howard E., see Green, Richard F. 

Boroson, T. A., see Sargent, Wallace L. W. 

Borra, Ermanno F., and Arthur H. Vaughan. 
Observations of the transverse Zeeman effect 
in the magnetic star /3 Coronae Boreahs: 
evidence for the oblique rotator model, 
Astrophys. J. (Lett.), 210, L145-L147, 1976. 

Briggs, S. A., see Boksenberg, A. 

Brown, R, L., see Mason, K. 0. 

Campbell, M. F., J. H. Ehas, D. Y. Gezari, 
P. M. Harvey, W. F. Hoffman, H. S. Hudson, 
G. Neugebauer, B. T. Soifer, M. W. Werner, 
and W. E. Westbrook, Far infrared observa- 
tions of IRC+ 10216, Astrophys. J.. 208. 396- 
398, 1976. 

Carswell, R. F., see Boksenberg, A.; Greenstein, 
Jesse L. 

V 

Chase, R. C, see Svestka, Z. 

Chase, S. C, Jr., E. D. Miner, D. Morrison, 
G. Miinch, and G. Neugebauer, Mariner 10 
infrared radiometer results: temperatures and 
thermal properties of the surface of Mercury, 
Icarus, 28, 565-578, 1976. 

Chase, S. C, Jr., see also Kieffer, H. H. 

Dahn, Conrad C, see Zinn. Robert. 

de Bruyn, A. G., see Segalovitz, A. 

Dennison, E. W., Memory systems for signal 
generating photoelectric image detectors, in 



186 



CARNEGIE INSTITUTION 



Adixinces in Elect rati ics and Electron Physics, 
Vol. 40B. Photo-Electronic Image Devices, 
pp. 72\>-733. B. L. Morgan. R. W. Airoy. and 

D. McMuIlan. eds.. Academic Pres8, London, 
1976. 

de Riiiter. H. R.. A. G. Willis, and H. C. Arp, 
A Westerbork 1415 MHz survey of back- 
ground radio sources. II. Optical identifica- 
tions with deep Illa-J plates. Aslron. Astro- 
phys.. Suppl. Ser.. -JS, 211-277, 1977. 

de Ruiter. H. R.. .^rr also Arp. Halt on. 

Diner. D. J.. J. A. Westphal. F. P. Schloerb, 
Infrared imaging of Venus: 8-14 micrometers, 
Icarus. 27, 191-195. 1976. 

Dunlap, J. R.. see Kirshner. Robert P. 

Elia.<. J. H., see Campbell. M. F.; Ennis. D.; 
Mason. K. O.; Westbrook. W. E. 

Ennis. D.. E. E. Becklin. S. Beckwith, J. Elias, 
I. Gatley. K. Matthews, G. Neugebauer, and 
P. Willner. Infrared observations of Nova 
Cygni 1975. Astrophys. J.. 21If, 478-487, 1977. 

Etzel. Paul B., see Lanning, Howard. 

Evans. X. J.. II, see Beckwith. S. 

Forster. J. R.. see Wynn-WiUiams, C. G. 

Fosbury. R. A. E.. see Boksenberg, A. 

Frogel. Jay A., S. Eric Persson, and Marc 
Aaronson. Compact infrared sources associ- 
ated with southern H II regions, II, Astro- 
phys. J., 213, 723-736, 1977. 

Frogel, Jay A., S. E. Persson, M. Aaronson, 

E. E. Becklin. and K. Matthews, Infrared 
observations of the late-type stellar com- 
ponent of elliptical galaxies, in The Galaxy 
and the Local Group (RGO Bull. No. 182), 
pp. 111-118, R. J. Dickens and J. E. Perry, 
eds.. Royal Greenwich Observatory, Herst- 
monceux. England, 1976. 

Frogel, Jay A., see also Persson, S. Eric. 

Gatley. 1., see Becklin, E. E.; Ennis, D. 

Gezari. D. Y., see Campbell. M. F.; Westbrook, 
W. E. 

Goldreich, Peter, and Wallace L. W^. Sargent, 
Qua.'sar absorption lines, Comments Astrophys. 
Space Phys., 6, 133-137, 1976. 

Gott, J. Richard, III, and Edwin L. Turner, 
The mean luminosity and mass densities 
in the univer.s«, Astrophys. J., 209, 1-5, 1976. 

Gott, J. Richard, III, see also Turner, Edwin L. 

Green. Richard F., A discover>^ program for 
bright qua.'^ars: preliminary results, Publ. 
Astron. Soc. Pacific, 88, 66.5^668, 1976. 

Green, Richard F., and Douglas 0. Richstone, 
On the reality of periodicities in the redshift 
di.'stribution of emission-line objects, Astro- 
phys. J.. 208, 639-645, 1976. 

Green, Richard F., Jesse L. Greenstein, and A. 
Boksenbr-rg. A blue variable at high latitude, 
Publ. Astron. Soc. Pacific, 88, 598-^02, 1976. 

Green. Richard F., John P. Huchra, and Howard 
E. Bond, A study of the optical variability 
of the Seyfert galaxy X Comae, Publ. Astron. 
Soc. Pacific, 89, 2.5.5-260, 1977. 



Greenstein, Jesse L., Some further degenerate 
stars, IX, Astrophys. J. {Lett.), 207, L119- 
L123, 1976. 

Greenstein, Jesse L., Degenerate stars with 
helium atmospheres, Astrophys. J., 210, 524- 
532, 1976. 

Greenstein, Jesse L., Subluminous stars: post- 
novae, white dwarfs, and hot subdwarfs, 
Mem. Soc. Roy. Scis. Liege, 9, 247-267, 1976. 

Greenstein, Jesse L., Bond's flare star 232^ 
03, Publ. Astron. Soc. Pacific, 89, 304-308, 
1977. 

Greenstein, Jesse L., and J. B. Oke, An interpre- 
tation of the spectrum of the red rectangle, 
Publ. Astron. Soc. Pacific, 89, 131-138, 1976. 

Greenstein, Jesse L., M. A. Kazarian, and E. 
Ye. Khachikian, On the electron density of 
cometary nebula NGC 2261, Pisma in 
Astronomy, 1, 26-27, 1975. 

Greenstein, Jesse L., A. Boksenberg, R. Cars- 
well, and K. Shortridge, The rotation and 
gravitational redshift of white dwarfs, 
Astrophys. P., 212, 186-197, 1977. 

Greenstein, Jesse L., M. A. Kazarian, T. Yu. 
Magakian, and E. Ye. Khachikian, A spectro- 
photometry of NGC 2261 and R. Mon, I, 
Astrofizika, 12, 587-611, 1976. 

Greenstein, Jesse L., see also Green, Richard 
F.; Oke, J. B. 

Griffin, R. F., and James E. Gunn, Hyades 
giants d and 6^ Tauri as spectroscopic binaries, 
Astron. J., 82, 176-178, 1977. 

Gunn, James E., Observational tests in cos- 
mology, in Redshijts and the Expansion of 
the Universe, Int. Astron. Union Colloq., 
37-Centre Nat. Recherche Sci. Colloq., 263, 
pp. 183-206, C. Balkowski and B. E. Wester- 
lund, eds.. Centre National Recherche Scien- 
tifique, Paris, 1976. 

Gunn, James E., and Beatrice M. Tinsley, 
Dynamical friction: the Hubble diagram as 
a cosmological test, Astrophys. J., 210, 1-6, 
1976. 

Gunn, James E., see also Griffin, R. F.; Steig- 
man, Gary; Thuan, Trinh X. 

Hardy, Eduardo, The population structure of 
the LMC disk, I, Photographic and photo- 
electric observations of the underlying stellar 
component of the central regions, Astrophys. 
J., 211, 718-727, 1977. 

Hartoog, Mark R., The rotation of Ap stars 
in open clusters and magnetic braking, 
Astrophys. J., 212, 723-727, 1977. 

Harvey, P. M., see Campbell, M. F. 

Hauser, M. G., see Werner, M. W.; Westbrook, 
W. E. 

Hickson, Paul, Douglas 0. Richstone, and 
Edwin L. Turner, Galaxy collisions in dense 
groups, Astrophys. J., 213, 323-326, 1977. 

Hjellming, R. M., see Mason, K. O. 

Hoessel, John, see Melnick, Jorge. 

Hoffmann, W. F., .see Campbell, M. F. 



HALE OBSERVATORIES 



187 



Houck, J. R., see Werner, M. W. 

Howard, Robert, A possible variation of the 
solar rotation with the activity cycle, Astro- 
phys. J. (Lett.), 210, L159-L161, 1976. 

Howard, Robert, Phenomenological model of 
the solar cycle, in Physics of Solar Planetary 
Environments, Vol. 1, pp. 34^3, Donald J. 
Williams, ed., American Geophysical Union, 
Boulder, Colorado, 1976. 

Howard, Robert, Studies of solar magnetic 
fields, IV, The effects of angular resolution, 
Sol. Phys., 47, 57&-580, 1976. 

Howard, Robert, The Mount Wilson solar 
magnetograph scanning and data system, Sol. 
Phys., 48, 411-416, 1977. 

Howard, Robert, Studies of solar magnetic 
fields, V, The true average field strengths 
near the poles, Sol. Phys., 52, 243-248, 1977. 

Howard, Robert, Non-spot magnetic fields, in 
Transactions of the International Astronomi- 
cal Union, Reports on Astronomy, Vol, 
XVI-A, Part 2, pp. 41-43, G. Contopoulos, 
ed., D. Reidel Publishing Co., Dordrecht- 
Holland, 1976. 

Howard, Robert, and Z. Svestka, Development 
of a complex activity in the solar corona, 
Sol. Phys., in press, 1977. 

Howard, Robert, and Hirokazu Yoshimura, 
Differential rotation and global-scale velocity 
fields, in Basic Mechanisms of Solar Activity, 
Int. Astron. Union Symp., 71, pp. 19-35, V. 
Bumba and J. Kleczec, eds., D. Reidel Pub- 
lishing Co., Dordrecht-Holland, 1976. 

Hmvard, Robert, see also Scherrer, Philip H.; 
Svestka, Z. 

Huchra, John, The Zwicky catalogue magnitude 
scale : a comparison with photoelectric mag- 
nitudes of faint galaxies and with the magni- 
tudes of Holmberg and de Vaucouleurs, 
Astron. J., 81, 952-953, 1976. 

Huchra, John. Comment on photometric evo- 
lutionary corrections, in Redshifts and the 
Expansion of the Universe, Int. Astron. Union 
Colloq., 37-Centre Nat. Recherche Sci. 
Colloq., 263, pp. 179-181, C. Balkowski and 
B. E. Westerlund, eds.. Centre National 
Recherche Scientifique, Paris, 1976. 

Huchra, John P., The mass-to-light ratio of 
Markarian galaxies, in Redshifts and the 
Expansion of the Universe, Int. Astron. Union 
Colloq., 37-Centre Nat. Recherche Sci. 
Colloq., 263, pp. 289-299, C. Balkowski and 
B. E. Westerlund, eds.. Centre National 
Recherche Scientifique, Paris, 1976. 

Huchra, John P., see also Green, Richard F.; 
Kowal, C. 

Hudson, H. S., see Campbell, M. F. 

Jensen, E. B., see Strom, K. M. 

Johnson, Harold L., see Sandage, Allan. 

Katem, Basil, see Sandage, Allan. 

Kazarian, M. A., see Greenstein, Jesse L. 

Keenan, Phihp C, and Olin C. Wilson, Effects 



of heavy-element abundance on .spectro- 
scopic luminosities of G5 KO giants, Astro- 
phys. J., 212, 39f>-407, 1977. 

Khachikian, E. Ye., see Greenstein, Je.sse L. 

Kieffer, H. H., Stillman C. Chase, Jr., Ellis D. 
Miner, Frank Don ]-*alluconi, Guido Miinch, 
Gerry Neugebauer, and Terry Z. Martin, 
Infrared thermal mapping of the martian 
surface and atmosphere : first results, Science, 
193, 780-786, 1976. 

Kirshner, Robert P., and Keith Taylor, High- 
velocity gas in the Cygnus Loop, Astrophys. 
J. (Lett.), 208, L83-L86, 1976. 

Kirshner, Robert P., H. C. Arp, and J. R. 
Dunlap, Observations of supernovae: 1975a 
in NGC 2207 and 1975b in the Per.seus 
cluster, Astrophys. J., 207, 44-52, 1976. 

Kormendy, John, Brightness distributions in 
compact and normal galaxies, I, Surface pho- 
tometry of red compact galaxies, Astrophys. 
J., 214, 359-382, 1977. 

Kormendy, John, Absence of velocity anisot- 
ropy in the direction of the Virgo cluster, in 
Redshifts and the Expansion of the Universe, 
Int. Astron. Union Colloq., 37-Centre Nat. 
Recherche Sci. Colloq., 263, pp. 155-158, C. 
Balkowski and B. E. Westerlund, eds.. Centre 
National Recherche Scientifique, Paris, 1976. 

Kowal, Charles T., The case against names, 
Icarus, 29, 513, 1976. 

Kowal, Charles T., Periodic Comet Taylor 
(1916 I = 1977a), Int. Astron. Union Circ, 
3033, January 28, 1977. 

Kowal, Charles T., 1936CA (Adonis), Int. 
Astron. Union Circ, 3041, February 23, 1977. 

Kowal, Charles T., 1977HB, Int. Astron. Union 
Circ, 3066, April 26, 1977. 

Kowal, Charles T., Comet Kowal (1977f), Int. 
Astron. Union Circ, 3066, April 26, 1977; 
3067, April 29, 1977; 3076, May 20, 1977; 
3079, May 31, 1977. 

Kowal, Charles T., J. Huchra, and W. L. W. 
Sargent, The 1975 Palomar supernova search, 
Publ. Astron. Soc Pacific, 88, 521-525, 1976. 

Krieger, A. E., see Svestka, Z. 

Kristian, Jerome, The present status of 3CR 
identifications, in Radio Astronomy and Cos- 
mology, Int. Astron. Union Symp., 74, D. L. 
Jauncey, ed., D. Reidel Pubhshing Co., 
Dordrecht-Holland, 1977. 

Kristian, Jerome, A. R. Sandage, and J. A. 
Westphal, The Hubble diagram for red mag- 
nitudes of bright cluster galaxies, in Redshifts 
and the Expansion of the Universe, Int. 
Astron. Union Colloq., 37-Centre Nat. Re- 
cherche Sci. Colloq., 263, pp. 309-311, C. 
Balkowski and B. E. Westerlund, eds.. Centre 
National Recherche Scientifique, Paris, 1976. 

Kristian, Jerome, see also Westphal, James A. 

LaBonte, Barry J., Ha observations of the 
August 12, 1975, type III-RS bursts, Sol. 
Phys., 50, 201-211, 1976. 



188 



CARNEGIE INSTITUTION 



LaBonte. Bvirn- J.. A measurement of the 
helium D3 protiK^ with :\ birefringent filter. 
Sol. Phys., in press. 1977. 

Lanning. Howard, and Paul B. Etzel. Ha emis- 
sion in the eclipsing white dwarf V471 Tau 
(BD-}-16'516). ComrnL<!s{on 37 Int. Astron. 
I'nion Bull. Var. Stars. 1147, 29 June 1976. 

Lo. K. Y.. sec Westbrook. W. E. 

Lorre. Jean, see Arp. Halton. 

Madore. Barry F., see Arp. Halton. 

Magakian. T. Yu., sec Greenstein, Jesse L. 

Marsh. K. A.. The lifetimes and evolution of 
fibrils, Sol. Phys.. 60. 37-48. 1976. 

Marsh. K. A., The calcium K-line network in 
coronal holes. Sol. Phys., in press, 1977. 

Martin, Terry Z., see Kieffer, H. H. 

Mason. K. 0.. E. E. Becklin, L. Blankenship, 
R. L. Brown. J. Ehas. R. M. HjcUming. K. 
Matthews. P. G. Murdin. G. Xeugebauer, P. 
W. Sanford. and S. P. Willner, Further joint 
x-rav. infrared, and radio observations of 
Cygnus X-3. Asfrophys. J.. 207, 78-87, 1976. 

Massey. Philip. Photometiy of Shakhbazian I, 
Publ. Astron. Soc. Pacific, 89, 13-18, 1977. 

Matthews. Keith, see Becklin, Eric E.; Ennis, 
D.: Frogel. Jav A.; Mason, K. O.; Wynn- 
WilHams. C. G. 

Melnick. Jorge, Velocity dispersions in giant 
H II regions: relation with their linear 
diameters, Astrophys. J.. 213, 15-17, 1977. 

Melnick. Jorge, Simon D. M. White, and John 
Hoe.ssel. Photoelectric surface photometry of 
the Coma Cluster. Man. Notic. Roy. Astron. 
Soc. ISO, 207-218, 1977. 

Miner, E. D.. see S. C. Chase, Jr.; KiefTer, 
H.H. 

Moller. J., see Strom, K. M. 

Moore, R. L., see Zirin, Harold. 

Morrison, D., see Cha.«e, S. C, Jr. 

Miinch. Guido, Herbig-Haro object in the Orion 
Nebula, Astrophys. J. (Lett.), 212, L77-L79, 
1977. 

Mijnch, Guido, Highlights in planetary spec- 
troscopy 1962-75, Mem. Soc. Roy. Scis. Liege, 
9, 87-100. 1976. 

Miinch, Guido, and Jay T. Bergstralh, lo: 
morphologj' of its sodium emission region, 
Publ. A.stion. Soc. Pacific, 89, 232-237, 1977. 

Miinch, Guido, see also Chase, S. C, Jr.; 
Kif'ffer, H. H. 

Murdin, P. G.. see Mason, K. 0. 

Xeugebauer, Gerry, see Becklin, Eric E.; Beck- 
with, S.; Campbell, M. F.; Chase, S. C, Jr.; 
Enni.s, D.; Kieffer, H. H.; Mason, K. 0.; 
Wf-mer, M. W.; We.stbrook, W. E.; Wynn- 
Williams, C. G. 

Oke, J. B., Spectrophotometry of the x-ray 
binar>' HZ Herculis, Astrophys. J., 209, 547- 
555, 1976. 

Oke, J. B., and J. L. Greenstein, Spectro- 
photometr>' of the transient x-ray source 
A0620-00, Astrophys. .J., 211, 872-880, 1977. 



Oke, J. B., and G. A. Shields, Seyfert galaxies 
with strong Fe II emission, Astrophys. J., 
207, 713-724, 1976. 

Oke, J. B., see also Greenstein, Jesse L.; Rich- 
stone. D. O. 

Palluconi, Frank D., sec Kieffer, H. H. 

Penston, M. V., see Boksenberg, A. 

Persson, S. Eric, Jay A. Frogel, and Marc 
Aaronson, The 10 micron silicate feature in 
southern H II regions, Astrophys. J., 208, 
753-759, 1976. 

Persson, S. Eric, see also Frogel, Jay A. 

Richstone, D. 0., and J. B. Oke, The nebulosity 
near the quasar 3C249.1, Astrophys. J., 21S, 
8-14, 1977. 

Richstone, D. O., see also, Green, Richard E.; 
Hickson, Paul; Tremaine, Scott D. 

Sandage, Allan, High-latitude reflection nebu- 
losities illuminated by the galactic plane, 
Astron. J., 81, 954-957, 1976. 

Sandage, Allan, The reddening and extinction 
of a cluster of bright galaxies near the galactic 
plane in Cygnus, Publ. Astron. Soc. Pacific, 
88, 367-369, 1976. 

Sandage, Allan, and Basil Katem, The brightest 
stars in nearby galaxies, I, The color-magni- 
tude diagram and luminosity function for 
IC 1613, Astron. J., 81, 743-750, 1976. 

Sandage, Allan, and G. A. Tammann, The 
Virgo cluster, I, The equality of mean red- 
shifts of E and S galaxies near the cluster 
center, Astrophys. J. (Lett.), 207, L1-L4, 1976. 

Sandage, Allan, and G. A. Tammann, Steps 
toward the Hubble constant, VII, Distances 
to NGC 2403, MlOl, and the Virgo cluster 
using 21-cm line widths compared with opti- 
cal methods: the global value of Ho, Astro- 
phys. J., 210, 7-24, 1976. 

Sandage, Allan, Basil Katem, and Harold L. 
Johnson, The halo globular cluster NGC 
5053, Astron. J., 82, 389-394, 1977. 

Sandage, Allan, see also Kristian, Jerome. 

Sanford, P. W., see Mason, K. 0. 

Sarazin, C, see Becklin, Eric E. 

Sargent, Anneila I., see Baschek, B. 

Sargent, Wallace L. W., Redshifts for six 3CR 
radio galaxies and the spectrum of 3C111, 
Astrophys. J. (Lett.), 212, L105-L106, 1977. 

Sargent, Wallace L. W., Quasar absorption lines 
as probes of the past intergalactic medium, 
in The Evolution of Galaxies and Stellar 
Populations, Proc. Yale University Confer- 
ence, pp. 427-442, B. M. Tinsley and R. B. 
Larson, eds., D. C. Gehret, asst. ed., Yale 
University Observatory, New Haven, Con- 
necticut, 1977. 

Sargent, Wallace L. W., Radio sources and 
clusters of galaxies in The Physics of Non- 
Thermal Radio Sources, pp. 67-81, G. Setti, 
ed., D. Reidel Publishing Co., Dordecht- 
Holland, 1976. 

Sargent, Wallace L. W., and T. A. Boroson, 



HALE OBSERVATORIES 



189 



A statistical assessment of the evidence for 
line-locking in quasar spectra, Astrophys. J., 
212, 383-389, 1977. 

Sargent, Wallace L. W., and Edwin L. Turner, 
A statistical method for determining the 
cosmological density parameter from the red- 
shifts of a complete sample of galaxies, 
Astrophys. J. {Lett.), 212, L3-L7, 1977. 

Sargent, Wallace L. W., Paul L. Schechter, A. 
Boksenberg, and Keith Shortridge, Velocity- 
dispersions for 13 galaxies, Astrophys. J., 
212 326-334, 1977. 

Sargent, Wallace L. W., see also Boksenberg, 
A.; Goldreich, Peter; Kowal, Charles T. 

Schechter, Paul L., see Sargent, Wallace L. W. 

Scherrer, PhiHp H., A. B. Severny, John M. 
Wilcox, and Robert Howard, The mean mag- 
netic field of the sun : method of observation 
and relation to the interplanetary magnetic 
field, Sol. Phys., 62, 3-12, 1977. 

Schloerb, F. P., see Diner, D. J. 

Schmidt, Maarten, On the apparent absence 
of evolution of quasi-stellar radio sources 
with fiat radio spectra, Astrophys. J. (Lett.), 
209, L55-L57, 1976. 

Schmidt, Maarten, Cosmological interpretation 
of redshift data on quasars through the 
V/Fmax test, in Radio Astronomy and Cos- 
mology, Int. Astron. Union Symp. 74, in press, 
D. L. Jauncey, ed., D. Reidel Publishing 
Co., Dordrecht-Holland, 1977. 

Schmidt, Maarten, see also Boksenberg, A. 

Schramm, David N., see Steigman, Gary. 

Schweizer, Francois, On the rotation and rela- 
tive mass of NGC 5195, the companion of 
M51, Astrophys. J., 211, 324-328, 1977. 

Schweizer, Francois, Photometric studies of 
spiral structure, I, The disks and arms of 
six Sb I and Sc I galaxies, Astrophys. J., 
Suppl. Ser., 31, 313-332, 1976. 

Searle, Leonard, Composition differences within 
and among galaxies, in The Galaxy and the 
Local Group (RGO Bull. No. 182), pp. 119- 
127, R. J. Dickens and J. E. Perry, eds.. Royal 
Greenwich Observatory, Herstmonceux, Eng- 
land, 1976. 

Searle, Leonard, The evolution of stellar popu- 
lations, in The Evolution of Galaxies and 
Stellar Populations, Proc. Yale University 
Conference, pp. 219-237, B. M. Tinsley and 
R. B. Larson, eds., D. C. Gehret, asst. ed., 
Yale University Observatory, New Haven, 
Connecticut, 1977. 

Searle, Leonard, see also Zinn, Robert. 

Segalovitz, A., W. W. Shane, and A. G. de 
Bruyn, Polarisation detection at radio wave- 
lengths in three spiral galaxies. Nature, 264, 
222-226, 1976. 

Severny, A. B., see Scherrer, Philip H. 

Shane, W. W., see Segalovitz, A. 

Shields, G. A., see Oke, J. B. 



Shortridge, K., see Greenstein, Jesse L,; Sar- 
gent, Wallace L. W. 

Soifer, B. T., see Campbell, M. F. 

Steigman, Gary, David X. Schramm, and James 
E. Gunn, Cosmological limits to the nurnbf;r 
of massive leptons, Phys. Lett., OOB, 202-204, 
1977. 

Strom, K. M., S. E. Strom, E. B. Jensen, J. 
Moller, L. A. Thompson, and Trinh X. 
Thuan, A photometric study of the SO galaxy 
NGC 3115, Astrophys. J., 212, 335-346, 1977. 

Strom, S. E., see Strom, K. M. 

Sulentic, Jack W., Radio emission and optical 
morphology in Markarian galaxies, Astron. J., 
81, 582-590, 1976. 

Sulentic, Jack W., Redshifts in the Virgo 
cluster, Astrophys. J. (Lett.), 211, L59-L62, 
1977. 

Sulentic, Jack W., 1976WA, Int. Astron. Union 
Circ, 3071, May 10, 1977. 

Sulentic, Jack W., see also Arp, Halton; 
Barbieri, C. 

Svestka, Z., A. S. Krieger, R. C. Chase, and R. 
Howard, Transequatorial loops interconnect- 
ing McMath regions 12472 and 12474, Sol 

^ Phys., 52, 69-90, 1977. 

Svestka, Z., see also Howard, Robert. 

Tammann, G. A., Galactic and extragalactic 
supernova frequencies, in Proceedings of the 
1976 Duman Summer Workshop, pp. 137- 
162, Arthur Roberts, ed., CERN, Geneva, 
Switzerland, 1976. 

Tammann, G. A., A progress report on super- 
nova statistics in Supemovae, Astrophysics 
and Space Science Library, Vol. 6, pp. 95-116, 
David N. Schramm, ed., D. Reidel Publish- 
ing Co., Dordrecht-Holland, 1977. 

Tammann, G. A., The Hubble constant and 
the local expansion field, in Redshifts and the 
Expansion of the Universe, Int. Astron. Union 
Colloq., 37-Centre Nat. Recherche Sci. 
Colloq., 263, pp. 43-65, C. Balkowski and 
B. E. Westerland, eds.. Centre National 
Recherche Scientifique, Paris, 1977. 

Tammann, G. A., see also Sandage, Allan, 

Tanaka, K., see Zirin, Harold. 

Taylor, Keith, see Kirshner, Robert P. 

Terrile, R. J., and J. A. Westphal, The vertical 
cloud structure of Jupiter from 5 ixvo. meas- 
urements, Icarus, 30, 274-281, 1977. 

Terrile, R. J., and J. A. Westphal. Infrared 
imaging of Jupiter in the 8-14 micrometer 
spectral region, Icarus, 30, 730-735, 1977. 

Thompson, L. A., see Strom, K. M. 

Thuan, Trinh X., and James E. Gunn, A new 
four-color intermediate-band photometric sys- 
tem, Publ. Astron. Soc. Pacific. 88. 543-547, 
1976. 

Thuan, Trinh X., see also Strom, K. M. 

Tinsley, Beatrice M., see Gunn. James E. 

Tremaine, Scott D., and Douglas 0. Richstone, 
A test of a statistical model for the luminosi- 



190 



CARNEGIE INSTITUTION 



ties of bright cluster galaxies, Astrophys. J., 
212, 311^16, 1977. 

Turner. Edwin L.. Binary galaxies, I, A well- 
lietined statistical s^\mple. Astrophys. J., '^OS, 
20-2V), 1976. 

Turner. Edwni L., Binary galaxies, II, Dy- 
namics and mass-to-light ratios. Astrophys. J.. 
20S, 304-316. 1976. 

Turner. Edwin L.. and J. Richard Gott, III, 
Groups of galaxies, I. A catalog, Astrophys. 
J.. Suppl. Scr.. 32, 409-427. 1976. 

Turner, Edwin L.. and J. Richard Gott, III, 
Groups of galaxies. II. The luminosity func- 
tion, Astrophys. J.. 309. 6-11. 1976. 

Turner, Edwin L., .<rc also Gott, J. Richard, 
III: Hickson. Paul; Sargent, Wallace L. W. 

van der Kmit. P. C. Observations of velocity 
tields in three spiral galaxies using optical 
emission lines, Astron. Astrophys., Suppl. Ser., 
■25. 527-54S. 1976. 

Vaughan. Artluir H.. see Borra, Ermanno F. 

Wade. Richard A.. Supernova in NGC 5427, 
Int. Astron. Union Circ, 29S4, August 30, 
1976. 

Walsh. D., see Boksenberg, A. 

Walter, J., see Zirin. Harold. 

Welch. W. J., see Wynn-Wilhams, C. G. 

Werner, M. W., G. Xeugebauer, J. R. Houck, 
and M. G. Hauser, One-millimeter observa- 
tions of the Crab Nebula. Publ. Astron. Soc. 
Pacific. S9, 127-128. 1977. 

Werner. M. W., see also, Beckhn, Eric E.; 
Campbell. M. F.; Westbrook, W. E.; Wvnn- 
Wilhams, C. G. 

Westbrook, W. E., M. W. Werner, J. H. Elias, 
D. Y. Gezari, M. G. Hauser, K. Y. Lo, and 
G. Xeugebauer, One-millimeter continuum 
emission studies of four molecular clouds, 
Astrophys. J., 209, 94-101, 1976. 

Westbrook, W. E., .see also Campbell, M. F. 

Westphal, James A., and Jerome Kristian, The 
use of silicon target (SIT) camera tubes for 
photometry, spectroscopy, and field viewing, 
in Astronomical Application of Image De- 
tectors and Linear Response., Int. Astron. 
Union Colloq., 40, pp. 19-1-19-21, M. 
Duchesne and G. Lelievre, eds., Obsorvatoire 
de Paris-Meudon. France, 1976. 

We.stphal, James A., see also Diner, D. J.; 
Kristian, Jerome; Terrile, R. J. 

White, Simon D. M., see Melnick, Jorge, 

Wilcox, John M., see Scherrer, Philip H. 

Williams, T. B., Population synthesis of the 
nnr-lpi of ten nearby galaxies, Astrophys. J., 
209, 716-733, 1976. ' 

Williams, T. B., Velocity dispersions in the 
nufloi of Tf-n nearbv galaxies, Astrophys. J., 
21/,, 685-691, 1977. 

Willis, A. G., see Arp, Halton; de Ruiter, H. R. 



Willncr, S. P., 8 to 13 micron spectrophotometry 
of compact sources in W3, Astrophys. J., 214, 
706-711, 1977. 

WiUner. S. P., see also Ennis D.; Mason, K. O. 

Wilson, Olin C, Chromospheric variations in 
main-sequence stars, in Basic Mechanisms of 
Solar Activity, Int. Astron. Union Symp., 71, 
pp. 447-452, Y. Bumba and J. Kleczec, eds., 
D. Reidel Publishing Co., Dordrecht-Holland, 
1976. 

Wilson, Olin C, see also Keenan, Philip C. 

Wright, M. C. A., see Wynn-Williams, C. G. 

Wynn-Williams, C. G., E. E. Becklin, J. R. 
Forster, K. Matthews, G. Neugebauer, W. J. 
Welch, and M. C. A. Wright, On the rela- 
tionship between the infrared source CRL 
2591 (UOA-27) and its radio and H2O coun- 
terparts, Astrophys. J. (Lett.), 211, L89-L90, 
1977. 

Wynn-Wilhams, C. G., E. E. Beckhn, K. 
Matthews, G. Neugebauer, and M. W. Wer- 
ner, Infrared studies of H II regions and 
dust clouds near K3-50, Mon. Notic. Roy. 
Astron. Soc, 179, 255-264, 1977. 

Wynn-Williams, C. G., see also Becklin, Eric E. 

Yoshimura, Hirokazu, Solar cycle evolution of 
the general magnetic field, in Basic Mecha- 
nisms of Solar Activity, Int. Astron. Union 
Symp, 71, pp. 137-143, V. Bumba and J. 
Kleczec, eds., D. Reidel Publishing Co., 
Dordrecht-Holland, 1976. 

Yoshimura, Hirokazu, A model of the solar 
cycle driven by the dynamo action of the 
global convection in the solar convection 
zone, in Basic Mechanisms of Solar Activity, 
Int. Astron. Unioyi Symp., 71, pp. 409^13, 
V. Bumba and J. Kleczec, eds., D. Reidel 
Publishing Co., Dordrecht-Holland, 1976. 

Yoshimura, Hirokazu, see also Howard, Robert. 

Zinn, Robert, and Conrad C. Dahn, Variable 
19 in NGC 5466: an anomalous Cepheid in 
a globular cluster, Astron. J., 81, 527-533, 
1976. 

Zinn, Robert, and Leonard Searle, The masses 
of the anomalous Cepheids in the Draco 
system, Astrophys. J., 209, 734-747, 1976. 

Zirin, Harold, Further observations of the 
\10830 He line in stars and their significance 
as a measure of stellar activity, Astrophys. J., 
208, 414-425, 1976. 

Zirin, Harold, Production of a short-lived fila- 
ment by a surge, Sol. Phys., 60, 399-404, 1976. 

Zirin, H., and K. Tanaka, Prospectus for the 
solar maximum, Sol. Phys., 47, 385-387, 1976. 

Zirin, H., R. L. Moore, and J. Walter, Editors 
of Procee flings of the Workshop: The Solar 
Constant and the Earth's Atmosphere, Big 
Bear Solar Observatory, May 1975, Sol. Phys., 
46, 377-409, 1976. 



HALE OBSERVATORIES 



191 



STAFF AND ORGANIZATION 



Dr. Eric E. Becklin resigned, effective 
June 30, 1977, to accept a position as 
scientist in charge of the new 3-meter 
NASA infrared telescope at the Univer- 
sity of Hawaii. 

Dr. Robert J. Brucato was appointed 
Scientific Officer for the Las Campanas 
Observatory. 

Dr. James E. Gunn and Dr. George W. 
Preston were elected to membership in 
the National Academy of Sciences. 



Research Division 

Staff Members 

Halton C. Arp 

Horace W. Babcock, Director 

Eric E. Becklini 

Jesse L. Greenstein^ 

James E, Gunn^ 

Robert F. Howard 

Jerome Kristian 

Robert B. Leigh ton^ 

Guido Miinch^ 

Gerry Neugebauer^ 

J. Beverley Oke, Associate Director 

S. Eric Persson 

George W. Preston, 

Assistant Director, Mount Wilson 
Allan R. Sandage 
Wallace L. W. Sargent^ 
Maarten Schmidt^ 
Leonard Searle 
Stephen A. Shectman 
Arthur H. Vaughan 



James A. WestphaF 
Harold Zirin^ 



Members Engaged in 
Postretirement Studies 

Alexander Pogo 
Henrietta H. Swope 
Ohn C. Wilson 



Staff Associates 

Robert P. Brucato, Scientific Officer, Las 

Campanas Observatory 
Michael W. Werner® 



Senior Research Fellows 

Ronald Moore 
Robert J. Zinn^^ 



Research Fellows 

William M. Adams 
A. Ger de Bruyn^i 
Alan M. Dressler^^ 
Daniel Y. Gezari^^ 
Richard F. Green 
Eduardo Hardyii-i^ 
Mark Hartoogii-i* 
Gordon J. Hurford 
Vincent Icke 
Frank Israel 
Stephen L. Knapp^^ 
Daniel Kunth 
Kenneth A. Marsh^^ 
Larry D. Petro^^ 



1 Resigned June 30, 1977. 

2 Lee A. DuBridge Professor of Astrophysics, 
California Institute of Technology. 

2 Professor of Astronomy, California Institute 
of Technology. 

* Professor of Astronomy ; Chairman of the 
Division of Physics, Mathematics, and Astron- 
omy, California Institute of Technology. 

^ Professor of Physics, California Institute of 
Technology. 

6 Professor of Astronomy ; Executive Officer 
for Astronomy, Cahfamia Institute of Tech- 
nology. 



"^ Associate Professor of Planetary Science, 
California Institute of Technology. 

8 Chief Astronomer of Big Bear Observatory ; 
Professor of Astrophysics, California Institute 
of Technology. 

^ Assistant Professor of Physics, California 
Institute of Technology. 

10 Las Campanas Observatory Fellow. 

11 Carnegie Fellow. 

12 Fellowship ended November 30, 1976. 

13 Fellowship ended December 31. 1976. 
1^ Fellowship ended August 30, 1976. 

15 Fellowship ended April 1, 1977. 

16 Fellowship ended September 1, 1976. 



192 



CARNEGIE INSTITUTION 



Douglai: 0. Richstone^^ 
Jack W. Sulentic 
Trinh X. Tluian^® 
Altluw Wilkinson 
Peter Wilkinson 



Carnegie-Chilean Fellows 

Guido Garay 
Maria Teresa Riiiz^® 



Librarians 

Helen Z. Knudsen 
Nan W. Schow 



Senior Research Assistants 

Grace V. Knox 
Charles T. Kowal 
A. Louise Lowen^^ 



Research Assistants 

John M. Adkins 
John E. Boyden 
Ken D. ClaVdy 
Basil N. Katem 
Margaret Katz 
Stephen P. Padilla 
Frances Y. C. Tang 

Student Observers 

Steven V. W. Beckwith 
Kirk Borne 
Todd Boroson^^ 
France Cordova 
David J. Diner 
Jonathan H. Elias 
John G. Hoessel 
John P. Huchra2i 
Steven Kent 
Barn- J. LaBonte 
Jorge Melnick^^ 

Daniel Xadeau 
William C. Priedhorsky 



^' Fellowship ended Decomher 1, 1976. 
i** Fellowship ended July 1, 1976. 
i» Fellowship ended August 15, 1976. 

20 Retired June 30, 1977. 

21 Graduated June 11, 1976. 

22 Graduated June 10, 1977. 



Douglas M. Rabin 
Russell 0. Redman 
Anneila I. Sargent- 
Donald P. Schneider 
William L. Sebok 
David Sholle22 
Richard J. Terrile 
Richard Wade 
Peter J. Young 

Photographic Department 
John R. Bedke, Photographer 

Instrument Design and Construction 

David A. Bell, Electronics Engineering Aide 
Louis E. Beidler, Engineer^^ 
Lawrence E. Blakee, Supervisor, 

Electronics Services 
Barbara L. Dailey, Draftswoman 
Lee B. Dennison, Design Draftsman^* 
Stephen Doro, Machinist 
Earle B. Emery, Research Engineer 
Eugene B. Fair, Head Optician 
Hannah Fox, Computing Analyst 
Jerry T. Fridenberg, 

Head, Astroelectronics Laboratory 
C. L. Friswold, Head, Design Group 
Robert D. Georgen, Machinist 
Richard M. Goeden, Senior Engineer 
John G. Golson, Optician 
Simon Groesz, Electronics Specialist 
Fred H. Harris, 

Junior Electronics Technician 
Melvin W. Johnson, Optician^^ 
Leroy M. Kimoto, 

Senior Electronics Specialist 
Erich R. Koch, Senior Electronics Engineer 
Wilfred H. Leckie, Senior Draftsman 
Wilham H. McLellan, Senior Engineer 
Roger L. Minnix, Engineer 
Frederick G. O'Neil, Shop Foreman 
Richard A. Prout, Senior Engineer^^ 
Juan M. Sanchez, 

Photographic Laboratory Technician 
Orval A. Smith, Electronics Specialist 
Edward H. Snoddy, Designer 
Sharon Soltesz, Administrative Secretary 
Douglas Sprague, 

Senior Electronics Engineer 

23 Terminated April 15, 1977. 

24 Terminated December 3, 1976. 

25 Retired June 30, 1977. 

26 Resigned March 11, 1977. 



HALE OBSERVATORIES 



193 



Merle R. Sweet, Supervisor, 
Electronics Construction 
David F. Thompson, Technical Assistant 
Glenn A. Toennes, Electronics Technician 
Timothy J. Tyler, Electrical Technicians"^ 
Virgil Z. Vaughan, Supervisor, Stockroom^^ 
Fehce Woodworth, Illustrator 

Operation and Maintenance 
Mount Wilson Observatory and Offices 

Robert E. Cadman, 

Mountain Superintendent 
Herman E. Carpentier, Carpenter 
Linda Chaffee, Clerk-Typist 
Hugh T. Couch, 

Superintendent, Buildings and Grounds 
Helen S. Czaphcki, Typist-Editor 
Bette DeSmet, Secretary 
James Frazer, Night Assistant 
Hazel M. Fulton, Head Stewardess 
Joan Gantz, Assistant Librarian 
Thomas S. Gregory, Solar Observer 
Robert J. Grosdidier, 

Electronics Technician 
Eugene L. Hancock, Senior Night Assistant 
Mary Hark, Stewardess 
Jeanne M. Knight, Bookkeeper 
Howard H. Lanning, Night Assistant 
Jose Lopez-Tiana, Purchasing Clerk 
Ernest 0. Lorenz, 

Assistant Mountain Superintendent 
Ethel Marszalek, Custodian^^ 
Frank Perez, Mechanic 
Dolores Sahlin, Typist-Telephone Operator 
Glen Sanger, Senior Custodian 
William D. St. John, Chauffeur 
Frank Trylko, Custodian 
Frederick P. Woodson, Business Manager 
Gary Yanik, Electronics Engineer 

Palomar Observatory and 
Robinson Laboratory 

Ranney G. Adams, Night Assistant 
Albert R. Andrews, Maintenance Mechanic 
Bradley N. Bailey, 

Night Assistant and Junior Technician 
Ray L. Ballard, 

Senior Administrative Assistant 
Stephen A. Barry, Maintenance Mechanic^^ 



Donald C. Bates, 

Assistant Mountain Superintendent-^^ 
Jan Adriaan Bruin.^m,'), Painter 
Maria J. Bruinsma, Hous<^'keeping Aide 
Juan R. Carrasco, 

Night Assistant and Mechanic 
Lily D. Carrasco, Housekeeping Aide 
Rita A. Ewing, Secretary 
Liselotte M. Hauck, 

Senior Administrative Secretary 
Helen Holloway, Administrative Secretary 
Dorothy J. Howard, 

Administrative Secretary 
Willie D. Jones, Custodian 
Kevin M. Jordan, Maintenance Mechanic 
Joyce E. Keeble, Secretary 
Taras Kiceniuk, Mountain Superintendent 
J. Luz Lara, Maintenance Mechanic 
Marilynne J. Rice, 

Senior Administrative Secretary 
Elsa-Brita Titchenell, 

Administrative Secretary 
Gary M. Tuton, Senior Night Assistant 
Paul Van Ligten, Electrician 
Ruth E. Weaver, Administrative Secretari^ 
Larry L. Wickern, Assistant Superintendent 
Larry K. Williams, Maintenance Mechanic 
Dorothy Williams, Cook 
Mary R. Yates, Housekeeping Aide^^ 
Barbara A. Zimmerman, 

Computing Analyst- 

Big Bear Solar Observatory 

Alberta R. Altman, Secretary 
Jack R. Klemroth, 

Solar Observing Assistant 
Eugene H. Longbrake, Superintendent 
Charles F. Mason, General Machinist^^ 
Walter M. Nagao, Custodian 
Jeff B. Nenow, Solar Observing Assistant 
Alan P. Patterson, Associate Solar Scientist 
Ow^en Phairis, Solar Observing Assistant 

Las Caynpanas Observatory 

Maynard Clark, 

Senior Electronics Technician 
S. Thomas Couch, 

Administrative Assist ant ^^ 
Ljubomir Papic, Mountain Superintendent 
Manfred Wagner, Administrative Manager 



27 Terminated September 30, 1976. 

28 Retired November 22, 1976. 

29 Terminated June 30, 1977. 

30 Resigned December 9, 1976. 



31 Resigned October 21, 1976. 

32 Resigned May 23, 1977. 

33 Retired December 31, 1976. 

34 Terminated April 15, 1977. 



194 



CARNEGIE INSTITUTION 




H ^ 

1—1 0) 

(N '^ 

o 
f— I w 

o d 

O o 
cS CO 
■^^ J3 

>. o 

O (1) 
o M 

« _5 

TO 75 

■ d 

^ g 
-^ 5 

2 d 

*^ bC 

o) d 
^S 

a ■« 

>^ o 

X 0) 

■^ _d 

■*'^ 

^ o .2 

^ -^ bC 

2 o d 

tH 03 o 

'd '^ X 

d 0) X 

O -M -^^ 

CC rd M 

_d .22 9 
H cu O 

- d fc 

"^ "^ -d 



HALE OBSERVATORIES 



195 







Oi 






< 



a 
a 

O 
3 









a 
c 
O 



196 



CARNEGIE INSTITUTION 







<N 



< 

o 

o 

03 

a 

0) 

a 

CO 

o 



d 

CO 



O 

o 



Hi 

d 

a 

o 



& 






d 
o 

02 
0) 



CO 

Si 



HALE OBSERVATORIES 



197 







o 



'5: 

o 



o 

O 



o 

O 

G 



o 



198 



CARNEGIE INSTITUTION 



73 



O 

d 




T3 



bD 



05 



C<J 



p. 

<1 

d 
o 

CD 

o 



4^ 

d 
o 

d 



bD 
O 

O 
ft 

s 

CO 



o 




o 




:zi 




>. 




X 




^ 








Is 




bD 




t(-i 




u 




d 




^ 




-d 




9 


22 








_bC 


a; 




X3 





H 



Department of Plant Biology 



Stanford, California 



Winslow R. Briggs 



Director 



Carnegie Institution of Washington Year Book 76, 1976-1977 



Contents 



Introduction (Briggs) 203 

Spectral studies of P700-chlorophyll a-protein complexes (Brown) 209 

Action Spectra (French) 212 

Photosynthetic electron flow from photosystem II requires membrane-bound bicar- 
bonate (Stemler) 217 

The effect of temperature on the physical phase of chloroplast membrane lipids and 
photosynthesis (Fork) 220 

Introduction 220 

Lipid phase changes in lettuce and spinach chloroplasts at sub-zero temperatures 

(Murata and Fork) 220 

Studies on the effect of transition of the physical phase of membrane lipids on elec- 
tron transport in the extreme thermophile Synechococcus lividus (Fork and 
Murata) 222 

The Hght-induced carotenoid shift in Cyanidium and in higher plant leaves as an 

indicator of phase changes in chloroplast membrane lipids (Murata and Fork) 226 

The rate of proton gradient decay in chloroplasts as an indicator of membrane 

parameters (Avron and Fork) 231 

Proton gradients as possible intermediary energy transducers during ATP-driven 

reverse electron flow in chloroplasts (Avron and Schreiber) 236 

ATP-induced chlorophyll luminescence in isolated spinach chloroplasts (Schreiber and 

Avron) 236 

Studies on DNA sequence organization (Murray, Preisler, and Thompson) 240 

Single-copy DNA sequence comparisons in Atriplex (Belford and Thompson) 246 

Interspecific hybridization of fern DNA (Stein and Thompson) 252 

Contaminants affecting plant DNA reassociation (Murray and Thompson) 255 

Single-strand DNA fragment length determination by alkaline agarose electrophoresis: 

apphcations for DNA renaturation studies (Murray and Thompson) 259 

In vitro labeling of single-stranded DNA (Murray, Belford, and Thompson) 262 

Restriction endonuclease analysis of Agrobacterium plasmids (Rogler, Thompson, 

and Cohen) 267 

The use of two-wavelength microspectrophotometry to quantify light-induced changes 
in the intracellular distribution of phytochrome determined b}^ immunoc}i;o- 
chemical locahzation (Britz, Mackenzie, and Briggs) 274 

A recording microphotometer for measurement of chloroplast orientation movements 

in single algal filaments (Blatt and Briggs) 278 

The auxin hypothesis of light-inhibited cell elongation (Vanderhoef and Briggs) .... 282 

Kinetic and spectral studies on red-hght-induced suppression of mesocotyl elongation 

in maize (Vanderhoef and Briggs) 283 

Red- and Blue-Light-Induced Irreversible Absorbance Changes in Particulate Frac- 
tions of Com Coleoptiles (Britz, Widell, and Briggs) 286 



Methylene blue-mediated red-light photorediiction of cytochromes in particulate 

fractions of corn and Xcurospora (Britz, Schrott, Widell, Brain, and Briggs) .... 289 

Blue-light-induced absorbance changes in membrane fractions from Pisuin sativum 

(Galston, Britz, and Briggs) 293 

Correlative studies of hght sensitivity and cytochrome content in Neurospora crassa 

(Brain. Woodward, and Briggs) 295 

Solubilized membrane-bound auxin receptors from corn (Cross, Dohrmann, Briggs, 
and Ray) 299 

External labeling of membranes in intact plant tissues (Cross and Briggs) 303 

Ivinetic and ste<ady-state studies of ^^''O fixation into photorespiratory intermediates 
by intact leaves of C3 species (Berry, Osmond, and Lorimer) 307 

Incorporation of [^^0] oxygen into glycolate by intact isolated chloroplasts (Lorimer, 
Krause, and Berry) 314 

Induction of COo-independent photosynthetic O2 evolution in Dunaliella salina 

(Kaplan, Schreiber, and Avron) 316 

A proton gradient in intact cells of Dunaliella salina (Kaplan and Schreiber) 320 

Heat-induced cholorophyll fluorescence changes in intact leaves correlated with dam- 
age of the photosynthetic apparatus (Schreiber and Berry) 323 

Photosynthetic acclimation to temperature and water stress in the desert shrub Larrea 

divaricata (Mooney, Bjorkman, and CoUatz) 328 

Photosynthetic acclimation to temperature in Larrea divaricata: Light harvesting 
efficiency and capacity of photosynthetic electron transport reactions (Armond, 
Schreiber, and Bjorkman) 335 

Heat-induced changes in chlorophyll fluorescence and related heat damage at the 

pigment level (Schreiber and Armond) 341 

Thermal stability of photosjnithetic enzymes in heat- and cool-adapted C4 species 

(Bjorkman and Badger) 346 

Studies on the kinetic mechanism of ribulose-l,5-bisphosphate carboxylase and 
oxygenase reactions, with particular reference to the effect of temperature on 
kinetic parameters (Badger and Collatz) 355 

The internal CO2 pool of Chlamydomonas reinhardtii: Response to external CO2 

(Badger, Kaplan, and Berry) 362 

Adaptive value of leaf hairs in Encelia farinosa (Ehleringer) 367 

Bibliography 369 

Speeches 370 

Personnel 374 



INTRODUCTION 

In January 1977, a visiting committee partment to hear Carnegie scientists 
assembled by the Board of Trustees spent exj)lain their work and to see them 
the better part of two days at the De- demonstrate some of their equipment, 
partment of Plant Biology. Three of the Other classes, from Stanford and else- 
trustees and three plant scientists not where, used the field stations in the 
associated with Carnegie looked into Sierra Nevada — Mather and Timberline 
every facet of the Department — its teach- — for systematic or ecological studies, 
ing, its finances, and its science. The Department continued to make an 

Except for a few gentle caveats, the important contribution to graduate edu- 

committee's report was very favorable, cation through the participation of staff 

It lauded the Department for its unique members in thesis committees and the 

combination of informality, opportunity appointment of graduate students as 

for interaction, and adequate support fellows or assistants. Within the De- 

without pressure for short-term publica- partment, the mix of graduate students 

tion. This is the Carnegie approach to with postdoctoral fellows and more senior 

basic research, and it has consistently visitors is nearly optimal for effective 

led to outstanding results in plant science, interaction. 

Later in the year we were also greatly In summarizing some of the research 
encouraged and gratified by a grant of accomplishments of the past year, I feel 
$600,000 from the Andrew Mellon Foun- the usual uneasiness at attempting to 
dation for research on photosynthesis, single out highlights from a mass of 
The Mellon grant will enable us to in- sound research. The first section deals 
tensify our efforts to understand this primarily with basic aspects of photo- 
complex and vital process. synthesis at the mechanistic level, the 

This year, once again, every lab desk second with nucleic acids, the third with 

was occupied. Visitors ranging from un- the role of light and hormones in plant 

dergraduates to senior scientists on sab- growth, and the final section returns to 

batical exchanged information and ideas photosynthesis, this time primarily in the 

about a variety of research problems, context of adaptation to stress. 

Their collaboration resulted in a number Several of the articles report either the 

of articles, which appear later in this development of techniques or the design 

Report. of special equipment. For example, C. 

The Department continues to play an Stacy French, continuing his long-stand- 
important teaching role. Faculty mem- ing interest in action spectroscopy, has 
bers were repeatedly called on to give found an ingenious way of measuring 
guest lectures at Stanford University, steady-state dye concentration in light 
and visiting fellows occasionally par- and dark in a system containing dye and 
ticipated as well. Most of the younger photosynthetically active particles. The 
scientists had an opportunity to present beauty of the method is that it averages 
their work for critical review at seminars out ''noise" and permits far greater ac- 
with Carnegie and Stanford botanists, curacy than was possible before. ]\Iichael 
Carnegie staff and fellows also partici- Blatt, a graduate student working with 
pated with Stanford faculty in an ad- Briggs, has developed a technique for 
vanced seminar course on plant move- studying the influence of light on chlo- 
ments. Three groups of students from roplast movement in single algal fila- 
San Jose State University and San Fran- ments. The method utilizes two optic 
Cisco State University came to the De- fibers: One carries both actinic and 

203 



204 CARNEGIE INSTITUTION 

measuring beams to the filament ; and photosynthesis group, continued his 

the other, equipped with a filter to screen studies on the role of the bicarbonate ion 

out the actinic light, carries light trans- in the oxygen-evolving portion of system 

mitted through the filament to a photo- II in photosynthesis. He showed that 

diode for continuous monitoring. there was a very close correspondence 

Britz and Mackenzie, also with Briggs, between the binding of bicarbonate to 
adapted a two-wavelength microspectro- thylakoids and oxygen-evolving capacity, 
photometric method to quantify the that the bicarbonate, once bound, was 
fractional area covered by pigment in a not freely exchangeable, and that the 
system in which the distribution is non- binding site was perhaps not far from 
homogeneous. They applied the technique the site of action of the system II in- 
to determine indirectly the extent of hibitor DCMU. 

light -induced redistribution of the pho- Fork has continued his studies of the 

tomorphogenic pigment phytochrome. influence on photosynthetic activities of 

Murray and Thompson discovered a physical phase transitions of thylakoid 
contaminant that can greatly accelerate membrane lipids. In chloroplasts of let- 
plant DXA reassociation, and developed tuce and spinach that have high concen- 
techniques to eliminate it, thereby re- trations of unsaturated fatty acids, these 
moving a serious and puzzling source of phase transitions occurred well below 
variability in reassociation experiments. 0°C. He and Murata obtained evidence 
They also modified an electrophoresis that increasing either magnesium or 
technique to give extremely accurate potassium concentration in chloroplasts 
measurement of the lengths of single- from spinach or lettuce markedly de- 
stranded DNA fragments. Finally, Mur- pressed phase transition temperatures. In 
ray and Thompson modified a technique contrast to the lettuce and spinach, in 
for labeling single-stranded DNA so that which the phase transition temperatures 
far longer and. more complex DNA frag- were all below 0°C, the thermophilic 
ments could be labeled than previously, blue-green alga Synechococcus lividus, 
All three of these studies of plant nucleic which is capable of growing photosyn- 
acids sharpen the tools for investigation thetically at 75°C, showed a phase transi- 
of the properties of the plant genome in tion near 43°C when grown at tempera- 
organization, evolution, and expression tures above 55°C. When the algae were 
during development. grown at lower temperatures, lower phase 

Brown has made progress in char- transitions were seen. Consistent with the 
acterizing the reaction center chlorophyll results obtained earlier with the blue- 
complex from higher plants and algae. In green alga Anacystis, the photosynthetic 
addition to showing electron transfer to electron transport capacity of Synecho- 
cytochrome 6(5 under the appropriate con- coccus declined sharply below the phase 
ditions of pH and illumination, she ob- transition temperature, 
tained evidence from various sources for Murata and Fork also found that 
a tightly bound carotenoid in the com- phase transitions could be detected by 
plexes and determined the relationships measuring the dark decay of the light- 
between differently fluorescing systems, induced carotenoid change. These studies 
The interfacing of the Hewlett-Packard showed that chilling-sensitive plants had 
21 16 computer with the spectrofluorimeter a phase transition above 0°C that varied 
greatly increased the resolution of. the with growth temperature, while chilling- 
fluorescence studies, particularly in re- resistant plants did not. Finally, Fork 
solving fluorescence bands from back- and Avron studied the influence of tem- 
grounfl noise when total fluorescence was perature on the rate of proton efflux 
extremely low. through thylakoid membranes by mon- 

Stemler, a postdoctoral fellow with the itoring the fluorescence of 9-aminoacri- 



DEPARTMENT OF PLANT BIOLOGY 205 

dine. They found the rate to be sharply will help elucidate the functional sig- 
temperature-dependent and an excellent nificance of the organization, 
indicator of phase transitions and other Bel ford has greatly refined and ex- 
temperature-dependent membrane pa- tended her techniques for investigating 
rameters. Their technique also showed relationships among species of the genus 
the clear differences between chilling- Atriplex by a study of single-copy DNA 
sensitive and chilling-insensitive higher homology. The greater precision and ad- 
plant chloroplasts. ditional species examined strengthen the 

Concluding the reports of studies on earlier conclusion that present-day species 

photosynthesis per se are two articles utilizing the C4 photosynthesis pathway 

by Avron (on sabbatical leave from the did not arise independently, but prob- 

Weizmann Institute) and Schreiber. ably diverged from a common C4 stock 

These describe how 9-aminoacridine is early in the history of the genus, 

used to monitor proton pumping and Stein extended an evolutionary study 

efflux to determine how closely proton of the fern genus Osmunda to resolve an 

pumping parallels changes in the reduc- inconsistency between several recent 

tion of the primary system II electron DNA hybridization experiments and 

acceptor when reverse electron transport some earlier results. The sensitivity and 

is driven by exogenous ATP. Under a reproducibility of the inter-species com- 

wide variety of conditions, the buildup parisons by DNA hybridization allowed 

of protons in the thylakoids remarkably the conclusion that one collection made 

paralleled the reduction of the primary in 1973 was either from a natural hybrid 

acceptor, thus strengthening the chemi- population or contained tissue from a 

osmotic hypothesis for energy transduc- related, morphologically similar species, 

tion in chloroplasts. Avron and Schreiber The results also indicated that the tech- 

also found conditions under which elec- nique permits discrimination between 

tron transport could be driven backward closely related species, and can possibly 

with ATP to the photosystem II reaction even discern hybrids. This observation 

centers, and they were able to monitor suggests that detailed studies of repeated 

the process by chlorophyll luminescence, sequence evolution in Atriplex species 

In addition to the technical studies may soon be possible, 

mentioned earlier, Thompson's group has Rogler, with Thompson and Cohen, 

made substantial progress in several basic completed a careful comparative study 

areas. Murray and Preisler, together with of restriction enzyme fragments from 

Thompson, have obtained some solid purified plasmids from both tumor-induc- 

comparative data on sequence organiza- ing and non-tumor-inducing strains of 

tion in the pea and mung bean genomes, the crown gall bacterium Agrobacterium 

Both plants, in common with most ani- tumefaciens. It is clear that there are 

mals, contain single-copy sequences in- more DNA sequences in common among 

terspersed with repetitive sequences, the tumor-inducing plasmids than be- 

Mung bean, however, has more single- tween them and the non-tumor-inducing 

copy sequences than the pea has; and in ones, at least on the basis of DNA frag- 

the mung bean the long-period intersper- ment size. It is also evident that classes 

sion pattern is more common. Peas, hav- of a certain size are duplicated, though 

ing more total repetitive DNA, exhibit whether or not the duplicates represent 

much more short-period interspersion — identical sequences has not yet been re- 

and may actually have no significant solved. As in other studies by the plant 

long-period component at all. There are nucleic acid group, the resolving power 

other differences, and it is clear that con- of the techniques has been greatly im- 

tinued comparative study of both DNA proved in the past year, 

sequence organization and transcription Vanderhoef (on sabbatical leave from 



206 CARNEGIE INSTITUTION 

the University of Illinois) and Briggs tions from another higher plant, the pea 
completed a detailed study on the influ- seedling. Like corn and Neurospora, peas 
ence of red light on elongation of the yielded a membrane fraction enriched in 
first internode of germinating corn seed- the photoreducible system. It also could 
lings. They found that light treatment be reduced by red light if methylene blue 
brings about a dramatic inhibition of was present. The pea system permitted 
growth, and that the effect can be com- measurement of reversible light-induced 
pletely reversed by adding the plant hor- flavin reduction alone, in the absence of 
mone auxin. The inhibition shows two any interaction with the cytochrome, and 
phases, one in response to extremely low yielded a difference spectrum consistent 
doses of light and the other requiring with that for a flavoprotein. 
much larger doses. An action spectrum Brain, Woodward, and Briggs obtained 
for the first phase shows a peak at about evidence that Neurospora mutants de- 
665 nm. indicative of the well-known ficient in 6-type cytochromes are also 
photomorphogenic pigment phytochrome, deficient in light-reducible cytochrome in 
but there is a second sharp peak at 640 membrane fractions and have signifi- 
nm which cannot be attributed to phyto- cantly impaired photosensitivity. That 
chrome. Earlier workers had noted the the reduced photosensitivity was not 
peak but otherwise ignored it. Britz, simply an indirect result of lowered 
Widell. and Briggs have detected in respiratory capacity was suggested by 
membrane fractions from corn a pigment the appearance of normal photoreducible 
absorbing near 630 nm that is effectively cytochrome responses in membrane prep- 
bleached by both red and blue light, arations from another kind of respiratory 
They present evidence that this pigment mutant with normal cytochromes. These 
might be the 640-nm photoreceptor (pig- results, together with the pea and methy- 
ments frequently show spectral shifts lene blue studies, are the strongest to 
upon extraction). Whatever the outcome date implicating the fiavoprotein-cyto- 
of further studies, there is now reason to chrome complex in the blue-light photo- 
believe that phytochrome may not be the reception process. 

only photomorphogenically active pho- Cross, continuing with Dohrmann and 

toreceptor absorbing in the red region of Ray a project begun by Dohrmann last 

the spectrum. year, succeeded in the solubilization and 

Since methylene blue was known to partial purification of a macromolecule 

endow normally blue- and ultraviolet- that binds the plant hormone analog 

sensitive processes in several fungi with naphthylene acetic acid. He was able to 

red-light sensitivity, Britz, with Schrott, separate it clearly from ATPase activity 

Widell, and Brain, investigated whether by column chromatography, thereby 

the dye would also confer red-light sensi- weakening the hypothesis that auxin acts 

tivity on the normally flavin-mediated by binding and somehow affecting the 

photoreduction of a 6-type cytochrome, activity of a membrane-bound ATPase. 

thought to be a candidate for the blue- Cross also demonstrated (contrary to the 

ultraviolet photoreceptor in higher plants literature and our own expectations) that 

and fungi. Methylene blue did indeed the fluorogenic dye fluorescamine is not 

mediate light-induced transfer of elec- a specific label for cell surfaces but that 

trons to the appropriate cytochrome, and it shows a high affinity for any cellular 

showed a fairly high degree of specificity membrane and presumably reacts with 

in com and Neurospora membrane frac- the free amino groups of such molecules 

tions. as phosphatidyl ethanolamine. Definitive 

Galston, visiting briefly from Yale, identification of a specific membrane 

searched with Britz for light-inducible fraction such as the plasma membrane 

cytochrome reduction in membrane frac- has not been achieved, but current studies 



DEPARTMENT OF PLANT BIOLOGY 207 

with fluorescent mercury compounds fluorescence. They were able not only 

seem promising. to rank the plants in terms of heat sta- 

Berry, who has been on sabbatical bility but also to distinguish differences 

leave from the Department for the past in heat tolerance in specimens of a single 

year, has been investigating the origin species grown at different temperatures. 

of glycolate and other photorespiratory They also showed that by a mechanism 

intermediates in collaboration with Os- currently not understood, high light in- 

mond, Lorimer, and Krause. They con- tensity can provide substantial protection 

elude that it is extremely unlikely that against heat damage, 

glycolate arises in significant amounts A series of studies on the desert shrub 

from a pathway other than the oxygena- Larrea divaricata illustrates, among other 

tion of ribulose-l,5-bisphosphate car- things, the degree of interaction among 

boxylase. Understanding the origin of research groups in the Department and 

glycolate should help in the understand- the integrated approach that such inter- 

ing of environmental control of photo- action can produce. Mooney, Bjorkman, 

respiration. and Collatz studied photosynthesis in 

In a study of the highly salt-tolerant Larrea seedlings from Death Valley 
alga Dunaliella, Kaplan, with Avron grown under three temperature regimes. 
and Schreiber, studied some very inter- It was clear that the temperature for 
esting responses to increases in sodium optimum photosynthesis was higher when 
concentration. They showed that addition the plants were grown at higher tempera- 
of salt brought about a sharp increase tures, and that the disparity was unre- 
in oxygen evolution, even in the presence lated to differences either in the CO2- 
of extremely low CO2. It was already fixing enzyme or in some aspect of pho- 
known that such treatment would greatly torespiration. They then examined the 
increase the glycerol concentration within effect of water stress on the quantum 
the cell. The results were consistent with yield of photosynthesis for Larrea plants 
the hypothesis that the increase in sodium grown under ample water supply, com- 
concentration resulted in a diversion of pared to the effect on plants from Death 
the NADH and ATP from photosynthesis Valley. When the stress was — 36 bar, 
to the production of the glycerol from the quantum efficiency in the first group 
stored carbohydrate reserves. Kaplan dropped by half. What was startling, 
and Schreiber then used the same dye however, was that the same species, 
mentioned earlier, 9-aminoacridine, to growing in Death Valley, showed a nor- 
show the existence of a light-driven mal quantum efficiency and little change 
sodium-dependent proton uptake system, between — 20 and almost — 50 bar. The 
probably involving an ATPase. The re- results show not only that Larrea can 
suits could explain why Dunaliella can photosynthesize effectively under re- 
tolerate such dramatic changes in sodium markable drought stress in nature, but 
concentration without taking up any also that one must be very careful not to 
sodium ions. extrapolate from greenhouse and growth- 

The physiological ecology group has chamber experiments without doing care- 
done extensive experimentation upon the ful field studies as well, 
effect of temperature on whole plants or Armond, Schreiber, and Bjorkman next 
plant parts. Schreiber and Berry, work- isolated chloroplasts from the Larrea 
ing with leaves of plants with large dif- plants grown under the three tempera- 
ferences in heat tolerance, monitored ture regimes and investigated fluorescence 
changes in fluorescence both with gradu- properties of the chloroplasts with heat- 
ally increasing temperature and also with ing. Plants grown at the highest tempera- 
a sudden temperature jump under con- ture regime showed little change in fluo- 
ditions yielding either fixed or variable rescence spectra with heating, though 



20S CARNEGIE INSTITUTION 

they had the hirgest photosynthetic between species adapted to high tempera- 
units. Chlorophists from ph\nts grown on tiires and those adapted to low, there 
the other two regimes, however, showed are differences in enzyme stability as well, 
marked heat damage to energy transfer Badger and Collatz have undertaken 
from clilorophyll b to chlorophyll a at a detailed kinetic study of the enzyme 
temperatures well below those required ribulose-l,5-bisphosphatase carboxylase 
to inactivat<^ electron transport. Clearly, to learn something of the carboxylase 
pigment organization is a weak point and oxygenase reaction mechanisms. Al- 
in temperature stability. Furthermore, though the results are incomplete, they 
Larrea plants grown at a higher tempera- suggest that neither reaction is a strictly 
ture can adjust to improve the stability ordered one, with the COo or O2 always 
of the pigment organization. binding to the enzyme after the ribulose- 

More detailed experiments by Schreiber 1,5-bisphosphate. Badger, Kaplan, and 
and Armond showed heat damage to Berry have also continued work begun 
transfer of energy among forms of chlo- last year on the mechanism by which 
rophyll a as well, and also showed that the alga Chlamydomonas reinhardtii 
during heat inactivation those reaction adapts to growth on low concentrations 
centers which were still active were fully of CO2. The results clearly show that 
active and the photosynthetic unit size the adaptation involves development of a 
imchanged. By helping to describe how system to concentrate CO2 from the ex- 
one plant copes with drought stress, these ternal medium. This system is unrelated 
studies have added substantially to our to C4 photosynthesis in higher plants, 
knowledge of the nature of heat damage Ehleringer, as part of a wider study 
in plants. of leaf hairs in the genus Encelia, has 

In another study on heat damage, done a combination of experimentation 
Bjorkman and Badger investigated the and modeling which show that the leaf 
thermal stability of 14 photosynthetic hairs in this plant are highly adaptive, 
enzymes from the high-temperature- Without reflective leaf hairs, the plant 
adapted C4 species Tidestromia oblongi- would be unable to survive the extreme 
folia and the cool-temperate C4 species temperatures of its habitat. 
Atriplex sabulosa. Of the 14 enzymes Highlights of research for the year in- 
studied, four had heat stabilities that elude the extensive temperature studies 
were identical or similar in the two spe- in Fork's laboratory, the substantial tech- 
cies, while another six showed difTerences nical improvements and increased resolu- 
of from 6 to 10°C. In more than half tion developed in Thompson's laboratory, 
the enzymes investigated, heat inactiva- the increasing evidence from Briggs' 
tion of the Atriplex enzyme occurred at laboratory that a flavoprotein-cyto- 
temperatures lower than those affecting chrome complex is directly involved in 
the overall rate of photosynthesis in some way in photoreception of blue and 
Tidestromia but usually higher than ultraviolet light, and the extensive studies 
those required to inhibit photosynthesis of adaptation to temperature stress by 
in intact Atriplex. However, in both Bjorkman's group. 

plants there were certain enzymes that It should also be mentioned that Nobs 

showed heat inactivation near the tem- and Hiesey are assembling for publica- 

perature at which overall photosynthesis tion the results of an enormous program 

is inactivated. Many of these are enzymes of hybridization and transplantation of 

that require light activation. Thus, in grasses carried out years ago. This work 

addition to the known differences in heat is a welcome addition to the five volumes 

stability of system II electron transport of Experimental Studies on the Nature 

and of noncyclic photophosphorylation 0/ Species. 



DEPARTMENT OF PLANT BIOLOGY 



209 



SPECTRAL STUDIES OF P700-CHLOROPHYLL 
a-PROTEIN COMPLEXES 

Jeanette S. Brown 



The basic mechanism by which energy 
is converted in all plants from sunlight 
absorbed by chlorophyll to chemical po- 
tential is one of our most important 
scientific problems. One approach to 
this problem is to disrupt chloroplasts 
(the chlorophyll-containing organelles in 
which photosynthesis occurs) and to at- 
tempt to extract the smallest photo- 
chemically active piece. The most prom- 
ising of the ^'pieces" thus far obtained is 
the chlorophyll-protein complex, CPI, 
which contains the reaction center of 
photosystem I, P700. P700 is a special 
form of chlorophyll u, probably a dimer, 
which can be reversibly oxidized by visi- 
ble light. CPI obtained by detergent 
solubilization of chloroplast membranes 
and separation by hydroxylapatite chro- 
matography contains between 20 and 40 
antenna chlorophyll a molecules in addi- 
tion to the P700, depending upon details 
of the extraction procedure. Two cyto- 
chromes and an iron-sulfur protein nor- 
mally co-chromatograph with the chlo- 
rophyll-protein and a small amount of 
carotenoid pigment. The chlorophyll- 
protein structure of the basic complex is 
not known, but a model proposed by 
Thornber et at. (1977) suggests that the 
P700 may be attached to one polypeptide 
of a trimer having a total molecular 
weight of 160 kilodaltons. 

We have continued our spectroscopic 
studies of this P700-chlorophyll-protein 
complex isolated for the most part from 
spinach chloroplasts and a yellow-green 
and a blue-green alga. Fluorescence- 
excitation spectra have given information 
about energy transfer within the pigment 
complex, and the dark reduction kinetics 
of P700 by ascorbate have been clarified. 



Fluorescence Excitation and 
Emission of CPI* 

An emission spectrum of a CPI prepa- 
ration from spinach having a chlorophyll 
to P700 ratio of 32 was shown in Year 
Book 75, Fig. 47. An explanation for the 
unusual emission maximum of this spec- 
trum at 696 nm was suggested: namely 
that the oxidized dimer of P700 fChl+ • 
Chi) may absorb at about 690 nm and 
fluoresce near 696 nm. Philipson et al. 
(1972) suggested a similar hypothesis to 
explain their circular dichroism results, 
which indicated that exciton interaction 
between chlorophylls of a P700 dimer 
may cause absorption bands at 683 and 
697 nm. Upon oxidation these bands 
would disappear and a new band would 
appear near 686 nm of the unoxidized 
chlorophyll. This 686-nm absorption band 
could be the source of the 696-nm emis- 
sion maximum at low temperature. 

The emission spectra reported last year 
were measured with exciting light cen- 
tered at 438 nm and a slit-wndth of 10 
nm. A comparison of excitation spectra 
for emission from spinach CPI at 696 or 
670 nm (Fig. 1) shows that absorption 
near 450 nm preferentially excites the 
696 nm emission. The main excitation 
bands near 440 and 420 nm correspond 
to maxima of the absorption spectrum, 
but no band can be distinguished on the 
steep slope of the absorption spectrum 
near 450 nm. When Triton is added to a 
CPI preparation, emission at 650 and 670 
nm is increased from solubilized chlo- 
rophylls 6 and a, respectively. The emis- 
sion near 650 nm is excited bv 465-nm 



* CPI = P700-chlorophyll a-protein. 



210 



CARNEGIE INSTITUTION 



T 1 1 1 1 r 




360 380 400 420 440 460 480 



640 660 680 700 720 740 



Wavelength, nm 

Fig. 1. Fluorescence excitation and emission (— 196°C) and absorption spectra (— 180°C) of 
spinach CPI, chlorophyll/P700 = 30. For excitation spectra both sHt widths = 6 nm. For 
emission spectra excitation slit widths = 10 nm, emission slit widths =r 3 nm. 



light and the 670-nm emission by light 
absorbed by chlorophyll a below 440 nm. 
Even though only traces of these solu- 
bilized chlorophylls are formed, they have 
a very high fluorescence yield compared 
to the pigment bound to the protein 
complexes. 

In an attempt to understand the source 
of the excitation band near 450 nm, the 
low-temperature fluorescence of a photo- 
system I centrifugal fraction of spinach 
chloroplasts broken in a French press 
was measured for compari.son with CPI. 
The emission maximum characteristic of 
this spinach fraction is highest near 730 
nm at — 196^' (Brown, 1971). An exci- 



tation spectrum for emission at 730 nm 
showed maxima at 440, 446, 450, 464, 
470, and 474 nm. Apparently light ab- 
sorbed by chlorophyll a at 440, chloro- 
phyll b near 470, and carotenoid pigments 
at the other wavelengths passes by reso- 
nance energy transfer to the form of chlo- 
rophyll a absorbing the longest wave- 
lengths near 704 nm from which it is 
emitted. A separate band near 696 nm 
was not seen. Probably the Triton treat- 
ment used to extract CPI from the mem- 
brane solubilizes the long-wavelength, 
aggregated chlorophyll forms (Ca692 and 
Ca704) and thereby reduces the long- 
wavelength fluorescence (>725nm) from 



DEPARTMENT OF PLANT BIOLOGY 



211 



CPI. This effect may not occur during 
chloroplast particle preparations. 

A comparative study of chlorophyll- 
protein complexes isolated from different 
kinds of algae has continued with the 
yellow-green Bumilleriopsis filiformis and 
blue-green Anabaena * cylindrica. Pre- 
liminary results with Bumilleriopsis indi- 
cate that a chlorophyll complex analogous 
in its chromatographic elution pattern to 
spinach CPI can be obtained. The 
chemically reduced minus oxidized ab- 
sorption difference spectrum of this algal 
complex is similar to that of P700-en- 
riched higher plant fractions and showed 
a chlorophyll-to-P700 ratio of about 45. 
However, only a comparatively small, re- 
versible light-induced absorption change 
near 700 nm could be observed, and it 
had very slow kinetics. It may be that 
the detergent treatment removes the pri- 
mary electron acceptor from P700 in this 
alga. The 696-nm maximum was present 
in the fluorescence emission spectrum but 
was shorter in comparison to the 683-nm 
band than in the spinach CPI spectra. 
A comparison of excitation spectra for 
emission at these two wavelengths showed 
a maximum at 457 nm preferential for 
emission at 696 nm. 

CPI preparations from Anabaena were 
enriched in both light-oxidizable and 
chemically oxidizable P700 with a ratio 
of about 55 chlorophyll a molecules to 
one P700. These preparations also showed 
a distinct fluorescence emission maximum 
at 696 nm ( — 196°C) that was preferen- 
tially excited by absorption at 425 and 
450, with an additional strong band at 
480 nm. 

Collectively these results indicate that 
the chlorophyll-protein complex isolated 
from photosynthetic membranes by de- 
tergent treatment and enriched in the 
photosystem I reaction center chloro- 
phyll, P700, contains a tightly bound 
carotenoid that is able to transfer its 
absorbed energy to chlorophyll that 
fluoresces at 696 nm. Results by Ji et al. 
(1968) showed that the absorption of 
/^-carotene in vivo is modified from that 



in solution, probably by its attachment 
to the chlorophyll phytol and lamellar 
I)rotein. It is reasonable to assume that 
CPI prej)arations from different .s[)ecies 
may contain a similarly bound carote- 
noid with slightly different absorption 
maxima. A Soret band of an oxidized 
P700 dimer absorbing near 450 nm could 
also be the source of 696-nm emission. 
It will be of interest to measure action 
spectra for P700 j)hotooxidation by these 
complexes. 

Excitation spectra can be measured 
with an instrument such as the Perkin- 
Elmer MPF-3L Fluorimeter. The xenon- 
arc actinic light source contains a number 
of intense emission lines between 450 and 
500 nm which can distort the true excita- 
tion spectrum for pigments such as ca- 
rotenoids and chlorophyll b, which absorb 
in this spectral region. Recently we have 
been able to nullify this artifact by using 
the Hewlett-Packard 2116C computer to 
digitize and store collected spectra. Since 
a concentrated solution of Rhodamine B 
has an essentially constant quantum 
yield over the wavelength region from 
200 to 600 nm, its measured excitation 
spectrum is proportional to the quantum 
flux of the actinic light. Excitation spec- 
tra between 400 and 500 nm with differ- 
ent excitation slit-widths for the emission 
of Rhodamine B at 550 nm have been 
collected and stored in the computer. An 
experimental spectrum is divided by the 
Rhodamine curve measured at the same 
slit- width to give the corrected excitation 
spectrum free of artifacts caused by the 
lamp emission or other characteristics of 
the equipment. 

Effect of pH on the Reduction 
Kinetics of P700 by Ascorbate 

Since CPI does not contain any natural 
reductant for P700, ascorbate is usually 
added to reduce P700 in darkness after 
it is photooxidized. Shown below are the 
reduction half-times of photooxidized 
P700 as a function of pH and ascorbate 
concentration. 



212 



CARNEGIE INSTITUTION 



Ascorbi\ie 

Conoeniratiou 

mM 



Reduction 
Half-time (sec) 
pH S pH 10 



10 
50 

100 



24 
10 

4 



3 
<1 
<1 



Because ascorbate donates protons as 
well as electrons when it is oxidized, it 
can he a more efficient reductant at higher 
pH. but whether this property can ac- 
count completely for these kinetic differ- 
ences shown in the table is not clear and 
should be further investigated. 

At higher pH and ascorbate concen- 
trations the extent of P700 oxidation at 
a given light intensity may be less be- 
cause the rate of reduction may exceed 
the rate of oxidation. The extent of oxi- 
dation as measured by the decrease in 
absorption of P700 at 697 or 430 nm 
appeared to decrease with time in con- 
tinuous actinic light. This decrease was 
found to be the result of the depletion of 
oxygen, the final electron acceptor, in 
the cuvette. Methyl-viologen can act as 
an electron carrier between oxidized P700 
and oxygen and thereby increase the rate 
of this reaction. 

Coupled P700 Photooxidation and 
Cytochrome be Reduction 

The procedure of Shiozawa et al. 
(1974) for preparing CPI by Triton- 
solubilization of chloroplast membranes 
and hydroxylapatite chromatography 
permits the co-chromatography of cyto- 
chromes / and be along with the P700- 
enriched chlorophyll-protein. As noted 



previously {Year Book 74, pp. 779-783; 
Year Book 75, pp. 460-465) no light- 
induced oxidation of these cytochromes 
could be observed even with added plas- 
tocyanin. However, when the absorption 
change of P700 was measured at 430 nm 
with 100 mM ascorbate at pH 10, a large 
positive change occurred after the initial 
rapid decrease in absorption in continu- 
ous light. That this change was caused 
by cytochrome be reduction was con- 
firmed by observing a maximum at 563 
nm in the light-minus-dark difference 
spectrum. The reduction kinetics of the 
cytochrome were very slow (ti/2 = 2-3 
min) , indicating that the cytochrome was 
only loosely bound to the chlorophyll- 
protein. Anaerobic conditions favored the 
reduction, and there was some indication 
in the difference spectrum near 552 nm 
that cytochrome / was also reduced. The 
cytochrome could be reoxidized by mix- 
ing with air. 

References 

Philipson, K. D., V. L. Sato, and K. 

Sauer, Biochemistry 11, 4591-4595, 

1972. 
Brown, J. S., Methods Enzymol. 23, 477- 

487, 1971. 
Shiozawa, J. A., R. S. Alberte, and J. P. 

Thornber, Arch. Biochem. Biophys. 

165, 388-397, 1974. 
Ji, T. H., J. L. Hess, and A. A. Benson, 

Biochim. Biophys. Acta 150, 676-685, 

1968. 
Thornber, J. P., R. S. Alberte, F. A. 

Hunter, J. A. Shiozawa, and K.-S. Kan, 

Brookhaven Sym. Biol 28, 132-148, 

1977. 



ACTION SPECTRA 



C. Stacy French 



The work reported here started with of the two photochemical systems of 

the hope of finding good material and green plant photosynthesis. The purpose 

methods for measuring as precisely as was to compare the sum of the two action 

possible separate action spectra for each spectra with the absorption spectrum of 



DEPARTMENT OF PLANT BIOLOGY 



213 



the material to see if the absorption by 
chlorophyll can be accounted for by the 
activity of the two recognized photo- 
chemical steps in the normal process of 
photosynthesis — in other words, to con- 
struct a balance sheet for the distribution 
of absorbed energy between the two pho- 
tosystems and to check for small amounts 
of inactive absorption by certain forms 
of chlorophyll. 

The Nostoc preparations of Arnon 
were considered especially promising for 
such experiments because these very 
small particles give an essentially clear 
solution with strong activity for both 
photosystems. Furthermore, the action 
spectra for various steps in the electron 
transport system in Nostoc particles have 
been studied in detail by Fork, Hiyama, 
and Ford {Year Book 73, pp. 725-738). 
The stability of the frozen preparations 
make them particularly convenient. This 
work has been made possible through 
gifts of the frozen particles from Pro- 
fessor Arnon and Dr. Hiyama and 
through frequent consultation with Drs. 
Brown, Fork, and Avron. Much time has 
been spent on technical trivialities such 
as calibrations, investigations of sources 
of error, computer programming, pre- 
liminary experimentation, and methods 
of increasing the measurable signal with- 
out undue distortion of the data. The 
optimum format for presentation of 
action spectra has been given some at- 
tention. Although the basic objective of 
the work as stated above has not yet 
been reached, a very satisfactory pro- 
cedure has been devised for measuring 
the action spectrum of DCIP oxidation. 
The beauty of this method is that we 
can measure the stationary-state dye 
concentration instead of having to evalu- 
ate rates. Thus the noise level is aver- 
aged over a long period. Attempts may 
be made in the future to use similar 
dynamic equilibrium methods to study 
other steps in the electron-transport 
chain. 



Methods 

Measuring System 

The exposures are made in a 1 X 1 cm 
cuvette with a plastic insert giving a 
sharply defined top to the 1-cm liquid 
level. The whole cell is illuminated by 
the measuring beam from one side and 
by the actinic beam at a right angle to 
the measuring beam. Behind the cell an 
aluminum reflector returns 72% of the 
transmitted actinic beam. A reference 
measuring beam goes through an ad- 
jacent cell filled with water. Both of these 
measuring beams fall on silicon cells 
whose outputs are amplified and the 
ratios of the outputs determined by a 
divider. The transmission of the sample 
is recorded on an effective recorder scale 
of 1000 inches with a calibrated variable 
offset. Part of the actinic beam is re- 
flected by a glass plate to another silicon 
cell to monitor the actinic intensity, 
which shows on one pen of a two-channel 
recorder. When rates are to be deter- 
mined, the actinic monitor output goes 
first to an integrator, then to the recorder, 
to give a measure of the intensity X time 
as shown in Fig. 2. 

The absorption curves of the Nostoc 
material and the dye are used with the 
measured transmission at 593 nm to cal- 
culate the average actinic intensity in 
the cell for each wavelength. This aver- 
age intensity, including the light passing 
through and reflected back, is used in- 
stead of the incident intensity to calculate 
the action spectrum. This makes it pos- 
sible to use a high enough absorption to 
give an adequate response without dis- 
torting the results. The average intensity 
for each pass is calculated as: 



-.{ 



0.434 \ 

j(l _e-^/o-434) 



E 



where E is the optical density of the 
mixture for the actinic wavelength. The 
spectral half-width of the actinic light 
from the monochromator was 4 nm, small 
enough not to distort the action spectrum 



214 



CARNEGIE INSTITUTION 




Fig. 2. The transmission of Nostoc particles 
suspended in DCIP solutions. For 593 nm where 
the dye absorption is high, transmission in- 
creases on exposure to light that reduces the 
dye. The integral of intensity X time of the 
actinic beam is shown by the lower trace. The 
hght efifect is determined by extrapolation of 
the transmission drift before and after the 
exposure. 



detectably. This was checked with the 
slit-width correction program of Jones 
adapted to the Hewlett-Packard 2116 
computer by Glenn Ford. 

DCIP Reduction 

Before the DCIP oxidation was studied, 
an action spectrum for reduction of the 
same dye was measured. This work was 
a repetition of the study of Fork, Hiyama, 
and Ford (Year Book 73, pp. 725-738) 
to check out the modifications in the 
procedure. For DCIP reduction the fol- 
lowing reaction mixture was used at 
20X': XaHPO, pH 6.4, 2.5 X lO-^M; 
DCIP 3.33 X 10--^ M] DPC 4 X 10"^ 
M] MgCU 10-2 M; NaHC03 2 X 10-'^ 
M; sucrose 0.5 M; green material about 
2.2 fig ' chl/ml, absorbing about 30% at 
680 nm (higher in some experiments). 
Initially the dye concentration drifted 
toward an increase in color (reduction of 



partially oxidized dye), and then after 
half an hour of intermittent illumination 
the dye was slowly oxidized. For the few 
minutes before, during, and after an ex- 
posure of about 1 minute, these rates of 
drift were nearly constant. The change 
in transmission due to the light exposure 
was determined by extrapolation of the 
''before" and "after" drift lines to the 
center of the exposure time as shown in 
Fig. 2. This is a somewhat less than 
satisfactory procedure; it is nevertheless 
preferable to measuring slopes. 

DCIP Oxidation 

Particles of photosynthetic material 
in a solution of DCIP reduced to its 
colorless form by an excess of ascorbate 
wdll oxidize some of the dye to its colored 
form (Vernon and Zaugg, 1960). Equality 
is reached between the rate of the photo- 
oxidation and the rate of dye reduction 
by the ascorbate in about a minute at 
10°C, with a few percent of the dye in 
the oxidized form. In the dark the dye 
again becomes colorless. The initial rate 
of this photochemical reaction has been 
used as a measure of system I action by 
Brown {Year Book 70, pp. 499-504, 
1971), and also by Binder, Tel-Or, and 
Avron (1976). The measurement of the 
equilibrium dye concentration rather 
than its photooxidation rate is, however, 
far more convenient and precise. 

The reaction mixture for DCIP oxi- 
dation was: MgCU 10-^ M; DCIP 6.6 
X 10~-^ M; bovine serum albumin 0.04% ; 
DCMU 10-^ M; Methyl viologen 20 
/xM; Tris pB. 7.42, 0.05 M; sucrose 0.5 
M; green material 4.6 /xg chl/ml (56% 
absorption at 680 nm) ; catalase 1.66 X 
10-2 mg/ml; sodium ascorbate (to re- 
duce dye + 10% excess) ; dissolved O2 
about 2.8 X 10"^ M. DCMU was used 
to poison system II activity, methyl 
viologen to couple the reduced dye to 
dissolved oxygen, and (at Dr. Avron's 
suggestion) catalase to decompose any 
H2O2 produced. Bovine serum albumin 
and sucrose were added as stabilizers. At 



DEPARTMENT OF PLANT BIOLOGY 



215 



first, enough ascorbate was put in to re- 
duce the DCIP and to leave an excess of 
about 10%. Later, more ascorbate was 
usually added to keep the reduction rate 
at a convenient value. 

Calculations 

During a run of several hours with 
20-25 light exposures, the amount of dye 
oxidized by a standard exposure in- 
creased about 20% because of ascorbate 
depletion. The amount of dye oxidized at 
the dynamic equilibrium during the ex- 
posure was not linear with light intensity. 
Therefore, a single run, as with the DCIP 
reduction experiments, consisted of fre- 
quent exposures to (1) an intermediate 
intensity of a standard wavelength, 680 
nm; (2) a series of various intensities of 
this wavelength; and (3) a series of 
wavelengths adjusted in intensity to give 
responses within the range of the re- 
sponses to the standard wavelength. The 



S3 



2 - 



"I 1 ' r 



^ ■V H ti*^ 




iH*t^ 



dye oxidation level was monitored by 
light transmission at 593 nm iTig. 3j. 
The transmission change caused by ex- 
posure to the standard intensity at vari- 
ous times was used to correct all responses 
to a value equivalent to that at the start 
of the run. The corrected deflections for 
the standard wavelength of 680 nm were 
then plotted against intensity. From this 
curve (Fig. 4) the intensity of 680 nm 
needed to give a response equal to that 
obtained from each wavelength was 
determined. 

For the dye reduction experiments a 
computer program, ACTI5, was used to 
evaluate the action per unit of average 
actinic intensity in the vessel for all the 
exposures to the standard wavelength and 
to the experimental wavelengths. All 
calibration factors were included in the 
program. With the absorption spectrum 
of the green material for each run and 
with the dye absorption spectrum, it was 
possible to calculate from the measured 
transmission the average light intensity 
within the sample. The transmission was 
used to determine the dye concentration 



< 2 



12 3 4 

Time, min 

Fig. 3. Nostoc particles suspended in solutions 
of DCIP kept reduced to the colorless form by 
excess ascorbate will photooxidize some of the 
dye until a steady state is reached at a low 
concentration of oxidized dye. In this case the 
light effect is measured by the difference in 
level in the light and dark. Here extrapolation 
is not necessary because the dye returns to the 
colorless reduced state after the exposure. The 
light intensity is measured by the upper trace. 




Intensity, rel quanta min 

Fig. 4. The transmission change for various 
intensities of 680-nm hght. This curve is used 
to determine the intensity of 680 nm equivalent 
in action to the exposures for different wave- 
lengths. Very similar curves relate the rate of 
dye reduction to hght intensity. 



216 



CARNEGIE INSTITUTION 



at the middle of each light exposure. The 
response to a standard exposure decreased 
with time for the dye reduction experi- 
ments. Corrections for this effect were 
made either graphically or by use of the 
polynomial curve fitting program POLYR 
adapted to our computer by Ford and 
Brain. Similarly, either that program or 
graphical interpolation was used (plotting 
response versus intensity, as in Fig. 4) to 
calculate the intensity of the standard 
wavelength required to give the same 
response as that obtained from each ex- 
perimental wavelength. Thus completely 
comparable action responses were ob- 
tained for each wavelength within a 
single run of several hours. 

The action points were plotted against 
the fractional absorption of the green 
material used for each run. The action 
points were scaled to three fourths the 
height of the fractional absorption curve 
at its peak. This arbitrary scaling factor 



was a compromise between the theory 
that supposes all pigments to be active 
and another theory that assumes half 
the absorption at the peak to be inactive. 
Fortunately, the factor chosen has only a 
small effect on the final spectrum. The 
action points for each run were then 
transformed to active optical density by 
the relation, E' = logio (1/[1-A']). 
These tables of active optical density 
may then be scaled relative to each other 
without regard to the concentration of 
pigment in the separate experiments. It 
is important to note that the reasons for 
using active optical density rather than 
fractional absorbance in presenting ab- 
sorption spectra apply equally well to 
action spectra (French, 1977). 

Results 

The advantage of the steady-state 
measurements used in the photo-oxida- 



Q 
O 

> 

u 
< 



u 

c 
o 

_Q 



_Q 
< 





Numb 


er 


of poinfs for DC IP reduction: 












2 


3 





21 I52I3I525756 


5 


4 


8 7 


3 1 


I.O 


- 






/ 


^ 


V 




- 


0.9 


- 






//' 


■U 


\ 




- 


0.8 


- 






/ 


\ 


A 




- 


0.7 


- 






Absorption A 

o DCIP oxidation /' 




\ 

< 1 
J 


\ 


- 


0.6 


- 






—\- DCIP reduction /' 




\ 


\ 


- 


0.5 


- 






III 
// 
/ / 






» \ 
\ \ 

«r \ 


- 


0.4 


- 






1 i 






\ 

1 \ 
\ \ 
\ \ 


- 


0.3 


- 






y^^^ ^^^- ^ ' 






\ 
\ 

\ 

1 1 
\ 
\ 

\ 


y 


0.2 
0.1 


T 

4_ 


r 


o 


f^r\. .n silt half-widtti = 4nm 


>H 


o\ 

XV - 


r\ 




1 




1 1 1 1 1 1 1 


1 




1 


1 1 



600 



650 
Wavelength, nm 



700 



Fig. 5. The action .spectra for DCIP reduction with bars showing the standard deviation. The 
number of mea.suremont.s is indicated above. Points for DCIP oxidation are shown as circles. 
The ab.'iorption ."Spectrum of one preparation is given as a hne. The inactive absorption at 
shorter wavelengths is presumably due to some phycocyanin in the preparation. 



DEPARTMENT OF PLANT BIOLOGY 



217 



tion reaction can be seen by comparing slightly improved the fit of the action 
Figs. 2 and 3. In Fig. 3 the base line curve to the absorption. It therefore 
from which the light effect is measured is seems that the DCIP oxidation photo- 
located by the line through the transmis- reaction uses both pigment systems I and 
sion curves position both before and after II for the reaction and that system II is 
the exposure. The response can be easily perhaps slightly more effective than pig- 
evaluated from such data. ment system I for this reaction. 

For the reduction reaction, however, The deviation of both action spectra 



many averaged repetitions were needed. 
Figure 5 shows the number of determina- 
tions and their standard deviation as bars 



from the absorption curve in the 600-650 
region may have been caused by small 
amounts of inactive phycocyanin re- 



for each point on the DCIP reduction maining in the preparation, even though 

action spectrum. Superimposed is the it was more thoroughly purified than 

action spectrum for dye oxidation (cir- earlier preparations. The deviation of the 

cles), and the absorption spectrum for action spectra from the absorption be- 

one of the preparations is given as a line, yond 695 nm indicates some inactive ab- 

This unexpectedly close agreement may sorption in this region. The expected dif- 

be the result of MgCU facilitating energy ference on the long-wavelength side of 

transfer between pigments, possibly the peaks between what are supposed to 

through aggregation, so that the entire be typical system I and system II actions 

pigment system functions as a single are in the direction usually found in 

assembly. The differences in the two green plants. The great overlap between 

action spectra in the 600-650 region may the two actions is, however, not typical, 
be significant. The curve for DCIP re- 
duction appears to peak near 620-625, 
while the curve for its oxidation seems 
higher, at 625-635. 

The DCIP oxidation action spectrum 
nearly fits the entire absorption spectrum. 



References 

Binder, A., E. Tel-Or, and M. Avron, 
Eur. J. Biochem. 67, 187-196, 1976. 



Attempts to improve the fit by adding French, C. S., Photochem. and Photobiol. 

the two action spectra were not success- 25, 159-160, 1977. 

ful. Subtraction of about 7% of the Vernon, L. P., and W. S. Zaugg, J. Biol. 

DCIP reduction action curve, however, Chem. 235, 2728-2733, 1960. 



PHOTOSYNTHETIC ELECTRON FLOW FROM 
PHOTOSYSTEM II REQUIRES MEMBRANE-BOUND 

BICARBONATE 

Alan Stemler 



Bicarbonate ions, which are required 
for the photochemistry associated with 
photosystem II, are bound to chloroplast 
thylakoid membranes in two distinct 
pools (Stemler, Year Book 75, pp. 477- 
479; 1977). One site has a relatively high 
affinity for HCOs" and exists in a con- 
centration approximating that of the 
photosystem II reaction centers. More 
numerous lower-affinity sites also exist. 



Of the two binding sites, the high- 
affinity site is easier to characterize. Once 
HCOs" is bound to this site, it cannot be 
removed by repeated washes with buf- 
fered solutions at neutral pH. The amount 
of HCOa" bound to the large pool, on 
the other hand, diminishes with each 
washing, though trace amounts persist 
even after three washes. Washing away a 
large fraction of the HCOs" bound to 



218 



CARNEGIE INSTITUTION 



TABLE 1. Ability of Various Wash Media to Remove Bound H^COs" and Suppress 

Oxygen Evolution * 



Wash solution 



HCO.- 
Removed 
dpm-' Chi (% of 
X 10"' control) 



pinoles O2 mg ' Chi hr "' 



+HCO3- 
-HCO3- +HCO3- -HCO3- 



0.1 M sodium phosphate pH 7.0 

0.1 M XaCl 440 

0.3 M sucrose 

0.1 M sodium phosphate pH 5.0 

0.175 M XaCl 3 

0.1 M sodium formate 

lO-* M DCMU (added first) 

0.1 M sodium phosphate pH 5.0 249 

0.175 M XaCl 

0.1 M sodium formate 



control 



99 



44 



40.0 



2.6 



41.3 



38.7 



1.03 



14.9 



* The chloroplasts were charged with IP^COg" by suspension in 1 ml medium containing O.IM 
sodium phosphate pH 5.8, 0.2 M NaCl, 168 fiM NaH'^COs (1.2 ^ Ci) and 2 mg chl. After a 
5-min incubation at 30°C, 6 ml of ice-cold wash medium containing O.lAf sodium phosphate 
pH 7.0, 0.01 M XaCl, 0.3 M sucrose was added. After centrifugation the pellet was washed 
twice in 7 ml of the wash medium, then a third time in the medium indicated. The dpm were 
determined in the final pellet and portions were measured for oxygen-evolving ability in 
saturating light immediately after suspension in reaction mixture containing 0.1 M sodium 
phosphate pH 7, 0.175 M NaCl, 0.1 M sodium formate, 2 mM K3Fe(CN)6, 50 ^g Chl m\-\ 
Initial rates were measured before and after injection of NaHCOs to 12.5 mM. 



low-affinity sites does not induce de- 
pendence of oxygen evolution on added 
HC03~. This result indicates either that 
the large pool of binding sites is not in- 
volved at all in photochemical events or 
that only a very small fraction of the 
low-affinity sites need to be occupied with 
HCOo" at any given time. 

The role of HCOa" bound in the small 
high-affinity pool is more evident. Chlo- 
ropla.-t membranes were depleted of 
HCO-i" (see Stemler and Radmer, 1975, 
for details), then provided with enough 
i^C-labeled HCO," to refill the small 
pool. They were then washed several 
times in buffered solution, pH 7, to re- 
move all ''trapped" Hi^CO.-. Such chlo- 
ropla.sts require no added HCO.s" for full 
oxygen-evolving activity (Table 1, top 
line). If such chloroplast membranes are 
washed once in "HCO.^" depletion me- 
dium" containing high salt concentra- 
tions and buffered at pH 5, all the bound 
H^'^COa" is removed and oxygen evolving 



capability is reduced to a trace (Table 
1, line 2). Adding back HCOa" then 
stimulates oxygen evolution 15-fold. This 
result shows clearly that the depletion 
procedure does in fact remove membrane- 
bound HCOs" and that this bound anion 
is needed for maximum photosystem II 
activity. If the inhibitor 3-(3,4-dichlo- 
rophenyl)-l, 1-dimethylurea (DCMU) 
is given to the chloroplasts before they 
are suspended in depletion medium, the 
removal of bound HCOs" is retarded 
(Table 1, line 3). This inhibition sug- 
gests that the DCMU binding site and 
the HCOs" binding site are very close. 
The effect of light on high-affinity 
bound HCOs" is of interest as a clue to 
the mechanism of action of this ion. 
Chloroplast grana were labeled with 
H^'^COa", then washed several times to 
remove "trapped" H^^COs". They were 
then illuminated in the presence of ferri- 
cyanide while oxygen evolution was mon- 
itored. At various times, aliquots of the 



DEPARTMENT OF PLANT BIOLOGY 



219 



0.5 




8 12 

Time of illuminafion, min 



- I 



I 

o 

X 

3 2 



2 e 

a 







Fig. 6. Loss of tightly bound H^COa from chloroplasts during oxygen evolution. Chloroplasts 
were charged with H^COs" as explained in the legend of Table 1. After a third washing the 
grana were suspended in reaction mixture containing 0.1 M sodium phosphate pH 7.0, 0.01 M 
NaCl, 0.3 M sucrose, 0.01 M K3Fe(CN)6, 162 ^g chl ml"\ then illuminated. At times indicated, 
1 ml of the reaction suspension was withdrawn from the illumination chamber, centrifuged, and 
the pellet measured for bound HCOs". 



cyanide while oxygen evolution was mon- 
itored. At various times, aliquots of the 
reaction mixture were withdrawn and 
centrifuged; the grana-containing pellet 
was then assayed for bound H^^COs". 
Results are shown in Fig. 6. Chloroplasts 
that were illuminated for 18 minutes 
gave off oxygen continuously, though at 
a decreasing rate. At the same time only 
about a third of the bound HCOs" was 
lost from the thylakoid membranes. The 
same result was observed when unlabeled 
HCOa" was added to the reaction mix- 
ture until a final concentration of 20 mM 
was reached. This result indicates that 
bound HCOs" does not exchange with 
free HCOs" in the course of oxygen evo- 
lution. Instead, the single ion bound to 
the photosystem II reaction center com- 
plex remains in place while hundreds of 
molecules of oxygen are evolved. The 
fraction of bound HCOs" which was lost 



during illumination may reflect non- 
specific membrane damage. Another pos- 
sibility is that the lost HCOs" represents 
HCOs" that was bound in the low- 
affinity pool and managed to survive the 
wash treatment used before illumination 
to remove trapped HCOs". If the second 
possibility holds true, it would imply that 
the low-affinity HCOa" binding sites may 
also play a role in the photosystem II 
reaction. 

Further characterization of the two 
pools of bound HCOs" is in progress. 



References 

Stemler, A., Biochim. Biophys. Acta 460, 

511-522, 1977. 
Stemler, A. and R. Radmer, Science 190, 

457-458, 1975. 



220 



CARNEGIE INSTITUTION 



THE EFFECT OF TEMPERATURE ON THE PHYSICAL PHASE 

OF CHLOROPLAST MEMBRANE LIPIDS AND 

PHOTOSYNTHESIS 



David C. Fork, Norio Murata, and Mordhay Avron 



Introduction 

These studies and those reported in the 
hist two Year Books seek a better un- 
derstanding on the molecular level of 
the influence of temperature on photo- 
synthesis. 

The photosynthetic apparatus that 
converts solar energy to chemical energy 
is located in lamellar lipoprotein struc- 
tures that constitute the chloroplast thy- 
lakoid membrane. One model (for a 
re\iew, see Anderson, 1975) views the 
chloroplast thylakoid membrane as a 
lipid bilayer containing embedded pro- 
teins and certain molecules involved in 
the bioenergetic process such as the chlo- 
rophylls, quinones, various cytochromes, 
and carotenoids. Membrane lipids can be 
tightly bound to the outer layers of 
embedded proteins or can act with one 
another to form a fluid bilayer through 
which the lipid molecules can move 
laterally (Jost et al., 1973; Tralible and 
Overath, 1973; Dehlinger et al, 1974). 

In earlier studies we found that at the 
temperature of transition of the physical 
phase of membrane lipids from the liquid 
crystalline to the phase-separation state 
there appeared characteristic changes of 
photosynthetic electron transport {Year 
Book 74, 766-776; Murata et al, 1975; 
Fork and Murata, 1977). 

In the present studies we report phase 
changes of thylakoid membrane lipids in 
chilling-resistant plants such as spinach 
at sub-zero temperatures and, by con- 
trast, in the extreme thermophilic blue- 
green alga Synechococcus lividus where 
phase changes were seen at the highest 
temperatures f43''C) so far observed for 
a photosynthetic organism. 

In studies of the temperature depend- 



ence of the light-induced spectral shift 
in carotenoids and of proton uptake and 
efflux using the fluorescent indicator 9- 
aminoacridine, we found that diffusion 
of ions through thylakoid membranes is 
greatly affected by the physical phase of 
membrane lipids and that the membrane 
becomes leaky to the ions below the phase 
transition temperature. 

Lipid Phase Changes in Lettuce and 

Spinach Chloroplasts at Sub-Zero 

Temperatures 

Norio Murata and David C. Fork 

We have shown in our previous studies 
that fluorescence is a convenient tool to 
detect the transition of the physical phase 
of thylakoid membrane lipids in photo- 
synthetic material (Murata and Fork, 
1975; Murata et al, 1975; Fork and 
Murata, 1977). A maximum or positive 
shoulder in the fluorescence-versus-tem- 
perature curve indicates the occurrence 
of a phase transition. 

Except for the desert plant Tidestromia 
oblongifolia (Murata and Fork, 1977) no 
maxima were found in higher plant chlo- 
roplasts above 0°C (Murata and Fork, 
1975). In this study we present the 
fluorescence-versus-temperature curves 
for lettuce and spinach chloroplasts from 
about 5°C to — 35°C. 

To prevent freezing of the reaction 
mixture we added ethylene glycol to 
make a concentration of 50%. This con- 
centration partly inhibits the Hill re- 
action using 2,6-dichlorophenol indo- 
phenol (Inoue and Nishimura, 1971) and 
will protect against freezing down to 
about -35°C (Cox, 1975). 

Figure 7 shows the temperature de- 



DEPARTMENT OF PLANT BIOLOGY 



221 



100 



U 90 



80 - 



-31° -25° 
I I 



,(c) + 100 mM KCI 



/" 



(b) + 5 mM MgCl2 




(a) + 5 mM NaCI 



-50 -40 -30 -20 -10 

TEMPERATURE, °C 



10 



Fig. 7. Temperature dependence of chloro- 
phyll a fluorescence in chloroplasts of lettuce 
grown at 25 °C, (a) The suspension medium 
consisted of a mixture of ethylene glycol and 
water (50:50 v/v) that contained 200 mM 
sucrose, 5 mM NaCl, 1 mM sodium ascorbate, 
5 X 10"' M DCMU, and 5 mM Tricine-NaOH 
buffer, pH 7.4, (b) plus 5 mM MgCL, (c) plus 
100 mM KCI. Excitation light: 435 nm, 500 ergs 
cm"^ sec"^. The fluorescence was measured at 
685 nm. Temperature was lowered at a rate of 
rC/min. 

pendence of steady-state chlorophyll a 
fluorescence in chloroplasts isolated from 
lettuce grown at 25°C. At a low mono- 
valent cation concentration (5 mM Na + ) 
the fluorescence maximum appeared at 
— 11°C. Addition of 5 mM Mg++ or 100 
mM K+ lowered the maximum tempera- 
ture to — 31C° or — 25 °C, respectively. 







1 1 

-31° 

1 






1 1 


100 


— 


1 


>» 




— 






-20° 

1 




V 


(b) + 5 mM MgCl2 


90 
an 




1 1 






(a) + 5 mM NaCI 
1 1 



-40 -30 -20 -10 

TEMPERATURE, °C 



10 



Fig. 8. Temperature dependence of chloro- 
phyll a fluorescence in spinach chloroplasts in 
the presence of 5 mM NaCI or 5 mM MgCh. 
The experimental conditions were the same as 
in Fig. 7. 



Figure 8 shows the temperature de- 
pendence of chloroi)hyll a fluorescence in 
spinach chloroplasts. In the presence of 
5 mM Na+ the maximum appeared at 
— 20^0 and in the presence of 5 mM 
Mg++ it appeared at — SrC. 

A maximum in the temperature-versus- 
fluorescence curve indicates a transition 
of the physical phase of thylakoid mem- 
brane lipids. The curves obtained using 
lettuce or spinach chloroplasts are very 
broad when compared to those obtained 
from Anacystis nidulans (Murata and 
Fork, 1975; Murata et al, 1975) or for 
Synechococcus lividus (next article), for 
example. This indicates that the phase 
transition of membrane lipids in higher 
plants occurs over a broad range of tem- 
peratures. In addition, the temperature 
of the phase transition and perhaps mem- 
brane fluidity are greatly influenced by 
the presence of divalent cations and by 
higher concentrations of monovalent 
cations, at least in higher plants. 

We used thylakoid membrane prepara- 
tions of Anabaena variabilis and an arti- 
ficial membrane preparation of dimyris- 
toyl lecithin to see if the addition of 
50% ethylene glycol had an influence on 
the phase transition of membrane lipids 
under conditions in w^hich the phase 
transition occurred above freezing tem- 
peratures. Figure 9 shows that the maxi- 
mum in the fluorescence-to-temperature 
curve appeared at 10°C either with or 
without ethylene glycol added. This con- 
centration of ethylene glycol increased 
the absolute fluorescence yield by about 
20%, but had no effect on the phase 
transition between the liquid-crystalline 
and the phase-separation states. 

In a water suspension of dimyristoyl- 
phosphatidylcholine the fluorescence yield 
of l-anilinonaphthalene-8-sulfonic acid 
(ANS) decreased drastically at 23°C 
with and without ethylene glycol. The 
same temperature dependences were ob- 
served when the temperature was de- 
creased or increased. This dramatic 
fluorescence change is known to occur at 
the phase transition between the liquid- 



222 



CARNEGIE INSTITUTION 







10° 


I 1 




100 


y 


1 


50% EG 
50% WATER 




90 




1 






^ 




1 


WATER 
1 1 


- 



-10 



10 20 30 

TEMPERATURE °C 



40 



Fig. 9. The effect of ethylene glycol on the 
temperature curve of chlorophyll a fluorescence 
in a thylakoid membrane preparation of 
Anahaena variabilis (strain M3) that was grown 
at 33 'C. The fluorescence yields for each curve 
were measured using the same sensitivities. The 
suspension medium with and without 50% 
ethylene glycol contained 200 mM sucrose, 5 
mM XaCl, 1 m.V sodium ascorbate, 5 X 10'^ 
M DCMU, and 5 mM Tricine-XaOH buffer, 
pH 7.2. The experimental conditions were as 
described for Fig. 7. 



crystalline and the gel states (Traiible, 
1971: Oldfield and Chapman, 1972), and 
it appears that 50% ethylene glycol has 
no effect on this change. The absolute 
fluorescence yield decreased to about one 
fourth after addition of ethylene glycol. 
This decrease may be caused by a change 
in the partitioning of ANS between the 
membrane lipid and the water phase 
when the aqueous phase contains ethyl- 
ene glycol. 

It is clear that 5 mM Mg++ and 100 
mM K^ shifted the phase transition to 
lower temperatures. This suggests that 
the phase transition and perhaps mem- 
brane fluidity are markedly affected by 
these cations. Cations exert striking 
effects on lipid phase transitions in model 
membranes (van Dijck et al, 1975; 
Onishi and Itoh, 1974). In this case, 
however, the cations produce effects 
opposite from those seen with chloro- 
plasts. In may be that cations interact in 
thylakoid membranes with negatively 



charged lipids such as sulfoquinovosyldi- 
glyccride, phosphatidylglycerol and phos- 
phatidylinositol, and so affect the cluster- 
ing of these lipids, thereby influencing the 
transition of the physical phase of mem- 
brane lipids. 

Studies on the Effect of Transition 

OF THE Physical Phase of Membrane 

Lipids on Electron Transport in the 

Extreme Thermophile 

Synechococcus lividus 

David C. Fork and Norio Murata 

As mentioned in the previous article, 
the fluorescence of chlorophyll a in vivo 
is a convenient probe to detect transitions 
of the physical phase of thylakoid mem- 
brane lipids in photosynthetic material. 
Using this technique, we measured for a 
number of photosynthetic organisms 
phase transition temperatures ranging 
from below zero for spinach or lettuce 
chloroplasts (previous article) to around 
24°C in the blue-green alga Anacystis 
nidulans grown at 38 °C (Murata and 
Fork, 1975; Fork and Murata, 1977; 
Year Book 75, 465-472). We used the 
blue-green alga Synechococcus lividus, 
w^hich is capable of growing at the high- 
est temperature (73-75°C) of any photo- 
synthetic organism known (Kempner, 
1963; Brock, 1967; Castenholz, 1969). 
This extreme thermophile is found in 
alkaline hot springs where it often grows 
abundantly. 

We measured phase transitions for 
these algae grown at various tempera- 
tures and found significant alterations in 
the rates of photosynthetic electron trans- 
port above and below these phase transi- 
tion temperatures. 

The cultures of Synechococcus lividus 
used for these experiments were obtained 
through the courtesy of Dr. Richard W. 
Castenholz of the Biology Department 
of the University of Oregon and Dr. 
Mercedes R. Edwards of the New York 
State Department of Health. All of the 
cultures were grown in D-medium 
(Castenholz, 1969) at the desired tern- 



DEPARTMENT OF PLANT BIOLOGY 



223 



perature with a gas phase of 0.5% CO2/ 
air in bubble tubes fitted with condensers 
to retard evaporation. The intensity of 
the tungsten Hght used for growth was 
about 5000 lux. The measurements of 
fluorescence versus temperature were per- 
formed as described previously (Murata 
and Fork, 1975). Electron transport was 
followed by measuring redox changes of 
cytochrome / at 420 nm. The outputs of 
the photomultiplier that measured the 
absorption change, of the thermocouple 
that measured temperature in the cuvette, 
and of the photocell that monitored light 
intensity were all amplified and trans- 
mitted to an analog-to-digital converter 
that digitized the signals at intervals 



appropriate to tlic needs of the experi- 
ment. The digitized values were then 
stored and analyzed by a Hewlett- 
Packard 2116 computer such that the 
desired on or off rates or the steady-state 
values of absorption changes, tempera- 
ture, and light intensity could all be 
obtained and displayed during an experi- 
ment in which temperature was decreased 
or increased at rates of about 1°C per 
minute. 

Measurements of the fluorescence of 
chlorophyll a as a function of tempera- 
ture were all done in the presence of 10 
ixM DCMU [3-(3,4-dichlorophenyl)- 
1,1-dimethylurea] to inhibit electron 
transport. Figure 10 shows the tempera- 



— I 1 1 1 1 1 r 

Synechococcus lividus 



Grown af 65 °C 




45 °C 



Temperature, °C 



Fig. 10. Temperature dependence of chlorophyll a fluorescence in Synechococcus lividus 
grown at 65°, 60°, 55°, and 45°C. Fluorescence was excited at 435 nm (400 ergs cm~- sec~^) and 
measured at 685 nm in the presence of 10 fiM DCMU as described previously {Year Book 75, 
pp. 465-^72). The cells grown at 65°C were strain OH68-S, Clone HXf (Meeks and Castenholz, 
1971). Those grown at 60°, 55°, and 45°C were strains SY-2, SY-4 and SY-3, respectively, 
obtained from Dr. M. Edwards. 



224 



CARNEGIE INSTITUTION 



ture-versus-fluorescence curves for cells 
of Synechococcus lividus. The maxima, 
or shoulders, in these curves mdieate 
transitions of the physical phase of 
thylakoid membrane lipids. It can be 
seen that upon decreasing and then in- 
creasing the temperature of cells grown 
at 65 ^\ 60 "\ and 55 °C the maximum or 
shoulder occurred at about 43^C. The 
maximum could be seen for several cycles 
of temperature increase and decrease. 
Cells grown at 45^C had broad maxima 
in their temperature-to-fluorescence 
curves ranging from 18° to 23°C. Upon 
increasing temperature a second shoulder 
or maximum appeared at 53° and 45 °C 
in cells grown at 55° and 45°C respec- 
tively. These maxima do not correspond 
to a lipid phase transition, since they 
were not observed on decreasing the 
temperature. 

In the photosynthetic electron trans- 
port system of a blue-green alga like 
Synechococcus the electron carriers such 
as plastoquinone, cytochrome /, and P700 



are oxidized upon excitation of system I 
and reduced by illumination in pigment 
system II (Amesz and Duysens, 1962; 
Amesz, 1964; Murata and Takamiya, 
1969). To observe the effect-of the transi- 
tion of the phase of membrane lipids on 
electron transport reactions, the oxida- 
tion-reduction reactions of cytochrome / 
were measured at various temperatures. 
Cells were illuminated with high- 
intensity red actinic light having wave- 
lengths longer than 620 nm; the light 
was absorbed by both pigment systems. 
Absorbance changes produced by cyto- 
chrome / (and partly by P700) were 
measured at 418-420 nm near the Soret 
maximum for cytochrome /. Light-minus- 
dark difference spectra at 55°C showed 
the characteristic shape produced by 
light-induced oxidation of cytochrome / 
and had a maximum near 405 nm and 
minima at 422 and 554 nm. A shoulder 
around 433 nm, produced by P700, was 
also visible. 
Figure 11 shows examples of the 



e 

c 
00 



0) 
u 

c 
o 

JQ 



JQ 
< 




Fig. 11. Kinetics of light-induced ab.sorbance changes at 418 nm in cells of Synechococcufi 
lividu.s grown at 55''C and measured at 53% 34°, and 22''C. Half-bandwidth of the measuring 
beam was 2 nm. Red actinic liglit with wavelengths from 620 to 750 nm was obtained with glass 
optical filters, Schott RG2 and Calflex C, and had an intensity of 1.8 X 10' ergs cm'" sec"'. 



DEPARTMENT OF PLANT BIOLOGY 



225 



kinetics of absorbance changes at 418 nm 
measured at 53°, 34°, and 22 °C for 
Synechococcus cells grown at 55°C. Upon 
illumination with bright red light, a 
rapid oxidation (absorbance decrease) 
was seen. This was followed by a rapid 
transient reduction of the oxidized cyto- 
chrome in the light and then by a second 
and slower oxidation that reached a 
steady-state level during continued illu- 
mination. Prompt reduction of cyto- 
chrome / took place when the actinic 
illumination was turned off. Electrons 
originating from the reduced plasto- 
quinone produced by exciting system II 
with high-intensity red light appear to be 
responsible for the transient reduction of 
cytochrome / observed during illumina- 
tion, since this transient reduction was 
inhibited by DCMU and was not seen 
with far-red actinic light, which excites 
only system I. Both the transient reduc- 
tion of cytochrome / in the light and its 
reduction in the dark were temperature- 
sensitive (Fig. 11). 



50 



Tempera+ure, C 

40 30 



c 
.9 

u 



o 



100 



30 



10 



o - o 
4.6 kcal/mol 




8.4 kcal/mol 



3.1 



3.2 



3.3 



3 0,y-[ 



l/T X 10 . "K 



Fig. 12 Arrhenius plot of cytochrome / reduc- 
tion measured at 420 nm after turning off red 
actinic light (described in Fig. 11) in intact cells 
of Synechococcus lividus grown at 55°C. Light 
and dark periods used were 16 and 4.3 sec, 
respectively. Temperature was lowered from 
51° to 33° C at a rate of about TC/min. 



Figure 12 shows the temperature de- 
pendence of the dark reduction of cyto- 
chrome / after cells grown at ^o(^ wore 
illuminated with red actinic light. The 
graph gives a fairly straight line with 
an abrupt change in slope at 43'^C, near 
the phase transition temperature. The 
activation energies above and below the 
break point are 4.6 and 8.4 kcal/mole, 
respectively. Meeks and Castenholz 
(1971) found a break near 43 "^C in the 
Arrhenius plots for photosynthesis meas- 
ured as photoincorporation of ^^C- 
NaHCOs by Synechococcus lividus cul- 
tures grown at temperatures above 60°C. 

The temperature dependence for the 
transient reduction of cytochrome / dur- 
ing the light exposure was measured. The 
time required in the light for the transient 
to change to one fourth of its initial 
extent was set as the standard for the 
relative rate of electron transport from 
plastoquinone to cytochrome /. A single 
sample of cells grown at 55 °C was first 
cooled from 54°C to about 33°C and 
then heated again to about 57°C; and 
relative rates of cytochrome / reduction 
in the light were determined. The 
Arrhenius plot (Fig. 13) shows that the 
points clustered along two straight lines 
that intersected at 43 °C — the phase 
transition temperature as determined 
by the temperature-versus-fluorescence 
measurement. The activation energies 
above and below the break point fol- 
lowed each other with about the same 
activation energies. Above the break 
point, however, the slopes of the lines 
were lower than before (2.3 kcal mol~^ 
on initial cooling; —3.4 kcal mol~^ upon 
rewarming). This decrease may result 
from damage to the thylakoid mem- 
brane when the temperature was low- 
ered. The ''chilling" of the cells to 33°C 
may have resulted in a lower rate of 
electron transport when the temperature 
was raised again. A similar result was 
obtained (Murata et a/., 1975) with 
Anacystis grown at 38°C, cooled to 6°C, 
and heated again to 33 °C. A second 
break occurs at 53 °C near the growth 



226 



CARNEGIE INSTITUnON 



Temperature, C 



SO 

30 n r- 




3.3 



l/T X 10^, °K" 



Fig. 13. Arrheniiis plot of the transient reduction of cytochrome / measured at 420 nm 
during a period of red actinic ilhimination (described in Fig. 11) in intact cells of Synechococ- 
cus Uvidus gro\\Ti at 55° C. The time for the transient seen immediately after illumination to 
decay to one fourth of its initial value was taken as the relative rate of electron transfer from 
photosA'stem II to cytochrome /. One sample of cells was used for the experiment and was first 
cooled and then heated at rates of about l°C/min. Cycles of 0.3 sec light and 10 sec dark 
were used. 



temperature for the cells. Above this 
temperature the rates drop significantly. 

Transitions of the physical phase of 
the membrane lipids produce significant 
alterations in photosynthetic electron 
transport (Shneyour et al, 1973; Murata 
et al, 1975; Fork and Murata, 1977), in 
the state 1 to state 2 shift (Murata et al., 
1975), in the intensity of delayed fluores- 
cence (Ono and Murata, 1977) , in mem- 
brane permeability to nonelectrolytes 
(Nobel, 1974), and in the light-induced 
production of a membrane potential (fol- 
lowing articles). The change in the rate 
of cytochrome / reduction coresponding 
to a transition of the phase of membrane 
lipids suggests that, as with Anacystis 
(Murata et al., 1975), the part of photo- 
synthetic electron transport involving 
participation of the lipophilic molecules 
of plastoquinone is significantly affected 
by change.- in the phase of thylakoid 
membrane lipids. 

The.se studies indicate that the preser- 
vation in the thylakoid membranes of 
the proper physical state of the lipids is 



a requirement for efficient photosynthetic 
function and that many organisms are 
flexible and able to achieve this state 
even if their growth temperature is 
changed. 

Acknowledgments 

We are indebted to Mr. Glenn A, Ford, 
who wrote the programs and helped in- 
terface the apparatus to the computer 
system, and to Mr. Benny Catanzaro, 
who designed and built electronic com- 
ponents used in these experiments. 

The Light-Induced Carotenoid Shift 

IN Cyanidium and in Higher Plant 

Leaves as an Indicator of Phase 

Changes in Chloroplast 

Membrane Lipids 

Norio Murata and David C. Fork 

In this study we investigated the tem- 
perature dependence of the light-induced 
spectral shift of carotenoids in an at- 
tempt to demonstrate an effect of the 



DEPARTMENT OF PLANT BIOLOGY 



227 



physical phase of membrane lipids on the 
production of a membrane potential and 
on the permeability of the membrane to 
ions. 

The absorbance changes that are seen 
near 520 nm (positive) and 475 nm 
(negative) upon illumination of higher 
plants and green algae appear to be pro- 
duced by a spectral shift of photosyn- 
thetic pigments (mainly ^-carotene) in 



the thylakoid membranes (Pv,eich ('A al., 
1976; Kleuser and Biichen, 1969; Amesz 
and Visser, 1971). Light-induced absorb- 
ance changes with three maxima and 
minima, principally due to a spectral 
shift of carotenoids, have been observed 
in several classes of algae. Similar ab- 
sorbance changes are also seen in isolated 
higher plant chloroplasts (Weikard et aL, 
1963; Wakamatsu and Nishimura, 1974 j. 



O 



O 

C 



SI 

l_ 

o 

_Q 
< 



T 1 1 1 1 r 



405 



"T I I 1 1 r- 

Measured at 31 °C 




400 



450 500 

Wavelength, nm 



550 



Fig, 14. Light-minus-dark difference spectra measured at 31° and 9°C in intact cells of 
Cyanidium caldarium grown in Allen's (1959) medium at 38° C. The half -bandwidth of the 
measuring beam was 2 nm. Red actinic light with wavelengths from 630 to 750 nm was obtained 
by filtering white light through optical filters. Filters used were Schott RG2, 3 mm and Calflex 
C and 37 mm of water. The light had an intensity of 1.8 X 10^ ergs cm"" sec"^. Far-red light 
was obtained in the same way after substituting Corning glass CS 2-64 for RG2 and had an 
intensity of 1.3 X 10^ ergs cm"^ sec"^ in a band from 650 to 750 nm. The absorbance difference 
was between the levels in the light after 1 sec of actinic illumination and the level in the dark 
1.6 sec after turning off the actinic illumination. 



228 



CARNEGIE INSTITUTION 



Although the unicellidar alga Cya- 
nidium caldarium resembles a blue-green 
alga in its preponderance of the chromo- 
protein pigment c-phycocyanin. its mor- 
phological and cytoplasmic organization 
is more like that of a red alga (Doemel 
and Brock. 1971 K Figure 14 shows that 
the light-minus-dark difference spectra 
measured for this organism are not unlike 
those obtained using other red algae 
(Fork and Amesz. 1967), since they have 
positive peaks at 450, 483, and 515 nm 
and negative peaks at 433, 465, and 500 
nm. These reversible alternating positive 
and negative peaks, each separated by 
about 33 nm, can be attributed to a light- 
induced shift of the absorption spectrum 
of carotenoids to longer wavelengths in 
the light, followed by a reversal in the 
dark. The difference spectra of Fig. 14 
also show a reversible light-induced 
oxidation of cytochrome /, with negative 
peaks at 554 and 420 nm and a positive 
peak near 405 nm. 

At low temperatures the dark decay of 
the absorbance change produced by the 
carotenoid shift was composed of both a 
fast and a slow component. The decay 
rates of the slow component were plotted 
in Fig. 15. In this experiment the recipro- 
cals of the half-decay time were taken 
as representing the decay rates even 
though the dark decay did not follow 
perfect first-order kinetics. The Arrhenius 
plots followed essentially the same line 
upon decreasing or increasing the tem- 
perature. A break in the line appeared 
at 8''C. This temperature corresponds to 
the temperature of phase transition in 
Cyanidium, using chlorophyll a fluores- 
cence measurements ( Year Book 75, 465- 
472 1. The apparent activation energies 
above and below the 8°C break point 
were 11 and 40 kcal/mole, respectively. 

The desert plant Tidestromia oblongi- 
John grows at high temperatures (^ 
50^C) in Death Valley, California {Year 
Book 70^ 540-550) . For measurements of 
fluorescence versus temperature we used 
chloroplasts extracted from Tidestromia 
collected one summer morning in Death 



Tempera+ure, C 



40 


30 


20 




10 


30 


4 


\ 


1 


^ 


1 


10 






-tY 


A^ 


\ 


3 

1 


1 


1 


1 




1 1 



3.2 



3.4 



3.6 



3 0,y-\ 



l/T XIO'', °K 



Fig. 15. Arrhenius plot of the decay kinetics 
of the slow component of the light-induced 
carotenoid change measured at 483 nm in C. 
caldarium. Reciprocals of the half-decay times 
were taken as representing decay rates. Open 
circles indicate decreasing temperature; open 
triangles, increasing temperature. Red actinic 
light was used, as described in Fig. 14. Re- 
peated hght and dark periods were 4.0 and 4.2 
sec, respectively. 



Valley and used the same afternoon. With 
this preparation we found a shoulder or 
in some cases a maximum around 5°C 
in the fluorescence-versus-temperature 
curve (data not shown). Previously 
(Murata and Fork, 1975; Year Book 7l, 
766-776) we had not seen such a break 
in the fluorescence-to-temperature curve, 
possibly because the plants used in those 
experiments were cultivated in a growth 
cabinet at temperatures below those 
found in the native environment. 

Figure 16 shows the Arrhenius plot 
of the dark decay of the slow component 
of the 520-nm change (carotenoid change) 
in a leaf of T . oblongifolia. The points 
obtained upon decreasing and increasing 
the temperature followed the same line. 
At 5°C a clear break in the line was 



DEPARTMENT OF PLANT BIOLOGY 



229 



Temperafure, C 
30 20 10 




l/T XIO^ °K 



Fig. 16. Arrhenius plot of the decay kinetics 
of the slow component of the absorbance change 
at 520 nm in a leaf of Tidestromia oblongifolia. 
The plant used for these measurements was 
collected during the summer growing season in 
Death Valley, California. Reciprocals of the 
half-decay time were taken as representing the 
decay rates. Open circles are used for decreasing 
temperature ; open triangles, for increasing 
temperature. Repeated cycles of 5.1 sec of red 
light (described in Figure 14) and 7.4 sec dark- 
ness were used. 



seen. Thi.s temperature corresponds to 
the phase-transition temperature de- 
tected by the fluorescence measurement 
mentioned above. The apparent activa- 
tion energies above and below 5C were 
11 and 30 kcal/mole, respectively. As 
with Cyanidium, the decay below the 
break point was composed of both a fast 
and a slow component. The rates for the 
slow component were used to plot Fig. 16. 

Raison (1973), using spin labels with 
isolated chloroplasts from chilling-sensi- 
tive plants, has found that a phase transi- 
tion occurs around 10°C in plants such 
as bean and tomato; but no such transi- 
tion was seen in chilling-resistant plants 
such as pea or lettuce. We therefore 
compared the temperature dependence of 
the 520-nm change in the chilling-sensi- 
tive plants bean and tomato with the 
temperature dependence of this change 
in chilling-resistant plants such as spinach 
and lettuce. 

Figure 17 compares the kinetics of the 
520-nm change in tomato and lettuce 
leaves at various temperatures. In the 
tomato leaf the kinetics of absorbance 
change during light exposure varied re- 



A Ac,. 0.01 



Tomafo 25 °C 




Le+tuce 



16 "C 



7°C 



4°C 





t I 

On Off 



t i 



t I 



t i 



T 



AA5200.002 

1 



Fig. 17. Time courses of light-induced absorbance changes at 520 nm at different tempera- 
tures in a tomato leaf grown at 25°C (upper part) and in a lettuce leaf grown at 15"C (lower 
part). Repeated cycles of red light (described in Figure 14) and darkness were 5.0 and 7.5 sec, 
respectively, for tomato and 3.5 and 9.0 sec, respectively, for lettuce. 



230 



CARNEGIE INSTITUTION 



markably depending upon the tempera- 
ture. However, the height of the initial 
rise produced upon onset of actinic iUu- 
mination was virtually unaffected by 
changing the temperature. At 2°C and 
also at 4~"X the increase of the second 
slow phase of the 520-nm change dis- 
appeared. 

The lower part of Fig. 17 illustrates 
absorbance changes at different tempera- 
tures in a leaf of lettuce grown at 15°C. 
By contrast to the tomato leaf, the time 
courses were not so markedly affected by 
changing the temperature. The second, 
slow increase during light exposure could 
still be seen at 4°C. We saw the same 
tendency in the temperature dependence 
of the time courses of the 520-nm change 
in a lettuce leaf grown at 25 °C and in 
market spinach leaves. 

Figure 18 shows Arrhenius plots of 
the dark decay of the 520-nm change in 
tomato leaves grown at 15° or 25 °C. A 
discontinuity point was found at about 
lO^'C in the leaf grown at 15°C, and a 
new slope began at about 12°C in the 
leaf grown at 25°C. In a leaf grown at 
35°C. the break appeared at 13°C (not 
shown in the figure). 



50 
40 

30 
20 



30 



10 



3.3 



Tempera+ure, C 
20 10 




3.4 3.5 

l/T X 10^ "K"' 



3.6 



Fig. 19. Arrhenius plots of the dark decay of 
the absorbance change at 520 nm in leaves of 
lettuce grown at 15° and 25 °C and in a spinach 
leaf. Reciprocals of the half-decay time were 
taken as representing the decay rates. Arrows 
indicate the direction of temperature change. 
Experimental conditions were as described for 
lettuce in Figure 17. 




I/T X 10^. °K" 



Fig. 18. Arrhenius plots of the dark decay of 
the absorbance change at 520 nm in leaves of 
tomato grown at 15'" and 25'C. Reciprocals of 
the half-decay time were taken as representing 
the decay rates. Mea.surements were done by 
decrea.sing the temperature. Experimental con- 
ditions were a.s described for tomato in Figure 
17. 



A break was seen for a bean leaf at 
15°C for both directions of temperature 
change, although the two sets of lines 
did not conform to each other. 

Figure 19 shows the Arrhenius plots of 
the dark decay of the 520-nm change in 
leaves of lettuce grown at 15° and 25°C 
and in a spinach leaf. There were no 
breaks in these lines. 

The light-induced absorbance change 
at 483 nm in Cyanidium and the 520-nm 
change in leaves of higher plants appear 
to be due to an electrochromic shift 
mainly of carotenoids (Reich et al., 1976; 
Junge and Witt, 1968; Graber and Witt, 
1976). After a fairly long period of illu- 
mination (seconds), the spectral shift in- 
duced in carotenoids is produced mainly 
by ion gradients established by the influx 
of H+ from the outer medium to the 
inner space of the thylakoid (Jackson 



DEPARTMENT OF PLANT BIOLOGY 



231 



and Crofts, 1969; Okada and Takamiya, 
1970; Strichartz and Chance, 1972; N(3U- 
mann and Jagendorf, 1964; Schuldiner 
et al., 1972, 1973). The dark decay of 
the carotenoid absorbance changes seems 
to be correlated with the dissipation of 
the ion gradient previously established 
across the thylakoid membrane in the 
light. In intact cells and leaves the dark 
decays were rapid (about 100 msec) com- 
pared to a 10-second decay rate seen in 
isolated chloroplasts (Wakamatsu, et al., 
1974) . The more rapid decay in the intact 
material is probably a reflection of a 
close coupling of phosphorylation to the 
dissipation of the ion gradient. 

The breaks or the changes in the ap- 
parent activation energies of the slow 
decay component of the carotenoid change 
seen in the Arrhenius plots in Cyanidium, 
Tidestromia, and tomato suggest that 
the coupling of electron transport to 
phosphorylation is affected by a phase 
transition in the membrane lipids. This 
is supported by a recent finding of Ono 
and Murata (unpublished) that a clear 
break appears at the phase transition 
temperature in the Arrhenius plot of pho- 
tophosphorylation in thylakoid membrane 
preparations of Anacystis nidulans. 

Acknowledgments 

We are grateful to Drs. Joseph A. 
Berry and Olle Bjorkman and to Mr. 
Jim Johnson, who provided the growth 
cabinets and assisted in growing the let- 
tuce and tomato plants. Dr. Joseph A. 
Berry collected the Tidestromia plants 
used in this study and Mr. Steven Graff 
helped with the culture of Cyanidium. 
Mr. Richard W. Hart built the cuvette 
used in this study. 

The Rate of Proton Gradient Decay 

in Chloroplasts as an Indicator of 

Membrane Parameters 

Mordhoy Avron and David C. Fork 

It has recently become clear that one 
of the major functions of the thylakoid 



membrane is to regulate proton passage 
in such a way as to maximize the efficiency 
of energy transduction by the photo- 
chemical apparatus (Jagendorf, 1975; 
Avron, 1977). 

Previous reports from this laboratory 
{Year Book 75, pp. 465-572; Murata et 
al., 1975; Murata and Fork, 1975; Fork 
and Murata, 1977) indicated that a 
variety of techniques can be employed 
to monitor changes in the physical phase 
of the lipids in photosynthetic mem- 
branes. In this study we investigated the 
rate of dark decay of the pH gradient, 
produced previously across the thylakoid 
membrane by photosynthetic electron 
transport, as a function of temperature 
in chloroplasts isolated from both chilling- 
sensitive and chilling-resistant plants. 
We utilized the technique described by 
Schuldiner et al. (1972) for following the 
pH gradient across the thylakoid mem- 
brane by observing the change in fluores- 
cence of 9-aminoacridine in response to 
the formation and decay of the gradient. 

Chloroplasts were isolated by a stand- 
ard technique (Avron, 1961) and were 
suspended in a concentration of about 
10 fxg chlorophyll/ml in a solution con- 
taining Tricine, 15 mM, pH 8.0; NaCl, 
20 mM; MgCU, 5 mM; phenazine metho- 
sulfate, 10 fxM ; and 9-aminoacridine, 2 
fiM. A monochromator and a narrow- 
band interference filter provided a weak 
blue light for exciting 9-aminoacridine 
fluorescence. The fluorescence peaked at 
400 nm and was monitored by a photo- 
multiplier (EMI 9558B) protected by a 
filter combination that peaked at 500 nm 
and consisted of Corning filters CS 4-96 
and CS 3-72, Calflex C, and a Wrat- 
ten No. 64 filter. Strong red actinic light 
was provided by filtering the light from 
a tungsten-iodide lamp through a Calflex 
C heat filter, 37 mm of water, and a 
Schott glass filter RG 5 (3 mm thick). 
A thermocouple in the reaction mixture 
continuously monitored the temperature, 
which was varied by passing cooled or 
heated alcohol-water through a stainless 
steel coil immersed in the reaction mix. 



232 



CARNEGIE INSTITUTION 



The samples were heated and cooled at 
rates of about TX and O.S'^C min, re- 
spectively. The outputs of the photo- 
multiplier and of the thermocouple were 
fed directly into a Hewlett-Packard 2116 
computer system, which calculated the 
half-time of decay of the proton gradient; 
its kinetics were monitored on a chart 
recorder. 

Figure 20 illustrates sample chart re- 
cordings of the responses at different 
temperatures and with a variety of chlo- 
roplasts. The rate of decay of the proton 
gradient was a strong function of tem- 
perature — the rate for spinach chloro- 
plastc? varied from a half-time of more 





o 

c 

e 

o 

6) 






Spinach 




6.3 °C +, = 27; 



Spinach 



2.5 "C +, = 100: 





Tidestromia 




0.6 *C +, = 24 sec 



1 2 3 4 5 

Time, min 

Fig. 20. The kinetics of light-induced proton 
gradient formation and decay across chloroplast 
thylakoid vesicles of spinach, bean, and Tide- 
stromia oblongifolia at different temperatures. 
The proton movements were followed at the 
temperatures indicated as changes in the fluo- 
re.scence of 9-aminoacridine excited by weak 
blue light, as described in the text. The down- 
ward and upward arrows mark the beginning 
and end, respectively, of strong red actinic light 
(^on for 52 sec) that excited the photosynthetic 
reactions but was not detected by the fluores- 
cence-measuring s>'stem. Gas phase, air. 



1000 



300 



O 
X 



- 100 



30 



10 L-^ 



30 

1 — 



Temperature, C 
20 10 



-i 1 r 



Spinach 




3.3 



3.4 3.5 

l/T X 10^ °K' 



3.6 



Fig. 21. Arrhenius plot of the rate of proton- 
gradient decay in spinach chloroplast fragments 
previously illuminated by red actinic hght. Se- 
quences of the light-induced decrease and the 
following dark increase of 9-aminoacridine fluo- 
rescence were measured as described in Fig, 20. 
Light periods of 52 sec were followed by 
sufficiently long dark periods to re-establish 
the dark base level seen before illumination. 
The sample at 16 °C was first cooled to 2.5° C 
and then heated to about 30 °C. 



than 100 seconds at temperatures around 
0°C to fractions of a second at tempera- 
tures around 35° C. Chloroplasts isolated 
from Tidestromia oblongifolia or beans 
(both chilling-sensitive plants) also ex- 
hibited kinetics of proton efflux that were 
strongly temperature dependent, but they 
did not show the very slow decay char- 
acteristically observed at low tempera- 
tures with chloroplasts isolated from 
spinach (chilling resistant). 

An Arrhenius plot relating the recipro- 
cal of the half-time of the decay of the 
proton gradient to the reciprocal of the 
absolute temperature for spinach chloro- 
plasts is shown in Fig. 21. In agreement 
with data previously obtained on the 
520-nm shift and chlorophyll fluorescence 



DEPARTMENT OF PLANT BIOLOGY 



233 



in spinach (Murata and Fork, 1975 and 
this Year Book), no breaks were ob- 
served between 20° and 2°C, and the 
points in this region followed the same 
line when temperature was decreased or 
increased. The energy of activation in 
this region is 11 kcal/mole. Above 20°C 
the points deviated from linearity in a 
manner similar to that previously de- 
scribed for the temperature dependence 
of atebrin fluorescence quenching (Kra- 
ayenhof and Katan, 1971). However, 
several lines of evidence indicate that 
this break in linearity is not due to a 
phase transition but rather to a high 
temperature-dependent gradual inactiva- 
tion of the chloroplasts: (1) the points 
above 20° C do not fall on a straight line 
but on a continuously upward-sloping 
curve; (2) on decreasing the temperature 
from points above 20°C, the "break" was 
not observed, but instead the points fol- 
lowed a straight line that represented 



faster decay times than observed ini- 
tially for a given temperature (see Fig. 
22 for a similar situation in Tidestrowda 
chloroplasts) ; (3) the temperature (20'"' 
C in Fig. 21) at which the deviation from 
linearity was observed was not constant, 
but varied somewhat with different chlo- 
roplast preparations (18-23''C) . 

Arrhenius plots of the response in 
Tidestromia chloroplasts are shown in 
Fig. 22. Starting in the low-temperature 
region we have repeatedly observed a 
break in the plot around 5°C (see Fig. 
22). This agrees with similar breaks seen 
in the Arrhenius plot of the 520-nm ab- 
sorption change and in the chlorophyll 
fluorescence-versus-temperature curves 
(Murata and Fork, this Year Book). This 
break therefore also seems to indicate a 
lipid phase transition at 5°C in this high- 
temperature adapted plant. Above 5°C a 
flat region was sometimes observed (see 
Fig. 22, at right) extending for 5-8°C 



1000 



300 



30 



20 



o 
O 



X 

^ 100 

X 



C 

o 
"o 

u 

a 



30 



10 



^^ 



Tempera+ure, C 

20 10 



7/ 



20 



10 







Tidestromia 




J I I I I I I jii 



it^ 



J I L 



3.2 3.3 3.4 3.5 3.3 3.4 3.5 

.3 o,.-l 



^-IL 



I I I I I L 



3.4 3.5 



3.6 



3.7 



l/T X 10 . °K" 



Fig. 22. Arrhenius plots of the rates of proton-gradient decay from three different samples 
of Tidestromia ohlongifolia chloroplast fragments. Measurements were as described in Fig. 21. 
In each case the samples were initially at a temperature of about 7°C. One sample was 
heated to about 36°C and then cooled again to 8°C (left). Another sample was heated to 
30°C, then cooled (middle). Another sample was heated to 20°C and cooled again to — 1.6~C 
(right). The Tidestromia, provided through courtesy of Dr. Olle Bjorkman, was grown at 32°C 
day and 20^0 night temperatures. 



234 



CARNEGIE INSTITUTION 



before a linear dependence was again 
evident up to about 27-X. Within this 
linear region, increasing or decreasing the 
temperature produced identical results. 
At temperatures above 27''C the char- 
acteristic increasing slope, which we have 
attributed to a temperature inactivation 
(see the results with spinach chloroplasts, 
above"*, was again evident. 

In comparing the results obtained w^th 
spinach chloroplasts to those observed 
with Tidestromia chloroplasts, three fea- 
tures can be emphasized: (1) Tidestromia 
shows a transition around 5°C, which 
seems to correlate with a membrane lipid 
transition; no such transition is observed 
in spinach. (2) The lowest temperature 
at which irreversible inactivation is ini- 
tially observed is around 20°C in spinach 
and 27^C in Tidestromia. (3) In the low- 
temperature region, spinach exhibits very 
long half-times for proton efflux (> 90 
sec), while the longest half-times ob- 
served with Tidestromia were around 20 
seconds. 

An experiment on proton efflux was 
also conducted with chloroplasts isolated 
from leaves of bean, a chilling-sensitive 
plant (Fig. 23). Similar characteristics 
were observed — a break around 5°C, a 
linear retraceable portion between 7- 
17°C, and a temperature-dependent in- 
activation like that observed with Tide- 
stromia (not shown here in detail) 
beyond 17°C. Here again, proton efflux 
half-times at low temperatures were rapid 
f< 20 sec). 

It is clear from these results that the 
rate of proton efflux through chloroplast 
thylakoid membranes, as probed by the 
fluorescence of 9-aminoacridine, is highly 
temperature dependent and can be used 
to monitor thylakoid membrane proper- 
ties in a variety of plants. Species-specific 
phase transitions and temperature-de- 
pendent modifications of membrane 
properties are parameters that can easily 
be monitored with this technique. 

The differences between chilling-sensi- 
tive and chilling-resistant plants reported 
in the previous article on the carotenoid 



1000 



Tempcra+ure, "C 
10 



O 



X 



300- 



100- 




3.4 



l/T XIO"*. ^'K 



Fig. 23. Arrhenius plot of the rate of proton- 
gradient decay of bean chloroplast fragments. 
Measurements were as described in Fig. 21. The 
sample was heated from about 1.5 °C to about 
20° C. The plants used for chloroplast extraction 
were grown at 32 °C day and 20 °C night 
temperatures. 



change are also reflected by the behavior 
of proton efflux as a function of tempera- 
ture. 



References 

Allen, M. B., Arch. Mikrobiol. 32, 270- 

277, 1959. 
Amesz, J., Biochim. Biophys. Acta 79, 

257-265, 1964. 
Amesz, J., and L. N. M. Duysens, 

Biochim. Biophys. Acta 64, 261-278, 

1962. 
Amesz, J., and J. W. M. Visser, Biochim. 

Biophys. Acta 234, 62-69, 1971. 
Anderson, J. M., Biochim. Biophys. Acta 

416, 191-235, 1975. 
Avron, M., Anal. Biochem. 2, 535-543, 

1961. 
Avron, M., Annu. Rev. Biochem. 46, 143- 

155, 1977. 



DEPARTMENT OF PLANT BIOLOGY 



235 



Brock, T. D., Nature 214, 882-885, 1967. 

Castenholz, R. W., Bacteriol. Rev. 33, 
476-504, 1969. 

Cox, R. P., Biochim. Biophys. Acta 387, 
588-598, 1975. 

Dehlinger, P. J., P. C. Jost, and O. H. 
Griffith, Proc. Nat. Acad. Sci. U.S.A. 
7^2280-2284,1974. 

Doemel, W. N., and T. D. Brock, J. Gen. 
Microbiol. 67, 17-32, 1971. 

Fork, D. C, and J. Amesz, Photochem. 
Photobiol. 6, 913-918, 1967. 

Fork, D. C, and N. Murata, in Photosyn- 
thetic Organelles: Structure and Func- 
tion, S. Miyachi, S. Katoh, Y. Fujita, 
and K. Shibata, eds., Japanese Soc. of 
Plant Physiologists, Tokyo, pp. 427- 
436, 1977. 

Graber, P., and H. T. Witt, Biochim. 
Biophys. Acta 423, 141-163, 1976. 

Inoue, H., and M. Nishimura, Plant Cell 
Physiol. 12, 137-145, 1971. 

Jackson, J. B., and A. R. Crofts, FEBS 
Lett. 4, 185-189, 1969. 

Jagendorf, A. T., in Bioenergetics of 
Photosynthesis, Govindjee ed., Aca- 
demic Press, New York, pp. 413-492, 
1975. 

Jost, P. C, 0. H. Griffith, R. A. Capaldi, 
and G. Vanderkooi, Proc. Nat. Acad. 
Sci. U.S.A. 70, 480-484:, 197d. 

Junge, W., and H. T. Witt, Z. Naturforsch. 
23b, 244-254, 1968. 

Kempner, E. S., Science 142, 1318-1319, 
1963. 

Kleuser, D., and H. Biichen, Z Natur- 
forsch. 24b, 1371-1374, 1969. 

Kraayenhof, R., and M. B. Katan, in 
Proc. 2nd International Congress on 
Photosynthesis Research, G. Forti, et 
al., eds.. Junk, The Hague, pp. 937- 
949, 1971. 

Meeks, J. C, and R. W. Castenholz, 
Arch. Mikrobiol. 78, 25-41, 1971. 

Murata, N., and D. C. Fork, Plant 
Physiol. 56, 791-796, 1975. 



Murata, N., and A. Takamiya, Plant Cell 

Physiol. 10, 193-202, 1969. 
Murata, N., J. H. Troughton, and D. C. 

Fork, Plant Physiol. 56, 508-517, 1975. 
Neumann, J., and A. T. Jagendorf, Arch. 

Biochem. Biophys. 107, 109-119, 1964. 
Nobel, P. 8., Planta 115, 369-372, 1974. 
Ohnishi, S., and T. Itoh, Biochemistry 

13, 881-887, 1974. 
Okada, M., and A. Takamiya, Plant Cell 

Physiol. 11, 713-721, 1970. 
Oldfield, E., and D. Chapman, FEBS 

Lett. 23, 285-297, 1972. 
Ono, T., and N. Murata, Biochim. 

Biophys. Acta 460, 220-229, 1977. 
Raison, J. K., J. Bioenergetics 4, 285- 

309, 1973. 
Reich, R., R. Scheerer, K.-U. Sewe, and 

H. T. Witt, Biochim. Biophys. Acta 

449, 285-294, 1976. 
Schuldiner, S., H. Rottenberg, and M. 

Avron, Eur. J. Biochem. 25, 64-70, 

1972. 
Schuldiner, S., H. Rottenberg, and M. 

Avron, Eur. J. Biochem. 39, 455-462, 

1973. 
Shneyour, A., J. K. Raison, and R. Smillie, 

Biochim. Biophys. Acta 292, 152-161, 

1973. 
Strichartz, G. R., and B. Chance, Biochim. 

Biophys. Acta 256, 71-84, 1972. 
Traiible, H., Naturwissenschaften 58, 

277-284, 1971. 
Traiible, H., and P. Overath, Biochim. 

Biophys. Acta 307, 491-512, 1973. 
van Dijck, P. W. M., P. H. J. Th. Ver- 

vergaert, A. J. Verkleij, L. L. M. van 

Deenen, and J. de Gier, Biochim. 

Biophys. Acta 406, 265-278, 1975. 
Wakamatsu, K., and M. Nishimura, Plant 

Cell Physiol. 15, 587-599, 1974. 
Wakamatsu, K., N. Ikehara, and M. 

Nishimura, Plant Cell Physiol. 15. 

601-610, 1974. 
Weikard, J., A. Miiller, and H. T. Witt, 

Z. Naturforsch. 18b, 139-141, 1963. 



236 



CARNEGIE INSTITUTION 



PROTON GRADIENTS AS POSSIBLE INTERMEDIARY 

ENERGY TRANSDUCERS DURING ATP-DRIVEN REVERSE 

ELECTRON FLOW IN CHLOROPLASTS 

Mordhay Avron and Ulrich Schreiber 



After light activation of the latent 
adenosine triphosi^hatase. addition of 
ATP in the dark drives reverse electron 
flow in isolated chloroplasts, as evidenced 
by reduction of the primary system II 
electron acceptor, Q (Rienits et ai, 1974). 
According to the chemiosmotic hypothe- 
sis, proton gradients should be obligatory 
energy-transducing intermediates in 
ATP-induced reverse electron flow. In- 
deed, it has been demonstrated that 
transmembrane proton gradients are cre- 
ated by the action of ATPase (Bakker- 
Grunwald and Van Dam, 1973) and, 
when artificially induced, drive reverse 
electron flow by themselves (Shahak et 
al, 1975). As an obligatoiy intermediate, 
the buildup of a proton gradient is ex- 
pected to be at least as fast kinetically 
as the induction of reverse electron flow 
under all experimental conditions. 

We constructed an apparatus that 
enabled us to monitor simultaneously the 
ATP-driven buildup of ApH and reduc- 
tion of Q under a variety of conditions. 
Q-reduction was measured as the in- 
crease of chlorophyll fluorescence yield, 
with measuring light sufficiently low to 
avoid light-induced Q-redox changes. 
The same weak light excited 9-amino- 
acridine fluorescence, the quenching of 
which reflects the buildup of ApH 



(Schuldiner et al, 1973). The results 
are essentially in agreement with the 
predictions of the chemiosmotic hypothe- 
sis. Thus, slowing the ATP-induced 
buildup of ApH by using a variety of 
imcouplers and internal buffers and by 
lowering the temperature brought about 
a corresponding change in rate and extent 
of the ATP-induced reduction of Q. Since 
the observed ATP-driven reactions are 
relatively slow (half-time of a few sec- 
onds), they may permit complete equili- 
bration between other postulated high- 
energy intermediates and the observed 
proton gradients. This material is pub- 
lished in detail elsewhere (Avron and 
Schreiber, 1977). 

References 

Avron, M., and U. Schreiber, FEES Lett. 

77, 1-6, 1977. 
Bakker-Grunwald, T., and K. Van Dam, 

Biochim. Biophys. Acta 292, 808-814, 

1973. 
Rienits, K. G., H. Hardt, and M. Avron, 

Eur. J. Biochem. 43, 291-298, 1974. 
Schuldiner, S., H. Rottenberg, and M. 

Avron, Eur. J. Biochem. 39, 455-462, 

1973. 
Shahak, Y., H. Hardt, and M. Avron, 

FEBS Lett. 54, 151-154, 1975. 



ATP-INDUCED CHLOROPHYLL LUMINESCENCE IN 
ISOLATED SPINACH CHLOROPLASTS 

Ulrich Schreiber and Mordhay Avron 



After light-activation of the latent tion of Q by reverse electron flow (Avron 

ATPa>f'. arlflition of ATP in the dark to and Schreiber, 1977; see also Avron and 

isolated chloroplasts leads to formation Schreiber, this Year Book). Both the 

of a transthylakoidal ApH and reduc- ApH and the reduction of Q constitute 



DEPARTMENT OF PLANT BIOLOGY 



237 



conditions favorable for the stimulation 
of post-illumination luminescence. This 
luminescence is generally considered to 
result from the recombination of positive 
(Z+) and negative {Q") charges at the 
photosystem II reaction centers (Lavorel, 
1975). Although stimulated luminescence 
has been reported when a ApH and Q- 
reduction was artificially induced by an 
acid-base transition (Shahak et al., 1977) , 
attempts to observe ATP-induced lumi- 
nescence under the particular conditions 
required for ATPase activation have 
been unsuccessful. 

In the present study we developed a 
procedure by which ATP-induced lumi- 
nescence can be readily measured. This 
procedure is illustrated in Fig. 24. The 
chloroplasts were first illuminated with 
strong, heat-filtered white light for three 



minutes to activate the latent ATPa.se. 
Shortly after th(; activating light was 
turned off, the decay of post-illumination 
luminescence was monitored for 90 sec- 
onds, by which time it approached zero. 
Then two saturating flashes were given, 
and the flash-induced luminescence was 
recorded for 90 seconds. Another flash 
pair was then given, and ATP was in- 
jected before the flash-induced lumines- 
cence was completely decayed. ATP 
caused about a tenfold stimulation of 
luminescence. A third flash pair, given 
90 seconds after the second in the pres- 
ence of an active ATPase, induces again 
about ten times more luminescence than 
could a flash pair in the absence of ATP 
(see dotted line). 

The requirements for observing a sig- 
nificant ATP-induced luminescence are 



>^ 

c 




0) 
u 

c 

u 
(/) 
0) 

c 

E 

_2 

> 




6.0 6.5 

Time, min 



7.5 



8.0 



Fig. 24. ATP-induced stimulation of luminescence in isolated spinach chloroplasts. The light- 
off arrow indicates the end of the 3-min light activation period. At the zig-zag arrows, pairs 
of brief (peak intensity after 2 ^sec) saturating flashes (Stroboslave) were given. The broken 
lines represent the decay of flash-induced himinescence in an identical sequence without ATP 
addition. Monitoring of postillumination luminescence was initiated 5 sec after preillumination. 
ATP addition was by injection of 3 /ul 0.1 M solution into 500 ^1 of stirred reaction mixture. 
The measuring apparatus and measuring conditions were as described previously (Avron and 
Schreiber, 1977), except for a much lower PMS concentration (here 5 X 10"^ M). 



23S 



CARNEGIE INSTITUTION 



listed in Table 2. In contrast to the ATP- 
indiiood reduction of Q (Rienits et al., 
1974). PMS does not seem to be obliga- 
tory in this system. Actually the same 
high concentrations of PMS (> 1 /xM) , 
which are optimal for ATP-induced re- 
verse electron flow (Rienits et a/., 1974), 
accelerate the decay of flash-induced 
luminescence to a point that ATP-induced 
luminescence cannot be observed. 

An important observation was that 
unless at least one preilluminating flash 
were given prior to ATP addition, almost 
no luminescence was stimulated by ATP. 
This result is in agreement with the 
postulated mechanism of luminescence 
by recombination of the positive and 
negative charges separated by the photo- 
act at system II reaction centers (Lavorel, 
19751. Without a preilluminating flash, 
luminescence is limited by the availability 
of positive charges, since the Z-pool is 
relatively small compared to the Q-PQ 
pool. ATP does not stimulate lumines- 
cence in this situation, because the ATP 
effect is on the Q-PQ side. A saturating 
flash creates an equal number of positive 
and negative charges. While the negative 
charges drain rapidly into the secondary 



TABLE 2. Requirements for ATP-induced 

Luminescence* 





Extent of ATP-induced 




Luminescence 


Conditions 


(% of control) 


No light activation 


1 


DTT omitted 


15 


PMS omitted 


94 


MgClo omitted 





MgCL omitted during 




activation only 


49 


Xo flashes 


8 


One flash 


32 



* The values given represent the relative 
height of the luminescence peak obtained upon 
ATP injection. The complete reaction mixture 
and control procedure are described in the text. 
When MgClz was omitted during activation 
only, it was added 15 sec after the activating 
light was turned off. No flashes: ATP was 
added when the postactivation luminescence 
reached the same level as in the control. 

acceptor pool, the positive charges have 
a relatively long half-life, on the order 
of 30 seconds (Joliot et al, 1971). In 
this situation an ATP-induced reverse 
electron flow from the secondary acceptor 
pool back to Q can lead to marked stimu- 
lation of luminescence. 



>s 



0) 

u 

c 
cy 

m 

c 

e 

_2 
> 

cr 




Fig. 25. Dependence of ATP-stimulated luminescence on the time elapsed between a pre- 
illuminating flash pair and ATP-injection. Conditions and preillumination schedule were as in 
Fig. 24. 



DEPARTMENT OF PLANT BIOLOGY 



239 



An important parameter for the yield 
of ATP-induced luminescence is the time 
elapsed between the flashes and ATP 
addition (Fig. 25). The phenomenon is 
the more pronounced the earlier ATP is 
added, but a significant stimulation is 
observed even one minute after the 
flashes, when the flash-induced lumines- 
cence itself is almost completely decayed. 

If the phenomenon of ATP-induced 
luminescence is indeed due to the ATP- 
synthase system working in reverse, it 
should be sensitive to uncouplers and 
ATPase inhibitors. These predictions are 
confirmed by the results shown in Fig. 26. 
Gramicidin, which is a potent uncoupler, 
and tentoxin, an ATPase inhibitor 
(Steele et al., 1976), each completely 
abolished the effect and left only the 
flash-induced luminescence. 

These experiments demonstrate that 
after proper activation the ATPase sys- 
tem can affect the electron transport 
system all the way to the photosystem II 
reaction center. Thus they extend and 



complement the previous demonstrations 
of an ATP-induced proton gradient and 
ATP-induced reduction of Q (Avron and 
Schreiber, 1977, and this Year Book). 

References 

Avron, M., and U. Schreiber, FEES Lett. 
77, 1-6, 1977. 

Joliot, P., A. Joliot, B. Bouges, and G. 
Barbieri, Photochem. and Photobiol. 
14, 287-305, 1971. 

Lavorel, J., in Bioenergetics of Photo- 
synthesis, pp. 319-371, Govindjee, ed., 
Academic Press, New York, 1975. 

Rienits, K. G., H. Hardt, and M. Avron, 
Eur. J. Biochem. 43, 291-298, 1974. 

Shahak, Y., Y. Siderer, and M. Avron, in 
Photosynthetic Organelles, Special Is- 
sue of Plant Cell Physiol., pp. 115-127, 
Center for Academic Publications, 
Japan, 1977. 

Steele, J. A., T. F. Uchytil, R. D. Durbin, 
P. Bhatnagar, and D. H. Rich, Proc. 
Nat. Acad. Sci. U.S.A. 73, 2245-2248, 
1976. 




>N 



(X) 

o 

c 

O 

c 
£ 

> 



"T r 



Gramicidin 



ATP 



Tenfoxin 




ft t 

ATP 



2 3 4 

Time, mm 



Fig. 26. Inhibition of ATP-stimulated luminescence by gramicidin and tentoxin. One pre- 
illuminating flash pair was given before ATP-addition, 2 min after light-activation. The 
inhibitors were added 15 sec after activation. Concentrations: gramicidin, 5 X 10"^ M ; tentoxin, 
10"^ M. The tentoxin was a gift from Dr. J. A. Steele, University of Wisconsin. 



240 



CARNEGIE INSTITUTION 



STUDIES ON DNA SEQUENCE ORGANIZATION 

Michael G. Murray. Richard S. Preislcr, and William F . Thompson 



Last year we reported preliminary 
studies which established that the pea 
genome is organized in a pattern gen- 
erally similar to that of many animal 
genomes [Year Book 75, p. 356). Single- 
copy sequences were shown to be less 
than 3.000 nucleotides in length, with 
both short (200-400-nucleotide) and long 
(> 1500-nucleotidel repetitive sequences 
present. The longer repeats reassociate to 
produce duplexes with high thermal sta- 
bility, indicative of precise base pairing, 
while the short repeats form duplexes 
with greater mismatch, indicating that 
there has been more base sequence di- 
vergence within families of short repeti- 
tive sequences. 

More detailed studies of both pea and 
mung bean DNA are now in progress. 
Experiments have been designed to ex- 
amine the interspersion of single-copy 
sequences with repetitive DNA, applying 
techniques developed by Davidson et at. 
(19731 and Graham et al. (1974). These 
experiments rely on the fact that a duplex 
region in an otherwise single-stranded 
DNA molecule wall cause the entire 
molecule to bind to hydroxylapatite. 
Thus if DNA is reassociated so that only 
repetitive sequences can react, the bound 
fraction will include any unreacted single- 
copy DNA present in the same fragment 
with a repeated sequence. If the frag- 
ments employed are shorter than the 
single-copy sequences, most of the single- 
copy DNA will be found on fragments 
containing no repetitive elements, and 
will therefore not bind to hydroxylapatite. 
However, as the fragment length is in- 
creased, more and more single-copy DNA 
will become bound, since the fraction of 
fragments containing at least one repeti- 
tive element will increase with increasing 
fragment length. Binding will increase 



until the fragments exceed the length of 
single-copy sequences. Further increases 
in length will result in fragments con- 
taining two repetitive regions; however, 
this will not increase the extent of hy- 
droxylapatite binding since a single du- 
plex region is sufficient to cause binding. 
If many single-copy sequences are 
contained in a class with a relatively 
narrow distribution of length, there will 



1.0 



as 



0.4 



"1 r 



n — I 1 — r 



Pec 




J I I L 



J I I I L 



500 



1000 



1500 



Fragment length, nucleotides 



Fig. 27. The fraction of pea DNA fragments 
containing repetitive-sequence elements, as a 
function of fragment length. Labeled DNA 
fragments of the indicated average lengths were 
reassociated with a 2500-fold excess of 400- 
nucleotide fragments to Cot 50. The fraction 
bound to hydroxylapatite (R), was corrected 
for zero time binding as described in the text 
and plotted as a function of fragment length. 
Fragment lengths were determined after incuba- 
tion. Values shown are averages of three 
repHcations and vertical lines denote standard 
deviations. 



DEPARTMENT OF PLANT BIOLOGY 



24 



be a sharp break in the slope of the 
binding-versus-length curve at a point 
corresponding to the average length of 
that class (Davidson et al., 1973; 
Graham et al., 1974). In most higher 
organisms studied, a majority of the 
single-copy regions are shorter than a few 
thousand nucleotides, a condition reflect- 
ing the interspersion of repeated se- 
quences in a short-period pattern; a 
smaller number are much longer, reflect- 
ing long-period interspersion of repeats 
(Davidson et al., 1975). 

Figures 27 and 28 show the results of 
one series of experiments on pea and 
mung bean DNA. DNA was labeled by 
iodination with Na^^^I as described 



1.0 - 



0.9 



_ 0.8 
q: 



-| 1 — I r 



-] — I 1 — I — I 1 I T r 



Mung bean 




0.41 — ^ — L. 



J I I L 



J L 



500 1000 1500 

Fragment length, nucleotides 

Fig. 28. The fraction of mung bean DNA 
fragments containing repetitive-sequence ele- 
ments as a function of fragment length. Labeled 
fragments of the indicated lengths were incu- 
bated with a 2500-fold excess of 400-nucleotide 
fragments to Cot 100 and then treated as de- 
scribed in the legend to Fig. 27. Values shown 
are averages of three replications and the 
vertical lines denote standard deviations. 



previously (Year Hook 76, p. 363 j, ex- 
cept that the reaction was carried out 
for 1-2 min at 98'' tcj prevent reassoci- 
ation or intrastrand duplex formation. 
The labeled DNA was then fractionated 
on a preparative alkaline sucrose gradi- 
ent to obtain tracer preparations of dif- 
ferent lengths, and the different tracers 
were allowed to react separately with an 
excess of unlabeled fragments 400 nucleo- 
tides long. Binding was measured at C<,t 
50 for pea DNA and Cut 100 for mung 
bean. Figures 29 and 30 show that almost 
all repetitive sequences have reacted by 
the time these C^t values are reached, 
while little or no single-copy DNA has 
reassociated. Fragment lengths were 
measured by electrophoresis in alkaline 
agarose gels (Murray and Thompson, 
this Year Book) after reassociation in 
order to take into account any strand 
scission that may have occurred during 
the incubation at elevated temperature. 
Total binding (B) was corrected to elimi- 
nate the effect of ^'zero time" binding 
elements (foldback or inverted repeat 
sequences) by measuring the fraction 
(Z) of each tracer bound after incuba- 
tion to Cot 10~^. The fraction bound 
because of bimolecular reassociation be- 
tween repeated sequences is then: 

R^lOOiB -Z)/{1 -Z) 

This correction involves the assumption 
that sequences adjacent to '^zero time" 
binding elements behave like other se- 
quences in the genome. 

It is readily apparent from the figures 
that the data could be improved by 
including several longer and some shorter 
tracer lengths. Such work is currently in 
progress. Several important conclusions 
can already be drawn. By extrapolation 
to zero fragment length, the actual frac- 
tion of genome consisting of repetitive 
sequences can be estimated as about 0.63 
for pea and 0.44 for mung bean. In the 
case of pea DNA, this value is consistent 
with results from experiments using SI 
single-strand specific nuclease {Year 



242 



CARNEGIE INSTITUTION 




Log equivalent Cq\ 

Fig. 29. (A) Reassociation kinetics of short pea DNA fragments. Samples at various concen- 
trations in either 0.12 or 0.40 M sodium phosphate buffer, pH 6.8, were heat-denatured and 
incubated at 60' or 66°, respectively, for various times prior to fractionation on hydroxylapa- 
tite in 0.12 M sodium phosphate at 60°. Cot values for samples incubated in 0.40 M sodium 
phosphate have been corrected to the equivalent Cot values in 0.12 M sodium phosphate at 
60". Data are from independent experiments using unlabeled DNA preparations with average 
lengths of 360 or about 400 nucleotides. Tracer quantities of ^H-DNA were prepared from sheared 
single-stranded total DNA using E. coli DNA polymerase I and ohgonucleotide primers, and 
the reaction product was treated with SI nuclease prior to mixing with unlabeled driver frag- 
ments (Murray, Belford, and Thompson, this Year Book). The upper curve is a least-squares 
fit to the pooled data, using the three theoretical second-order components shown, plus a 9% 
"ver>' fast" fraction reacting prior to Cot 0.01. The rate constant for single-copy sequences was 
fixed at 2.4 X 10"* 1/mol-sec, the value predicted for a haploid nuclear DNA content of 4.5 pg. 
Solid circles indicate unlabeled DNA; open circles, ^H polymerase copy DNA. (B) Reassocia- 
tion kinetics of long pea DNA fragments. Tracer fragments with an average length of 1200 
nucleotides were mixed with a 2500-fold excess of unlabeled 400-nucleotide fragments and 
reassociated as described for Fig. 29 A. At each Cot value, the fraction of tracer fragments con- 
taining renatured regions was measured by hydroxylapatite fractionation. The upper curve is a 
least-s-juares fit for the two repetitive sequence components shown, plus a 15% 'Very fast" 
component reacting prior to Cot 0.01. The tracer used in this experiment was obtained from 
the .«:ame ^^I-DNA preparation as the fragments of other lengths used in the experiment of 
Fig. 27. Its length was estimated by electrophoresis in an alkaline agarose gel after incubation 
in 0.40 M sodium phosphate for 6 hr (equivalent Cot =. 50). 



Book 75, pp. 356-362), and also with 
hypochromicity measurements on re- 
associated DNA (not shown). 

The data also show that most of the 
single-copy sequences in pea DNA are 



present in a short-period interspersion 
pattern (evident from the steep slope in 
the initial phase of the binding curve in 
Fig. 27) ; the mean length for this class 
falls between 600 and 900 nucleotides. 



DEPARTMENT OF PLANT BIOLOGY 



243 




0.2 
0.4 h 
0.6 



T5 






0.8 


o 




_Q 




C 


1.0 


o 









u 




o 





"1- 



0.2 - 



0.4 - 



0.6 - 



0.8 - 



B 






-2 



I 2 

Log equivalent Cof 



Fig. 30. (A) Reassociation kinetics of short mung bean DNA fragments. Mung bean DNA 
sheared to an average length of about 400 nucleotides was reassociated and fractionated as 
described in Fig. 29A. The upper curve represents a least-squares fit to the data using the two 
theoretical second-order components shown, plus a 15% "very fast" fraction. (B) Reassociation 
of ^^^I mung bean DNA fragments with an average length of 1200 nucleotides in the presence 
of excess unlabeled 400-nucleotide fragments. Reassociation and fractionation were carried out 
as described for Fig. 29B. The upper curve is a least-squares fit with the two theoretical second- 
order components shown, plus a 24% "very fast" fraction. The rate constant for the single-copy 
fraction of the tracer was fixed at 9 X 10"* 1/mol-sec (three times that observed for the 
400-nucleotide fragments), which is the value expected for 1200-nucleotide fragments. 



This value compares with estimates rang- 
ing from ^800 to 1500 nucleotides for 
animal genomes (Davidson et al., 1975). 
Walbot and Dure (1975) estimated the 
mean length of short-period single-copy 
DNA in cotton to be about 1800 nucleo- 
tides, while Zimmerman and Goldberg 
(1977) found a value of about 1400 
nucleotides for tobacco DNA. Some- 
what shorter sequences, averaging around 
1000 nucleotides, were found in wheat 
DNA by Flavell and Smith (1976) , while 
in rye DNA the major class of inter- 
spersed single-copy elements may aver- 
age only about 400 nucleotides in length 
(Smith and Flavell, 1977). Since our 



estimates of tracer fragment lengths were 
made after reassociation, we feel that 
ours more accurately reflect the situation 
at the time of the binding assay than do 
the measurements of initial tracer lengths 
used in many of the other studies. Control 
experiments show that strand scission 
reduces the average length of 1200-1400- 
nucleotide tracers by about 20-25% 
under our conditions. 

By extrapolating the data for the 
longer fragment lengths to the y-axis. 
it is possible to derive an estimate of 
16% (100 — 84) for the fraction of the 
pea genome composed of long-sequence 
elements unreacted at Cot 50. About 21% 



244 



CARNEGIE INSTITUTION 



of the genome (84 — 63) would then 
be composed of sequences in the short- 
period interspersion pattern. However, 
these calcuhitions fail to take into ac- 
count either any unreactable hibel in the 
tracer preparations or the presence of re- 
petitive sequences whose reassociation is 
not yet complete at Cot 50. The reassoci- 
ation kinetics of 1200-nucleotide tracer 
DXA. presented in Fig. 29 (lower) , reveal 
that about o^c of the DNA fragments of 
this length contain repetitive elements 
that, although they have not yet bound 
by Cot 50. do however bind at Cot values 
too low for reassociation of single-copy 
DXA. In addition, about 3% of the label 
appears to be unreactable. If we assume 
the interspersion of unreacted repetitive 
sequences to be the same as that of the 
total repetitive sequence population, the 
maximum binding we could expect at Cot 
50 would be 92%. Normalizing the data 
in this fashion lowers the estimate of the 
fraction of the genome in the long-period 
interspersion pattern to about 10 percent. 

These calculations are intended only 
to illustrate the uncertainty in estimat- 
ing the fraction of long-period single- 
copy DXA in highly repetitive and 
extensively interspersed genomes. In fact, 
the more sensitive kinetic analysis shown 
in Fig. 29, bottom panel, failed to detect 
any .^ingle-copy sequences longer than 
12(X) nucleotides. At least some of the 
increased binding observed in Fig. 27 at 
lengths above 700 nucleotides or so may 
be attributed to heterogeneity of the 
single-copy sequence lengths and of the 
tracer fragment lengths. It is thus possi- 
ble that single-copy sequences with a 
mean length greater than 600-900 nucleo- 
tides do not exist as a discrete class in 
the pea genome. 

Experiments such as that summarized 
in Fig. 27 mea.sure the binding that re- 
sults from complete reassociation of all 
repetitive sequences, and thus provide 
no information on the arrangement of 
repeater] sequences in other frequency 
classes. In order U) study interspersion 
of different frequency classes, we have 



therefore constructed Cot curves describ- 
ing the reassociation kinetics of long 
(1200-nucleotide) tracer DNA fragments 
in the presence of an excess of short frag- 
ments. By comparing the fractions of 
long and short fragments reassociating 
with the kinetics of a given repetitive 
component, we can estimate the extent to 
which sequences belonging to one fre- 
quency class are interspersed among 
more slowly reacting sequences in the 
genome. Results of two such experiments 
with pea and mung bean DNA are pre- 
sented in Figs. 29 and 30. Theoretical 
second-order kinetic components were 
fitted to the data by means of a least- 
squares computer program, and the re- 
sults of this analysis are summarized in 
Table 3. 

In the case of pea DNA, both the "very 
fast" and ''fast" components include a 
larger fraction of the long tracer frag- 
ments and thus are seen to be inter- 
spersed among more slowly reacting se- 
quences. Sequences adjacent to elements 
of the very fast fraction may include 
fast and ''slow" middle-repetitive as well 
as single-copy sequences, but do not con- 
stitute a large fraction of the total DNA. 
By contrast, the fast fraction clearly 
dominates the long tracer reaction, and 
sequences in this class must therefore be 
interspersed throughout much of the 
genome. About 70% of the long tracer 
molecules contain at least one fast repeat 
element, as opposed to about 25% in the 
driver. Almost half of the pea genome 
must therefore be composed of slow and 
single-copy sequences in close proximity 
to fast sequences. Extensive interspersion 
of slow and fast repeats would explain 
the fact that the slow component ac- 
counts for only about half as many long 
tracer fragments as it does driver frag- 
ments. 

It seems likely that the remaining slow 
repeats are interspersed among single- 
copy sequences. Long tracer fragments 
containing only slow sequences would be 
expected to reassociate faster than the 
slow repeats in the short driver DNA by 



DEPARTMENT OF PLANT BIOLOGY 



245 



TABLE 3. Comparison of Theoretical Components Fitted to Reassociation Kinetics Data 
from Figs. 3 and 4 for Long-Tracer and Short-Driver DNA Fragments 







Driver 


Tra 


cor 








Fraction 


Rate 


Fraction 


Rate 




Genome 


Components 


(Qa) 


(K.) 


(Q,) 


(Kr) 


Q, - Q^i 


Qt/Qi 


Pea 


Very fast* 
Middle repetitive 


0.09 




0.15 


... 


+0.06 


1.7 




(a) fast 


0.24 


3.3 


0.71 


4.9 


+0.47 


3.0 




(b) slow 


0.36 


0.05 


0.16 


0.05 


-0.20 


0.4 




Single-copy 


0.31 


0.00024t 







-0.31 





Mung Bean 


Very fast* 


0.15 




0.24 




+0.09 


1.6 




Middle repetitive 


0.34 


0.09 


0.51 


0.08 


+0.17 


1.5 




Single copy 


0.51 


0.0003 


0.25 


0.0009t 


-0.26 


0.49 



* The "very fast" fraction includes "foldback" or inverted repeat sequences as well as any 
sequences reassociating prior to Cot c^ 10"^. 

t Single-copy rates fixed at predicted values during computer analysis. 



a factor of at least 3 (the tracer/driver 
length ratio; Davidson et al., 1973). We 
detect no significant difference in the rate 
of the slow component in our data, and 
therefore we assume that most fragments 
in the slow tracer component probably 
consist of short repetitive elements ad- 
jacent to single-copy DNA. However, 
given the uncertainties inherent in fitting 
theoretical components to complex re- 
association data, this conclusion must be 
regarded as tentative. Additional experi- 
ments are clearly required before a firm 
conclusion will be possible. 

Although mung beans also belong to 
the family Legwminosae, the data pre- 
sented in Figs. 28 and 30 indicate that 
the pattern of sequence organization in 
mung bean DNA is strikingly different 
from that of pea DNA. Single-copy 
sequences account for a greater propor- 
tion of the total DNA in mung beans 
(about 59% versus 37% in pea DNA) 
and most of the mung bean single-copy 
sequences are significantly longer. The 
break in the binding curve for mung 
bean DNA fragments (Fig. 28) is less 
distinct than that for pea DNA, but 
would appear to be in the vicinity of 
1000 nucleotides. By estimating the frac- 
tions of short- and long-period single- 



copy sequences by extrapolation as de- 
scribed for pea DNA, we obtain values 
of 14% and 42% of the genome respec- 
tively. Using the data of Fig. 30 to 
estimate about 4% unreacted repetitive 
sequence at Cot 100 and 6% unreactable 
label, these figures can be normalized to 
19%) and 47%^. Thus, roughly 70% 
(47/66) of the mung bean genome con- 
sists of long-period single-copy sequences. 
This contrasts markedly with pea DNA, 
in which such long single-copy sequences 
cannot even be conclusively demonstrated 
to exist. 

The reassociation kinetics of long 
(1200-NT) mung bean tracer with short 
driver can best be fit with two second- 
order components, one repetitive and one 
non-repetitive (Fig. 30, bottom panel). 
About 25% of the 1200-nucleotide tracer 
reassociates according to single-copy 
kinetics, indicating that about half the 
single-copy sequences are longer than 
1200 nucleotides in the mung bean ge- 
nome. Most of the remaining single-copy 
DNA must be interspersed with middle- 
repetitive sequences, as indicated by the 
increase in the fraction of fragments re- 
associating with this component in the 
long tracer. Some of the single-copy 
and/or middle-repetitive sequences also 



246 



CARNEGIE INSTITUTION 



appear to be interspersed with sequences ment length of 1200 nucleotides. In mung 
in the "very fast" fraction, although (as beans, the major class of repetitive se- 



in pea DXA) these sequences do not 
constitute a major fraction of the genome. 
In summarizing our results on the pea 
and mung liean genomes we are impressed 
bv both similarities and differences. Both 



quences is similar to the slow repeated 
component in peas and is interspersed 
primarily with single-copy DNA. 

We believe that further studies of se- 
quence organization and transcription in 



genomes are organized according to the such different genomes may help to de- 



general pattern which characterizes the 
DXA of most animal species examined 
(Davidson, et al., 1975). In both species 
a significant fraction of the genome is 
organized in a short-period interspersion 
pattern, in which single-copy sequences 
average 700-1000 nucleotides in length. 
Much of the interspersion observed with 



termine which aspects of sequence or- 
ganization have functional significance. 

References 

Davidson, E. H., B. R. Hough, C. S. 
Amenson, and R. J. Britten, J. Mol. 
Biol 77, 1-23, 1973. 

1200-nucleotide fragments in both ge- Davidson, E. H., G. A. Galau, R. C. 
nomes is attributable to middle-repetitive Angerer, and R. J. Britten, Chromo- 
sequences. However, the mung bean ge- soma 51, 253-259, 1975. 

nome contains a larger fraction of single- Flavell, R. B., and D. B. Smith, Heredity 
copy DXA than does the pea genome, 37, 231-252, 1976. 
and a much larger fraction of the mung Graham, D. E., B. R. Neufeld, E. H. 
bean single-copy sequences are arranged Davidson, and R. J. Britten, Cell 1, 
in a long-period interspersion pattern. 127-137, 1974. 

Pea DXA contains a large component Smith, D. B., and R. B. Flavell, Biochim. 
of rapidly reassociating repeated se- Biophys. Acta J^7I^, 82-97, 1977. 
quences in addition to a more slowly Walbot, V., and L. S. Dure, J. Mol. Biol. 
reassociating component. These two re- 101, 503-536, 1976. 
peated sequence classes are significantly Zimmerman, J. L., and R. B. Goldberg, 
interspersed with one another at a frag- Chromosoma 59, 227-252, 1977. 



5IXGLE-COPY DNA SEQUENCE COMPARISONS IN Atriplex 
Heather S. Belford and William F. Thompson 



In the past year we have continued 
the single-copy DX^A sequence compari- 
son studies in the genus Atriplex. The 
number of species included in the survey 
was larger than previously, and some 
major technical modifications were made. 
Our objective has been to investigate the 
apparent disagreement between the clas- 
sical phylogenetic interpretation (Hall 
and Clements, 1923) and the interpreta- 
tion derived from recent genetic (Nobs, 
Year Book 75, pp. 421-423, 1976) and 
molecular (Belford and Thompson, Year 
Book 75, pp. 362-367) hybridizations. 



The classical scheme is a double-branched 
tree in which the C4 photosynthetic spe- 
cies of both sub-generic branches evolved 
from C3 ancestors. The current data 
suggest instead that the two main species 
groups are quite distinct in their evolu- 
tionary heritage. 

The species included in our present 
work are: A. hortensis (C3), A. triangu- 
laris (C.i), A. sabulosa (C4), andvl. rosea 
(C4) from the subgenus Euatriplex; and 
A. phyllostegia (C3) and A. serenana 
(C4) from the subgenus Obione. A. 
truncata (C4) (Obione) DNA has been 



DEPARTMENT OP PLANT BIOLOGY 



247 



prepared for inclusion in future experi- 
ments. These species have been chosen to 
represent major species groups in the 
classical scheme. In addition, A. fruti- 
culosa, a species of Obione which forms 
fertile hybrids with A. serenana (Nobs, 
Year Book 75, pp. 421-423), has been 
included to provide a ''control" combina- 
tion of species known to be closely re- 
lated genetically. A similar combination 
will be obtained in future experiments 
between A. rosea and A. sabulosa. 

DNA has been extracted from each 
species and sheared to a length of about 
400 base pairs in a Vir-Tis "60" homog- 
enizer (Britten et al, 1974). DNA highly 
enriched for single-copy sequences was 
prepared by heat-denaturing and re- 
associating DNA (in 0.12 M sodium 
phosphate buffer at 60°C or 0.6 M 
sodium phosphate buffer at 66°C) to an 
equivalent Cot of 350. After reassociation 
the mixtures were, diluted to 0.12 M 
sodium phosphate and chromatographed 
on hydroxylapatite at 60°C. Approxi- 
mately 25% of the total OD260 was re- 
covered in the unbound fraction as un- 
reassociated, primarily single-copy se- 
quence DNA. The single-copy fraction 
was purified over AG-50WX8 cation ex- 
change resin (Bio Rad) and chelex-100 
and then used to prepare radioactively 
labeled sequences for molecular hybridi- 
zations. 

In the current studies, the in vitro 
iodination procedure previously used was 
replaced by an oligonucleotide-primed 
E. coli polymerase I reaction that allows 
incorporation of ^^C- or ^H-labeled de- 
oxyribonucleotide triphosphates. This 
technique permits double-labeled experi- 
ments in which both homologous and 
heterologous tracer reactions may be fol- 
lowed in the same mixture. The homolo- 
gous reaction serves as an internal con- 
trol in each experiment, thus eliminating 
some of the variability possible between 
separate experiments. Radioactively la- 
beled E. coll polymerase I copies were 
made from Atriplex single-copy sequences 
according to the standard protocol de- 



tailed in this Year Book, (Murray, Bel- 
ford and Thompson). Each reaction gave 
an average of 60-70% copy with a frag- 
ment length of 250-300 base pairs as: 
determined by alkaline agarose gel elec- 
trophoresis. The DNA copy was purified 
from the enzyme mixture by hydrox- 
ylapatite chromatography in 8 M urea 
(Britten et ai, 1974). About 25% of the 
labeled product renatures extremely 
quickly even at very low concentrations, 
indicating that it contains intrastrand 
complementary sequences. Fragments 
containing these intrastrand comple- 
mentary or ''foldback" sequences can be 
removed (''stripped") from the purified 
copy DNA by denaturation followed by 
rapid cooling to 60°C and immediate 
hydroxylapatite fractionation. Labeled 
copies were prepared from single-copy 
DNA fractions for each of the eight 
Atriplex species, purified, and stripped 
of foldback to yield clean-copy DNA 
with specific activities of approximately 
6.6 X 10^ cpm/fxg. 

In previous Atriplex hybridization ex- 
periments the species from which the 
radioactive tracer DNA was obtained 
was held constant while the driver DNA 
species was varied. To continue this 
strategy in the current expanded study 
would involve the extraction from each 
species of large quantities of DNA, which 
was impractical in several cases. There- 
fore, we have modified our experimental 
design to vary the tracer DNA species 
while holding the driver species constant. 

To date, we have hybridized single- 
copy tracers from A. fruticidosa, A. phyl- 
lostegia, A. rosea, A. sabulosa, A. tri- 
angularis and .4. hortensis with an excess 
of unlabeled total DNA from A. serenana. 
Each interspecies cross has been ana- 
lyzed in terms of complementarity within 
homologous sequences and extent of cross 
reactivity. Mismatch estimates were 
derived from the thermal denaturation 
("melting") profiles of the hybrid mole- 
cules to provide a measure of comple- 
mentarity. Any degree of mismatch in a 
duplex molecule lowers the Tm (the tern- 



~0 

c 

D 

o 

_Q 

C 

o 

u 
D 






1 
- oo- - 


1111 


I 
A. serenana 


- 




• 






- 


a2 


- 


• .N^ OO *^0 O 




" 




- 


>v " O* ^0 




- 


0.4 


- 


\ . ° "xO 




- 




- 


^Vv "^^ ^o o 




- 


0.6 


" 


^-i->l^. ^^^^°^ 


X 8 


* 




^ 


"X..,,^ \ 


«i 




- • 


- . -^S^ s 


X 

d^DOQ O 




0.8 






^, o^'^-og O O O 




1.0 



1 


1 1 "" - 1- 1 


^^^^V-OJ,^. 








A. horfensis 


- 






" ■ — *w^ ^ 
































0.2 


~ 




^ 


~ 






X 
X 
X 


^^^^.^^ 




0.4 


■- 




— ^— _ 


- 




- 


X 


• 


- 


0.6 


*~ 


\ 




"■ 




— ' ....____^ ^ 




- 




N 


" 


0.8 






r ■ 


- 


1.0 



1 


1 1 1 1 






A. fruficulosa 


- 




'* ~"^~^ — — — ^ 






** •• > 








" 


-^^-~v^ 






0.2 


h- 






" 




' 






■ 


0.4 


- 


^S^ X X. 

N. X > 

\ X 




- 


06 


- 


\ X 
\ X 

X X 

\^ X 


N! 


~ 








^N^ ^^""•"V— -«— 




0.8 








- 


1 n 


1 


^1 ■ ~~ ~-r--_ , , 







I 2 3 

Log equivalenf Co+ 



Fig. 31. Rea.ssociation kinetics for total cell DNA from A. serenana and single-copy tracers 
from A. serenana, A. horlensin, and A. jruticulosa. Top panel: Driver (•) and tracer (O) 
kinetics for A. serenana self-reactions. Data were pooled from four independent experiments. 
Curves through the data points represent least-squares fits to the data using two theoretical 
second-order components for the tracer data and three for the driver. The theoretical compo- 
nents from the tracer fit are indicated by the light dashed lines. Middle and bottom panels: 
Reassociation of tracers from A. hortensis and A. jruticulosa in the presence of excess A. 
serenana driver DNA. Lines through the data points represent least squares fits for two com- 
ponenta, u.sing the equation for retarded kinetics described in the text. The theoretical com- 
ponents of each fit are represented by solid lines in the lower part of each panel. Dashed lines 
representing the reaction of A. serenana tracer have been included to facilitate comparison. 



DEPARTMENT OF PLANT BIOLOGY 



249 



perature at which half of the duplex 
molecules are separated into single 
strands) below that for native DNA. The 
/\Tm between homologous and heterolo- 
gous hybrid molecules indicates the 
amount of mismatch or base sequence 
divergence between the hybridized se- 
quences. A /\Tm of 1°C is generally in- 
terpreted to indicate about 1% base pair 
mismatch (Bonner, et al., 1973). 

To measure sequence homology be- 
tween single-copy sequences able to form 
hybrids under our reaction conditions, 
interspecies hybrids were bound to hy- 
droxylapatite at 60°C in 0.12 M sodium 
phosphate buffer and eluted with 0.075 
M sodium phosphate buffer at increasing 
temperatures. The elution buffer molarity 
was lowered to 0.075 M to ensure that all 
DNA eluted from the hydroxylapatite 
column with increasing temperature was 
the result of thermal denaturation rather 
than of a decrease in affinity of the 
hydroxylapatite for the double-stranded 
DNA (Martinson and Wagenaar, 1977). 

Thermal denaturation curves were con- 
structed for hybrid molecules formed at 
two Co^ values, equivalent Co^ 884 and 
equivalent Cot 28,275. A 1000-fold to 
2500-fold excess of total A. serenana 
DNA at 5 mg/ml was mixed with the 
heterologous ^"^H-tracer and homologous 
^^C-tracer species, each at 2-5 /xg/ml. 
The mixtures were heat-denatured and 
reassociated at 66 °C (approximately Tm 
— 25°C) in 0.6 M sodium phosphate 
buffer. Under these conditions the tracers 
are too dilute to interact significantly 
with themselves and thus any labeled 
hybrids formed are the result of reaction 
with the driver species. Most of the 
single-copy fractions isolated at equiva- 
lent Cot 350 contain some contaminating 
repetitive sequences (see Fig. 31, the 
homologous reaction component curves). 
Precautions were therefore taken to mini- 
mize the contribution of contaminating 
repetitive sequences to the melting pro- 
files since we wished to measure homol- 
ogy of single-copy sequences. All repeti- 



tive-sequence contaminants should be 
reacted at the early Cot point, and any 
duplex formation occurring between the 
early and late Cot points should there- 
fore involve only single-copy sequences. 
Thus we have subtracted the hybrid 
melting curves of the rapidly reacting 
duplexes from those of duplexes formed 
at the high Cot value to produce corrected 
curves for single-copy duplexes. These 
corrected curves were used to determine 
values for the ATm between homologous 
and heterologous hybrid duplexes. 

This correction has a very small effect 
on the ATm values observed in Table 4, 
even in cases where significant repetitive 
sequence contamination is present. In 
preliminary experiments wdth total DNA 
we observed much lower interspecific 
ATm values for repetitive sequences than 
for single-copy DNA; similar observa- 
tions have been made for Xenopus (Galau 
et al, Year Book IJ^^ pp. 711-723), pri- 
mates (Deininger and Schmid, 1976) and 
Osmundaceous ferns (Stein, unpublished) . 

Table 4 summarizes the results of our 
experiments. The ATm values range be- 
tween 1.5°C and 6.5°C. All but one of 
the values are clustered in the 5.5°-6.5°C 
range. The exceptional case, with a A^m 
of only 1.5°C, involves A. fruticulosa, 
which is interfertile with the reference 
species A. serenana. The other species, 
irrespective of subgenus classification or 
photosynthetic mechanism, seem to be 
almost equally distinct from .4. serenana. 

In our previous experiments using ^^^I 
A. hortensis single-copy tracer, we found 
a ATm between A. hortensis and .4. 
serenana of 8.0°C {Year Book 75, pp. 
362-367), compared to the 6.5°C ob- 
served with our present techniques. In 
the former experiments, the AT„i had to 
be estimated by comparing two separate 
melting profiles from incubations with 
A. hortensis and .4. serenana driver DNA. 
We feel that greater accuracy is achieved 
with the present procedure, in which two 
tracers are reassociated and melted to- 
gether with the same driver DNA. ^lore 



250 



CARNEGIE INSTITUTION 



TABLE 4. Summary of Cross Reactivity of Enriched Single-Copy Tracer Sequences with 

A. sercnana Total DNA Driver Sequences* 











Sinsile-Copv 


STm at Equiv 


alent Cot 






Photosvn 


thet 


ic 


N 


ormalized - 






Corrected 


Tracer 


Pathw 


■^y 


Subgenus 




x-Rxn 


884 


28,275 


AT„» 


A. fruticulosa 


a 




Obione 




0.85 


1.5 


2.5 


1.5 


A. sabulosa 


a 




Euatriplex 




0.65 


4.5 


4.75 


5.0 


A. rosea 


C4 




Euatriplex 






5.75 


t 


t 


A. hortensis 


a 




Euatriplex 




0.45 


6.5 


6.5 


5.25 


A. truingularis 


a 




Euatriplex 




0.51 


5.0 


6.5 


6.25 


A. phi/Uostcgia 


c. 




Obione 






6.5 


t 


t 



* The extent of cross reactivity is normalized with respect to the reactivity observed for 
A. screrwJia tracer in each reaction. The ATm is the difference between the Tm values for 
homologous and heterologous hybrid molecules in each reaction. The corrected ATm is derived 
from the curve of the difference between high and low Cot thermal denaturations. 

t Data for the difference denaturation profiles was not reliable because thermal degradation 
was observed at high Cot values. However, the homologous tracers in these reactions were 
relatively free of repetitive-sequence contaminants. Therefore, low Cot ATm values are as- 
sumed to represent an accurate ATm for comparative purposes. 



importantly, the use of 0.075 M rather 
than 0.12 M sodium phosphate buffer 
probably gives a much more realistic 
estimate of strand separation (as opposed 
to duplex elution) in these experiments 
(Martinson and Wagenaar, 1977). 

The extent of cross reactivity between 
each single-copy tracer and A. serenana 
DXA was also measured by comparison 
of the heterologous and homologous re- 
association kinetics. Mixtures were made 
up and incubated as for the thermal 
denaturation curves. At increasing Cot 
values, aliquots of each mixture were 
chilled, diluted into 0.12 M sodium 
phosphate, and fractionated on hydrox- 
ylapatite at 60°C. Figure 31 shows the 
results of the hybridization of A. serenana 
total DNA with the single-copy tracers 



from A. hortensis and A. fruticulosa. 
Theoretical second-order components 
have been fitted to the data for the A. 
serenana self-reactions by a least-squares 
procedure, using a computer program 
supplied by Dr. Eric Davidson and 
adapted to our computer by Mr. Glenn 
Ford. 

Mismatched single-copy heteroduplexes 
form at reduced rates, relative to the 
rate of A. serenana self-reassociation. 
Heterologous reactions may therefore be 
incomplete at the highest attainable Cot 
values, simply because no unreassociated 
A. serenana DNA remains to drive fur- 
ther reaction of the tracer. To estimate 
potential cross reactivity in such cases 
we have fitted the heterologous reaction 
data using the expression 



G/Go = J + F, n + KmCot)-^ 



+ F., 



(l+Ko2Cot) -'■'''' exp 



/ 0.25T\:i-{l+Kr>2Cot)^^^] \ 
\ 056 / 



G^Gf, is the fraction of the tracer re- rate constants of Koi and Ko2j respec- 

maining single-stranded at a given Cot, tively. T is the retardation coefficient 

J is the fraction incapable of reaction, (i^2. tracer/^/) 2) estimated from the ex- 

F, and Fo are the fractions of the tracer perimentally determined AT^ of the 

reacting with driver components having heterologous duplexes using the data of 



DEPARTMENT OF PLANT BIOLOGY 251 

Bonner et al. (1973). Repetitive se- feel that the lar^e differences in DNA 

quences contaminating the tracer prepa- homology previously observed between, 

rations are assumed to react at the same for instanc(;, A. hortensis and either A. 

rate (Kdi) as the most slowly reassoci- triangularis or A. sabulosa, make this 

ating driver repeats. The expression for hy[)othesis much more complicated and 

the retarded reassociation kinetics of the less tenable. 

single-copy component was derived by Support for the assumption that ge- 
Galau et al. (Year Book 74, pp. 711- nome sizes do differ significantly among 
723).^ It permits us to extrapolate from different Atriplex species can be derived 
the observed data to estimate the theo- from a comparison of the rate of single- 
retical potential cross reactivity for copy sequence reassociation observed 
various tracers. Examples of such extra- previously for A. hortensis with that ob- 
polated fits are shown in Fig. 31. Table 4 served here for A. serenana. The A. 
gives the fraction of single-copy tracer serenana rate is significantly faster than 
sequences capable of cross reacting with that for A. hortensis, even after correct- 
single-copy sequences of A. serenana for ing for the effects of the different buffer 
the four cases in which suitable kinetic systems used in the two sets of experi- 
data are presently available. ments, which suggests that the A. serenana 

Cross reactivity was highest with A. genome is substantially smaller than that 

jruticulosa, as was expected from the of A. hortensis. Further experiments are 

hybrid thermal stability and genetic planned to extend this analysis to other 

hybridization results mentioned above, species. 

Significantly lower values were obtained The new data presented here for both 

in reactions with the other tracers; 35- cross reactivity and hybrid thermal sta- 

55% of the single-copy sequences in these bility support our previous conclusion 

three Euatriplex species were apparently that the main species groups in Atriplex 

unable to react with sequences in the are quite distinct from one another and 

A. serenana genome under our incuba- that lines leading to the various groups 

tion conditions. In the case of A. /lor^ensis, probably originated from an ancestral 

the 45% cross reaction observed here stock at about the same time. Our data 

agrees well with the value of 48% we are clearly inconsistent with any scheme 

obtained previously (Year Book 75, pp. such as that of Hall and Clements (1923) 

362-367). The iodinated A. hortensis in which separation of the Euatriplex and 

tracer used in the earlier experiments Obione subgenera is assumed to have 

contained about 5% repeated sequences, occurred much earlier than divergence of 

which probably contributed to the total the lines leading to the main species 

cross reaction. groups within each subgenus. We there- 

We are assuming that the DNA which fore suggest that conclusions based on 
fails to cross-react with A. serenana DNA such schemes should be carefully re- 
is composed of sequences which were evaluated. Although we cannot exclude 
eliminated in the evolution of present- the possibility that C^ photosynthesis 
day A. serenana away from the main evolved independently in two or more 
generic branch. Addition of new DNA lines, our data suggest that any such 
sequences to the other species groups lineages must have had their origin at 
(e.g., by hybridization with a species in nearly the same time. For the present, it 
another genus) is also possible, but we appears simpler to assume that several 

lines leading to the contemporary C4 
species groups separated from a single C4 

iT^v.^ „ +-^ • + J • +1 • 4.U stock early in the historv of the genus, at 

I he equation was printed incorrectly in the '^ . -^ . ^ 

original publication. Dr. Roy Britten has con- about the tmie the other major evolu- 

firmed that the one given here is correct. tionary lines originated. 



252 



CARNEGIE INSTITUTION 



References Deininger, P. L., and C. W. Schmid, 

Bonner. T. L. D. J. Brenner, B. R. Xeu- Scitmce 194, 346-348, 1976. 

ieklaudR. J. Britten, J. Mol. Biol 81, Hall, H. M., and F. E. Clements, Car- 

123-135, 1973. negie Inst. Wash. Publ. 826, 1923. 

Britten, R. J.. D. E. Graham, and B. R. Martinson, G. G., and E. B. Wagenaar, 

Xeufeld. Methods Enzi/moi :39, 363- Biochim. Biophys. Acta 474, 445-455, 

418, 1974. ^ 1977. 



INTERSPECIFIC HYBRIDIZATION OF FERN DNA 



Diana B. Steiji^ and William F. Thompson 



Osmunda regalis, 0. claytoniana, and 
0. cinnamomea are three ferns whose 
taxonomic relationship has been a source 
of controversy for almost 70 years. We 
have been studying relationships among 
these species by means of DNA sequence 
comparisons. Analysis of interspecific 
duplexes formed with labeled 0. clay- 
toniana DNA originally suggested that 
this species was more closely related to 
0. cinnamornea than to 0. regalis (Stein 
and Thompson, 1975; Year Book 74, pp. 
786-789 1 . This conclusion was based on 
several measurements of the number and 
thermal stability of duplexes formed 
under a wide variety of reassociation 
conditions. However, all these experi- 
ments used DNA prepared from a single 
collection of fronds of each species, and 
subsequent experiments with DNA from 
different collections showed less homol- 
og>' between 0. claytoniana and 0. cin- 
namomea than had been observed ini- 
tially. We have attempted to identify the 
source of this discrepancy and to deter- 
mine the range of variation in the results 
of inter.'^pecific hybridizations between 
different DNA preparations or between 
tissue samples; in our experiments DNA 
samples obtained from separate fern 

^ Pro5!ont addrf'.s.s: Dfpartmont of Zoology, 
University of Ma.ssarhusot.ts, Amhfr.st, Massa- 
chu.setts 01003. 



populations at different seasons in four 
different years were used. 

DNA was isolated, sheared, and iodi- 
nated as previously described (Stein and 
Thompson, 1975; Year Book 74, pp. 786- 
789). 0. claytoniana DNA was used as 
the tracer DNA in these experiments, 
since its position relative to the other 
two species was in question. Aliquots of 
labeled DNA were mixed with a 1,000- 
fold to 5,000-fold excess of DNA from 
0. cinnamomea, 0. regalis, or 0. clay- 
toniana; the mixtures were denatured 
and incubated at 42° in 50% formamide 
containing 1.0 M NaCl and 10 mm Pipes 
buffer, pR 6.7-6.9 to a Cot of 2000. At 
this Cot virtually all repeated sequences 
(but few single-copy sequences) have 
become reassociated. Duplexes were then 
adsorbed to hydroxy lapatite in 0.12 M 
sodium phosphate buffer and subjected to 
thermal elution. 

A typical thermal elution profile ob- 
tained with the 1975 DNA's is shown in 
Fig. 32. The T^ (temperature at which 
50% of the adsorbed DNA has been 
eluted) reflects the average precision of 
base pairing in a given population of 
duplexes, and the AT^, or difference in 
7\n between inter- and intra-specific 
duf)lcxes, provides an indication of the 
flegree of sequence divergence for a given 
[)air of species. The results of eight such 



DEPARTMENT OF PLANT BIOLOGY 



253 







r — I 1 I 1 


\ 


—^f— 


r 


— 




100 














-o .A^ 


■l: " " 


■^ 






T3 




-• ' ' ■•^^'^ 










<^ 




'^'•'' X 










D 


80 


/y^ / 








- 


Q) 




/. ' ' / 










.^ 




*•' / 










C 




f / / 










o 

l_ 


60 










- 


0) 




/." / / 










a 




/'■ / / 










(^ 




/• / / 










> 


40 


.'■ rl J 








- 


-^ ■ 




' y^ 9 















/■ / r 










3 

E 




jf / / 










3 


20 



>f^^^^^ 1^ 1 1 1 


1 


—'—ii— 


1 





65 70 75 80 85 90 95 0.4MNaPB 

Temperature, C 

Fig. 32. Thermal elution profiles for sheared native 0. claytoniaua DNA (•) and duplexes 
formed between 0. claytoniana ^^T tracer and unlabeled DNA from 0. claytoniana (O), 0. 
cinnamomea (A) or 0. regalis (□) (1974 preparations of DNA). Except in the case of native 
DNA, appropriate samples were heat-denatured and incubated as described in the text. Dupli- 
cate samples for each species were then diluted 200-fold with 0.12 M sodium phosphate buffer 
(pH 6.8), sonicated briefly, and applied to hydroxylapatite at 60°C. After the columns were 
washed to remove single-stranded DNA, thermal elution was performed by raising the tem- 
perature of the column in increments of 5°C and eluting with 0.12 M sodium phosphate buffer 
at each temperature. Results are presented as the cumulative percentages of initially bound 
DNA eluted at each temperature. 



experiments are summarized in Table 5 
in terms of ATm values. The data show 
that, with the exception of the samples 
from the 1973 collections, DNA's from 
0. regalis and 0. cinnamomea appear to 
be about equally diverged from that of 
0. claytoniana. Variation between experi- 
ments utilizing DNA's from one extrac- 
tion is small, as is the variation observed 
from year to year — with the exception 
of 1973. 

Several variables in experimental pro- 
cedure were examined in an attempt to 
explain the apparent close homology be- 
tween 0. cinnamomea and 0. claytoniana 
observed in the 1973 collections. These 
variables included sonication of the 
duplexes to disrupt any aggregates before 
application to hydroxylapatite, iodina- 
tion of DNA fragments in double- 
stranded versus single-stranded form, 
different ratios of tracer to driver DNA, 



and possible fragment length effects. 
None of these factors produced signifi- 
cant changes in AT^ values. 

To ascertain whether it was 0. clay- 
toniana or 0. cinnamomea DNA that 
behaved differently in the 1973 prepara- 
tions, 1975 0. claytoniana tracer was 
reassociated separately with 1973 and 
1975 0. cinnamomea DNA. Nearly iden- 
tical thermal elution profiles were ob- 
tained for both hybrid populations (Fig. 
33). The AT„, was about 4.2° in both 
cases, which is within the range of values 
obtained for all other experiments with 
post- 1973 preparations. When 1973 0. 
claytoniana DNA was used to prepare 
the tracer for a similar experiment with 
the same two preparations of 0. cinna- 
momea driver, it was again observed 
that the hybrids formed with the two 
driver DNA's had nearly identical ther- 
mal elution profiles. However, in this 



254 



CARNEGIE INSTITUTION 



TABLE 5. Comparison of Data from Experiments with ^"''I-labeled 0. claytoniana Tracer 

under Standard Conditions* 



Collection Date 



lodinationj 



ATm for Hybrids with 



0. cinna}7Wt)ica 



0. rcgalis 



Sept. 1973t 
August 1974 



>ept. 1975 



June 1976 

Mrnn ± -tandard deviation (1974-1976) 



DS§ 

ss§ 
ss 
ss 
ss 

DS 

SS 

ss 
ss 



1.5X 

3.6 

4.5 

3.8 

3.8 

3.7 

4.0 

4.5 



2.8°C 

3.8 

4.0 

3.8 

3.5 

3.2 

4.0 

3.5 



4.01 ±0.35 



3.69 ± 0.30 



* Incubation in 507c formamide, 1 M NaCl, 0.01 M Pipes (pH 6.7-6.9) at 42° to Cot = 
2.000. 

t A large number of experiments involving various reassociation conditions were carried out 
with the. 1973 DNA; although absolute ATm values varied with the different conditions, results 
were always qualitatively the same. 

t lodination conducted using double-stranded (DS) or single-stranded (SS) DNA. 

§ In these experiments, reassociated duplexes were sonicated briefly to disrupt large hyper- 
polymers before being apphed to hydroxylapatite. 

il 1973 0. cinnamomea driver was used in this experiment. 



100 - 



no 

•*- 

Q) 

C 
O 

u 

«» 

a 

> 

E 




65 70 75 80 85 90 95 0.4MNaPB 

Temperature, °C 

Fig. .33. Thermal elution profiles for sheared native 0. claytoniana DNA (•) and duplexes 
formed between 1975 0. cl/jytoni/ma ^^T tracer and unlabeled DNA from 1975 preparations of 
O. cUiytoni/ina (O), 0. cinnamomea (A), 0. regalis (\J), and the 1973 preparation of 0. 
cinnamomea (V). Experimental method5 were as described for Fig. 32 except that reassociated 
DNA'.s were not .sonicated before application to hydroxylapatite. Triplicate samples represented 
by a single point when values were the same. <x indicates coincidence of data points for the 
two preparations from different years. 



DEPARTMENT OF PLANT BIOLOGY 



255 



case the l\Tm was only about 2.2°, 
which is close to the value ol)served in 
the 1973 experiments. The /\Tm meas- 
ured with 1975 0. regalis driver was 
nearly the same (3.5 vs 4.0°) whether 
1973 or 1975 0. claytoniana tracer was 
used. Thus it was possible to reproduce 
the 1973 results merely by substituting 
1973 0. claytoniana tracer in experiments 
with the later preparations, and we con- 
clude that the 0. claytoniana prepara- 
tion was primarily responsible for the 
difference between our results with 1973 
and results with later preparations. 

This conclusion was confirmed by an 
experiment designed to compare the 1973 
and 1975 0. claytoniana preparations 
directly. DNA from each of the two 
preparations was iodinated in parallel 
reactions and the resulting tracers tested 
for their ability to reassociate with un- 
labeled 0. claytoniana DNA from 1975. 
After incubation to Cot 2,000, 76% of 
the 1973 tracer and 86% of the 1975 
tracer had reacted. Too little of the 1973 
tracer was left for its reactivity with the 
1973 driver to be measured, and thus we 
do not have a rigorous control for this 
experiment. However, we have observed 
between 85% and 89% self-reassociation 
in all previous experiments. We therefore 
believe that the lower cross reactivity 
observed with the 1973 tracer indicates 
that the 1973 0. claytoniana preparation 
contained sequences which were not 
present in later preparations from this 
species. 

Since the 1973 0. claytoniana DNA 
also showed more homology with 0. cin- 
namomea than did later preparations, it 
is reasonable to assume that some se- 
quences from the 0. cinnamomea genome 



were present in this DNA. This circum- 
stance could be explained in either of 
two ways. Some 0. cinnamomea fronds 
might have been inadvertently mixed in 
with the 0. claytoniana collection that 
year. (These two ferns are so similar in 
appearance that fertile fronds must be 
present for positive identification.) Al- 
ternatively, it is possible that the sup- 
posed 0. claytoniana material collected 
in 1973 came from a population of 0. 
claytoniana X 0. cinnamomea hybrids. 
Such putative hybrid populations are 
currently being investigated by H. Ahles 
(personal communication). There is evi- 
dence that hybridization does occur 
within this group, in the reported occur- 
rence of a hybrid between 0. regalis and 
0. claytoniana var. Rugii (Try on,* 1940). 
It is noteworthy that, with the single 
exception of the 1973 0. claytoniana 
preparation, we have seen very little 
variation in results from different ex- 
periments, including ones using different 
DNA preparations and tissue collections. 
The sensitivity of these comparisons thus 
appears to be quite high. Since the 1973 
0. claytoniana DNA probably originated 
either from a natural hybrid population 
or from an inadvertently constructed 
"hybrid" mixture of tissue, the repro- 
ducible differences between this and sub- 
sequent preparations suggest that molec- 
ular hybridization techniques may be 
sensitive enough to permit future studies 
of natural hybrids, and perhaps even 
races or sibling species. 

References 

Stein, D. B., and W. F. Thompson. Sci- 
ence 189, 888-890, 1975. 
Tryon, R., Amer. Fern J. 30, 65-66, 1940. 



CONTAMINANTS AFFECTING PLANT DNA REASSOCIATION 

Michael G. Murray and William F. Thompson 



Studies of DNA reassociation, sequence partly because it has been harder to ob- 
organization, and evolution have been tain sufficiently pure plant DNA in the 
more difficult in plants than in animals, required quantities. Most plant tissues 



256 



CARNEGIE INSTITUTION 



contain low concentrations of DNA and 
high concentrations of materials such as 
tannins and soluble polysaccharides 
which are difficult to separate from DNA 
by conventional techniques. Recent prog- 
ress in plant genome organization has 
been greatly facilitated by development 
of new isolation procedures. An essential 
step in most such procedures involves the 
selective binding of DNA to hydrox- 
ylajxitite in the presence of 83/ urea and 
0.24 -)/ sodium phosphate buffer, with or 
without other additives such as NaC104, 
SDS, EDTA. or 2-mercaptoethanol 
(Britten et a/.. 1974). RNA, protein, 
tannins, and the majority of cellular 
polysaccharides can usually be removed 
by washing the hydroxylapatite with 
urea-phosphate buffer prior to eluting the 
DNA with 0.4 or 0.5 M sodium phosphate. 
Hydroxylaj^atite chromatography alone 
can yield DNA that appears to be pure 
by the standard criteria such as ultra- 
violet absorption spectra, thermal dena- 
turation profiles in standard buffer sys- 
tems, and analytical CsCl gradients. 
However, as normally applied all these 




Fig. 34. Schlieren photograph of an over- 
loaded analytical CsCl gradient containing pea 
DNA purified by hydroxylapatite chromatog- 
raphy, RXa.se and prona.se digest ion.s, followed 
by chloroform/octanol extraction and ethanol 
precipitation. A .solution containing 1.89 mg/ml 
DX.\ in 10 mM .sodium acetate, pH 7.0 wa.s 
adjusted to an initial den.sity of 1.696 g/cc with 
.solid CsCl and centrifuged at 44,700 rpm for 
44 hr at 21 "C in an AN-D rotor using a 12-mm 
single sector cell. Precipitated contaminants 
formed an opaque band above the DNA caus- 
ing the dark vertical line in the photograph. 



criteria are sensitive only to contaminants 
that have significant absorption in the 
tiltraviolet. We have recently observed 
that plant DNA prepared by the hy- 
droxylapatite procedure can be signifi- 
cantly contamined by polysaccharide- 
like impurities even though they appear 
pure by these standard criteria. Figure 
34 shows the schlieren profile obtained 
from an overloaded analytical CsCl 
gradient containing pea DNA purified 
by hydroxylapatite chromatography. In 
addition to the typical schlieren pattern 
of the DNA band, we observe a vertical 
line in the photograph corresponding to 
precipitated material of a slightly lower 
density than the DNA. This precipitate 
band could be observed visually in the 
cell. Its density suggests that it is com- 
posed principally of polysaccharide (s), 
although as yet we h